ID: 914698375

View in Genome Browser
Species Human (GRCh38)
Location 1:150107222-150107244
Sequence CTGAATATACAGATGTCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914698368_914698375 19 Left 914698368 1:150107180-150107202 CCCATGGCTTCAGCTACCACATA No data
Right 914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG No data
914698369_914698375 18 Left 914698369 1:150107181-150107203 CCATGGCTTCAGCTACCACATAT 0: 2
1: 0
2: 5
3: 37
4: 270
Right 914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG No data
914698373_914698375 3 Left 914698373 1:150107196-150107218 CCACATATTCGGGGAAAGCACTA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914698375 Original CRISPR CTGAATATACAGATGTCTAG TGG Intronic
No off target data available for this crispr