ID: 914703421

View in Genome Browser
Species Human (GRCh38)
Location 1:150152941-150152963
Sequence TGACCTCAGCCTAGGATATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914703416_914703421 15 Left 914703416 1:150152903-150152925 CCTTGCTTTTAGGTACAGAGACA 0: 1
1: 0
2: 1
3: 15
4: 199
Right 914703421 1:150152941-150152963 TGACCTCAGCCTAGGATATCTGG 0: 1
1: 0
2: 1
3: 4
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914703421 Original CRISPR TGACCTCAGCCTAGGATATC TGG Intronic
904106074 1:28085362-28085384 TGACTTCAGCCCAGGAGGTCAGG + Intronic
906567644 1:46812335-46812357 TGCCCTCACCCTAGGCTACCAGG - Intronic
907004550 1:50897914-50897936 TGATCTCATCAGAGGATATCAGG + Intronic
914703421 1:150152941-150152963 TGACCTCAGCCTAGGATATCTGG + Intronic
917034550 1:170733163-170733185 AGTCCTCAGACTAGAATATCAGG + Intronic
918524631 1:185452079-185452101 TAGCCTCAGCCTGGTATATCTGG - Intergenic
922490922 1:226015811-226015833 TCACCTGAGCCTGGGAGATCAGG + Intergenic
1065232003 10:23607859-23607881 AAAGCTCAGCCTAGGATATCCGG - Intergenic
1066015768 10:31242167-31242189 TGACCTCTGCCTAGAAAACCAGG - Intergenic
1069851435 10:71407673-71407695 TGACCTTAGCCTGGGCTTTCCGG + Intronic
1070778246 10:79122769-79122791 TGACCTCAGCCCAGGAACTTAGG - Intronic
1073443006 10:103564033-103564055 TGAGCCCAGCCTAGGGCATCTGG + Intronic
1074992322 10:118720321-118720343 AGAAGTCAGCCTAGGGTATCTGG - Intronic
1075761812 10:124863281-124863303 TCACCTGAGCCTAGGAGTTCAGG + Intergenic
1075962801 10:126584033-126584055 TCACCTGAGCCCAGGAAATCAGG + Intronic
1076787730 10:132759451-132759473 ACACCTCAGCCTGGGATTTCCGG + Intronic
1077625845 11:3770391-3770413 TCACCTGAGCCCAGGAAATCAGG + Intronic
1078899318 11:15626907-15626929 TGAACTAAGGCTAGGATTTCTGG + Intergenic
1083403789 11:62442936-62442958 TGACCTAAGCCTGGGAGACCTGG + Intronic
1084494769 11:69497540-69497562 TGACCTCACCCCCAGATATCAGG + Intergenic
1084955225 11:72687648-72687670 TTTCCTCAGCCTGGGATCTCAGG + Intronic
1085099806 11:73790968-73790990 TCACCTGAGCCCGGGATATCGGG - Intronic
1086538910 11:87884401-87884423 TGGCCTCAGCCTGGGAGATGGGG + Intergenic
1086576543 11:88344695-88344717 TGACATCTGCCTAGAAGATCAGG - Intergenic
1086673872 11:89580471-89580493 TGAGCTCAGCCTAAAATATGCGG + Intergenic
1092919306 12:13216391-13216413 TAACCTCAGCCTAGGTAATTTGG - Exonic
1095080660 12:37995863-37995885 GGACCTCAGCCTTGGAAAGCTGG + Intergenic
1097435710 12:59550276-59550298 TAACATCTACCTAGGATATCAGG - Intergenic
1097920019 12:65062058-65062080 TAGGCTCAGTCTAGGATATCTGG + Intronic
1097992260 12:65848489-65848511 TGACATAAGCCTAGGATTTCAGG - Intronic
1099778002 12:87158881-87158903 TGACCTTAGCCTAGGGTCTAAGG + Intergenic
1101696386 12:107131277-107131299 TGGCCTCTGCCCAGGATCTCTGG - Intergenic
1102455399 12:113067676-113067698 TGGCCCCACCCTTGGATATCTGG + Intronic
1107087405 13:36440627-36440649 TGACCATAATCTAGGATATCTGG + Intronic
1108225865 13:48288034-48288056 TGACCTCAAGGCAGGATATCTGG - Intergenic
1108555346 13:51585312-51585334 TGAATTCAGCCTAAGATGTCTGG - Intronic
1118202856 14:63693150-63693172 TCACTTGAGCCCAGGATATCTGG - Intronic
1124939214 15:34202528-34202550 TGATTTCAGCCTAGGAGATATGG - Intronic
1125813099 15:42558871-42558893 TCACTTGAGCCTAGGAAATCGGG + Intronic
1128409330 15:67378351-67378373 CCACCTCAGGCTAGGAAATCTGG + Intronic
1144273566 17:13643407-13643429 TGCCCTGGGCCTAGGACATCTGG - Intergenic
1146418953 17:32664623-32664645 TGAAGTCAGCAGAGGATATCGGG + Intronic
1148394588 17:47298026-47298048 TGACCTCATCATATCATATCTGG - Intronic
1149225704 17:54467732-54467754 TGTCCTCAGGCCAGGAGATCTGG + Intergenic
1153814704 18:8782527-8782549 TGACCTCAGCCAAGCATTGCAGG + Intronic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1163224200 19:15944357-15944379 CCACCTCAGCCTAGGATTACAGG + Intergenic
1163322215 19:16581466-16581488 TGACCTCACCCTGGTATATTTGG + Intronic
1165576156 19:36820809-36820831 TCACCTGAGCCTAGGAGATGAGG + Intronic
1168046868 19:53800382-53800404 TGGCTTCAGCCCAGGATGTCGGG + Intronic
932382828 2:71301186-71301208 TCACCTGAGCCTAGGAGTTCGGG - Intronic
932560577 2:72863924-72863946 TGAGCTCATCCTAGATTATCTGG - Intergenic
933104269 2:78303418-78303440 TGACTTCAGCCCAGGAGTTCAGG + Intergenic
933227333 2:79766291-79766313 TTACCTCAGAATAGTATATCTGG - Intronic
935769238 2:106401173-106401195 TGACCTGAGCCTAGGCAATTAGG - Intronic
935910854 2:107894750-107894772 TGACCTGAGCCTAGGCAATTAGG + Intergenic
935968981 2:108511594-108511616 TGACCTGAGCCTAGGCAATTAGG + Intergenic
936132640 2:109859795-109859817 TGACCTGAGCCTAGGCAATTAGG + Intergenic
936212057 2:110511690-110511712 TGACCTGAGCCTAGGCAATTAGG - Intergenic
936421197 2:112366252-112366274 TGACCTGAGCCTAGGCAATTAGG - Intergenic
938672861 2:133602224-133602246 TGACCTGAGCCTTGGACATTTGG + Intergenic
938672868 2:133602277-133602299 TGACCTGAGCCTCGGAGATTTGG + Intergenic
939113599 2:138035862-138035884 TGATATCAGCCTGGGTTATCTGG + Intergenic
940301652 2:152181459-152181481 TCACCTGAGCCCAGGATTTCAGG + Intergenic
940617673 2:156070432-156070454 TAACCTCAGCCAAGAATAACTGG + Intergenic
941413719 2:165192642-165192664 AGACCTCAGCCTCTGACATCTGG + Intronic
943637163 2:190319132-190319154 TGAGCTCAGCCTAGGAAATCTGG - Intronic
946347643 2:219124082-219124104 AGACTTCAGCCTGGGACATCAGG + Intronic
947949632 2:234136060-234136082 TGACCGCAGCCGAGGATGTGGGG + Intergenic
1172021587 20:31918454-31918476 TGACTTTAGCCCAGGAGATCAGG - Intronic
1174026105 20:47576999-47577021 TCAACTCAGCCAAAGATATCAGG + Intronic
1174160750 20:48548750-48548772 TGACCTCAGAATAGGATTTCAGG + Intergenic
1175716761 20:61260148-61260170 TGTCCTGAGCCTAGGTTTTCAGG + Intronic
1179059987 21:37970984-37971006 TGACCTCAGACTAGTATACTAGG + Intronic
1179401207 21:41085797-41085819 TGTCCTCAGCCTAAGAAAACAGG + Intergenic
1181382973 22:22521505-22521527 TCACCTCAGCCTTTGATAGCTGG - Intergenic
1183840705 22:40498367-40498389 TCATCTCAGCCCAGGAGATCAGG - Intronic
1184157211 22:42675838-42675860 TCACCTGAGCCCAGGAGATCAGG - Intergenic
1184388734 22:44190917-44190939 TGACCTCAGCAGAGGGCATCTGG + Intronic
1184731423 22:46373088-46373110 TGACCTCAGCCTGGGATGCAGGG - Intronic
949886282 3:8697188-8697210 TAACCTCACCCAAGGATATAAGG + Intronic
951436705 3:22673387-22673409 TGAGATCAGCCTAGGATACATGG + Intergenic
952849495 3:37715868-37715890 GGAACTCAGCCTAAGATAGCAGG - Intronic
960977010 3:123185242-123185264 AGACCTCTGGCTAGGAAATCCGG + Intronic
961270989 3:125688463-125688485 TAACCTCAGCCAAGGATATAAGG + Intergenic
973995797 4:56457210-56457232 TGAGCTCAGCCTAGGCAACCTGG + Intronic
976564580 4:86539145-86539167 TGAGCTCAGCCCAGGAAAACAGG + Intronic
980511141 4:133788826-133788848 TCACCTCAGCCTAGGAAACTGGG + Intergenic
981081228 4:140641575-140641597 TGACCACAGCCTGGGGTCTCTGG + Intronic
981191943 4:141874079-141874101 TACCCTCACCCAAGGATATCAGG - Intergenic
981483197 4:145258797-145258819 TCACCTGAGCCTAGCATTTCTGG + Intergenic
982716580 4:158815227-158815249 GGACCTGAGCCCAGGATGTCTGG + Intronic
984419552 4:179502703-179502725 TCACTTCAGCCTGGGAGATCAGG - Intergenic
985125464 4:186689684-186689706 TGTCCTTAGCCCAGGGTATCTGG + Intronic
987603965 5:20108629-20108651 TAACCACAGCCTAGCATACCTGG + Intronic
992560311 5:77945876-77945898 TGACCTCAGCCCAGGGTCTGGGG + Intergenic
1001771938 5:174303229-174303251 TGACATCAGCCCAGGAGATAAGG + Intergenic
1001975549 5:175995801-175995823 TGACCTCAGCTTAGCAGATTTGG - Intronic
1002241883 5:177847971-177847993 TGACCTCAGCTTAGCAGATTTGG + Intergenic
1006238575 6:32657765-32657787 GGACCTCTGCCTAGGAAAGCCGG - Intergenic
1007180517 6:39926151-39926173 TGCCCTCAGCCCAGGAAGTCAGG - Intronic
1007792278 6:44317314-44317336 GGACCTCTGCCTAGGAAAACCGG + Intronic
1016324815 6:142888640-142888662 TGACCTCATCAAAGGAGATCAGG - Intronic
1022394046 7:29969837-29969859 TGAAATCAGCTTCGGATATCAGG - Intronic
1022542834 7:31154107-31154129 GGACCTCTGCCTAGGAAAACTGG + Intergenic
1027562656 7:79751491-79751513 GGACCTCTGCCTAGGAAAGCTGG - Intergenic
1028306126 7:89267326-89267348 TGATATCAGCCTATGTTATCAGG + Intronic
1031501705 7:122526027-122526049 TGTCCTCAGCCTGGGGTATTGGG - Intronic
1032277651 7:130473724-130473746 GGACCTCAGCCTATTAGATCAGG - Intergenic
1033206654 7:139429056-139429078 TCACCTCAGCCTGGGATTACAGG - Intergenic
1041246513 8:55893889-55893911 TCACTTCAGCCCAGGATCTCAGG - Intronic
1044305811 8:90639313-90639335 TGACCTCTCCCTAAGATATTTGG - Intronic
1044369926 8:91398488-91398510 TGAATTCAGCCTAGGAAGTCAGG - Intergenic
1045155260 8:99461947-99461969 TGACCTCATTCTAGGATCTAGGG - Intronic
1046255802 8:111694704-111694726 TGCTCTCAGCCTAGGAAACCAGG + Intergenic
1046725161 8:117665947-117665969 TGTCCTGAGCCAAGGAGATCAGG + Intergenic
1054717114 9:68567376-68567398 TGACCTCTTCCTAGGATGGCTGG + Intergenic
1059500557 9:114749747-114749769 TCACCTGAGCCCAGGAGATCAGG + Intergenic
1061084885 9:128393015-128393037 TGCCCCCAGCCTGGGATCTCCGG + Intergenic
1061311166 9:129763624-129763646 TGAGCTCATCCTTGGATGTCAGG + Intergenic
1062150998 9:135018991-135019013 GGGCCTCAGCCCAGGATCTCTGG - Intergenic
1185892851 X:3835835-3835857 AGACCTCCGCCTGGGAGATCGGG - Intronic
1185897959 X:3874255-3874277 AGACCTCCGCCTGGGAGATCGGG - Intergenic
1185903078 X:3912686-3912708 AGACCTCCGCCTGGGAGATCGGG - Intergenic
1189685118 X:43555805-43555827 TCACCTGAGCCTGGGAGATCAGG + Intergenic
1197306695 X:124851194-124851216 TGACCTCAGTCTCTGATCTCAGG - Intronic
1198210121 X:134508476-134508498 TTACCTGAGCCCAGGAGATCAGG + Intronic
1200968716 Y:9126818-9126840 TGGTCTCAGCCTAAGATCTCAGG - Intergenic
1201068742 Y:10125034-10125056 AGACCTCTGCCTAGGAAAGCCGG - Intergenic