ID: 914690902

View in Genome Browser
Species Human (GRCh38)
Location 1:150025855-150025877
Sequence CTGAAAAAAGAGATGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914690900_914690902 -6 Left 914690900 1:150025838-150025860 CCACATGAATTACACAACTGAAA No data
Right 914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG No data
914690897_914690902 -3 Left 914690897 1:150025835-150025857 CCCCCACATGAATTACACAACTG No data
Right 914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG No data
914690893_914690902 29 Left 914690893 1:150025803-150025825 CCCTAGAGCAATTATTGTGGCAG No data
Right 914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG No data
914690894_914690902 28 Left 914690894 1:150025804-150025826 CCTAGAGCAATTATTGTGGCAGG No data
Right 914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG No data
914690898_914690902 -4 Left 914690898 1:150025836-150025858 CCCCACATGAATTACACAACTGA No data
Right 914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG No data
914690899_914690902 -5 Left 914690899 1:150025837-150025859 CCCACATGAATTACACAACTGAA No data
Right 914690902 1:150025855-150025877 CTGAAAAAAGAGATGTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914690902 Original CRISPR CTGAAAAAAGAGATGTGGTC AGG Intergenic
No off target data available for this crispr