ID: 914703306

View in Genome Browser
Species Human (GRCh38)
Location 1:150152000-150152022
Sequence AGAATACCTCCCGTGAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914703306_914703312 3 Left 914703306 1:150152000-150152022 CCCGCCCTCACGGGAGGTATTCT No data
Right 914703312 1:150152026-150152048 TTCCCTCACCCAGGGCTAACTGG No data
914703306_914703311 -5 Left 914703306 1:150152000-150152022 CCCGCCCTCACGGGAGGTATTCT No data
Right 914703311 1:150152018-150152040 ATTCTGTGTTCCCTCACCCAGGG No data
914703306_914703310 -6 Left 914703306 1:150152000-150152022 CCCGCCCTCACGGGAGGTATTCT No data
Right 914703310 1:150152017-150152039 TATTCTGTGTTCCCTCACCCAGG 0: 1
1: 0
2: 1
3: 16
4: 198
914703306_914703313 4 Left 914703306 1:150152000-150152022 CCCGCCCTCACGGGAGGTATTCT No data
Right 914703313 1:150152027-150152049 TCCCTCACCCAGGGCTAACTGGG 0: 1
1: 0
2: 1
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914703306 Original CRISPR AGAATACCTCCCGTGAGGGC GGG (reversed) Intronic
No off target data available for this crispr