ID: 914703663

View in Genome Browser
Species Human (GRCh38)
Location 1:150154507-150154529
Sequence CCATCCTTCTGAACTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 179}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914703663_914703667 4 Left 914703663 1:150154507-150154529 CCAGCAGCAGTTCAGAAGGATGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 914703667 1:150154534-150154556 ATACAAGACTGTAGATGGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 98
914703663_914703671 16 Left 914703663 1:150154507-150154529 CCAGCAGCAGTTCAGAAGGATGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 914703671 1:150154546-150154568 AGATGGTCTGGGTAATGGAAGGG 0: 1
1: 0
2: 2
3: 26
4: 206
914703663_914703670 15 Left 914703663 1:150154507-150154529 CCAGCAGCAGTTCAGAAGGATGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 914703670 1:150154545-150154567 TAGATGGTCTGGGTAATGGAAGG 0: 1
1: 0
2: 0
3: 8
4: 130
914703663_914703668 5 Left 914703663 1:150154507-150154529 CCAGCAGCAGTTCAGAAGGATGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 914703668 1:150154535-150154557 TACAAGACTGTAGATGGTCTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
914703663_914703666 -1 Left 914703663 1:150154507-150154529 CCAGCAGCAGTTCAGAAGGATGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 914703666 1:150154529-150154551 GGCAGATACAAGACTGTAGATGG 0: 1
1: 0
2: 0
3: 9
4: 137
914703663_914703669 11 Left 914703663 1:150154507-150154529 CCAGCAGCAGTTCAGAAGGATGG 0: 1
1: 0
2: 2
3: 13
4: 179
Right 914703669 1:150154541-150154563 ACTGTAGATGGTCTGGGTAATGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914703663 Original CRISPR CCATCCTTCTGAACTGCTGC TGG (reversed) Intronic
902049146 1:13548193-13548215 CCATCGTGCTGAACTTCTGGTGG - Intergenic
902326706 1:15705570-15705592 CCATACCTCAGAACTGTTGCTGG + Intronic
902401777 1:16161886-16161908 CCACCCTTCAGGGCTGCTGCTGG + Intergenic
902917215 1:19645965-19645987 CCATGCTAATGAGCTGCTGCAGG - Intronic
903298285 1:22360040-22360062 CCATCCCTCTGAAATCCTTCTGG - Intergenic
904265601 1:29316996-29317018 CCATCCTGCTGAGCCACTGCAGG - Intronic
904911595 1:33938341-33938363 CCATGATCCTGTACTGCTGCTGG + Intronic
904911653 1:33938694-33938716 CCATGATCCTGTACTGCTGCTGG + Intronic
906278396 1:44535705-44535727 CCATCCTTCTGCGCAGCTCCTGG + Intronic
906421614 1:45673113-45673135 TCACCCCTCTGAACTGCTGAAGG - Intronic
907814134 1:57901562-57901584 CCACCCTGATGACCTGCTGCTGG + Intronic
910261915 1:85301242-85301264 TCATCCTTCTTAACCTCTGCAGG - Intergenic
910263114 1:85310825-85310847 ACAGTCTTCTCAACTGCTGCTGG - Intergenic
912162747 1:107006261-107006283 CCATCTTTCTAGACTGCTCCAGG - Intergenic
914703663 1:150154507-150154529 CCATCCTTCTGAACTGCTGCTGG - Intronic
916199226 1:162254321-162254343 GCATCCTCCTAAACTGCTCCTGG - Intronic
916814804 1:168341365-168341387 GCAGTCTTCTGAACTGCTTCTGG + Intergenic
917928428 1:179807555-179807577 CCTTCCCTCTGTGCTGCTGCTGG - Intronic
920924597 1:210329386-210329408 CCAGCTTCCGGAACTGCTGCGGG + Intronic
921803102 1:219424493-219424515 CCATCCATCTGAAATGGTCCAGG - Intergenic
922056712 1:222049239-222049261 CTTTCCTTCTGAAATGCTTCTGG - Intergenic
922446533 1:225702756-225702778 TCATCCTTCTGAATAGCAGCTGG + Intergenic
922865280 1:228855332-228855354 GAATCCTTGTGTACTGCTGCTGG - Intergenic
1063305323 10:4894013-4894035 GCATGCCTCTGAACTTCTGCGGG + Intergenic
1067322974 10:45239835-45239857 CCATTCTTGTGAACTGCCGTAGG - Intergenic
1072432013 10:95380886-95380908 CCATCCTGCTGTCCTGCTGGAGG + Intronic
1074551272 10:114444775-114444797 CTGTCCTTCTGGGCTGCTGCAGG + Intronic
1074768901 10:116720549-116720571 CCATCCTGCTGGGGTGCTGCAGG + Intronic
1075816748 10:125270536-125270558 CCATCCTGCTGAGCTGCAGCTGG + Intergenic
1076337782 10:129720116-129720138 CACTCCTTCTGAACAGCTGCGGG - Intronic
1078094106 11:8285956-8285978 TCATCCTTCTGAGCTGTTGGAGG + Intergenic
1078640443 11:13090453-13090475 CCTCCCTTCTGAATTGCTGTGGG + Intergenic
1079654644 11:22973483-22973505 TCATTCTTCTGTAGTGCTGCTGG + Intergenic
1081884345 11:46482227-46482249 CCATCATGCTGAACTGCAGAGGG - Intronic
1083320997 11:61846626-61846648 CTATCCTGGTGAACTGTTGCCGG - Intronic
1084880313 11:72166334-72166356 CCTTCTTTCTGAGCTGCAGCTGG + Intergenic
1086010553 11:82098177-82098199 CCATCCATCTGAATTCCTGTGGG + Intergenic
1086827147 11:91513049-91513071 CAAGCCTTCTGTACTGCTGATGG - Intergenic
1090012021 11:123053775-123053797 TCATCCCCCTGAACTGCTTCTGG - Intergenic
1094821597 12:34230521-34230543 CCATCCCTCTGAACTTCTCAAGG - Intergenic
1097276382 12:57816184-57816206 CCATCATTGTGAAATGGTGCAGG - Exonic
1098222525 12:68285250-68285272 CCATCTTTCTGGACTGCACCAGG + Intronic
1099902488 12:88729065-88729087 CCAACCCTCTGAACAGCTCCTGG - Intergenic
1100926830 12:99558293-99558315 GCATCCTGCTGCACTGCTGCTGG - Intronic
1103890178 12:124232547-124232569 CCCTCCTGCTGAATTACTGCTGG - Intronic
1104473168 12:129047642-129047664 CCATCCGTCTGAATTGCCTCTGG - Intergenic
1104503700 12:129310512-129310534 CCCTCCCTCTGAGCTCCTGCTGG + Intronic
1105396678 13:20043336-20043358 CCATCACGCTGCACTGCTGCTGG - Intronic
1105509803 13:21041593-21041615 CCCTCCCTCTGATCTGCTGAGGG - Intronic
1107729851 13:43337998-43338020 CAACCCTTCTGCACTGCTGCTGG + Intronic
1110324305 13:74196318-74196340 TCCTCCTTCTGATCTCCTGCTGG - Intergenic
1113014840 13:105817359-105817381 GTATCGTTCTGAACTGCTGCAGG - Intergenic
1113150589 13:107259135-107259157 CTATGCTTCTGAGCTGCTCCTGG + Intronic
1114656311 14:24317786-24317808 GCATCCTTCTGCACAGATGCTGG - Exonic
1116788390 14:49312790-49312812 CCATCCTTCTGAACAACTCTGGG + Intergenic
1119187423 14:72652571-72652593 CCAACCTTCTCAACCTCTGCTGG + Intronic
1119601684 14:75980949-75980971 CCCTCCTTCTGCACGTCTGCTGG - Exonic
1121370047 14:93348096-93348118 AATTCCTTCTGAACTGCTTCAGG - Exonic
1121635888 14:95453686-95453708 CCTTCCTGCTGAATTCCTGCAGG - Intronic
1122940767 14:104980393-104980415 GCGTCCATCTGACCTGCTGCTGG - Intergenic
1126378096 15:48016823-48016845 ACTTCTTTCTGAACTGTTGCTGG + Intergenic
1127235758 15:57049335-57049357 ACATCTTTCTGGAGTGCTGCTGG - Intronic
1127853506 15:62935647-62935669 TCCTCCATCTGAGCTGCTGCTGG - Intergenic
1129351711 15:74959183-74959205 CCAACCTCCTAAACTGCTGTCGG + Intronic
1135907358 16:26525183-26525205 CATTCCTTCTGAGCTGGTGCTGG + Intergenic
1137621890 16:49881642-49881664 CCATACTCCTGGACTGCAGCTGG - Intergenic
1141825990 16:86480706-86480728 CCTTCCTTCTCAGCTGCTCCTGG - Intergenic
1142184644 16:88688728-88688750 CCGCCCTCCTGAACTGCAGCAGG + Intergenic
1203139267 16_KI270728v1_random:1749438-1749460 CCATCCATCCAAACTGCTGTAGG - Intergenic
1143648666 17:8248894-8248916 CCATCCATCTGAAGGCCTGCGGG - Intronic
1146537898 17:33668964-33668986 GCAGCCTTCTGAACTGCATCTGG + Intronic
1148228243 17:45914448-45914470 CGGTCCGTCTGCACTGCTGCGGG + Intronic
1151233177 17:72699482-72699504 CCCTCCATCTGAGCTGCTGTAGG - Intronic
1151807629 17:76416428-76416450 GCATCCCTCTGAGCTGCTTCTGG + Intronic
1156502767 18:37570044-37570066 CCAGGATGCTGAACTGCTGCGGG - Intergenic
1156901708 18:42308188-42308210 CCATTCTTCTGAAGTGCCGCAGG + Intergenic
1158076028 18:53530790-53530812 TATTCCTTCTGAACTGCTTCAGG - Exonic
1160333639 18:78017978-78018000 CCATTCCTCTGAAGTCCTGCTGG + Intergenic
1162412851 19:10517127-10517149 CCATACTTCAGTCCTGCTGCCGG - Intronic
1165070567 19:33252971-33252993 CCCTCCTTCTGGTCAGCTGCAGG + Intergenic
1168563206 19:57400796-57400818 CAATCCTTGTGCACTGCTGGTGG - Intronic
925370111 2:3338517-3338539 CCAGCCTGCTGCACAGCTGCTGG + Intronic
925456159 2:4018351-4018373 CCATCCTCCAGATCTGTTGCGGG - Intergenic
925662237 2:6214413-6214435 CCATCCTTATGAAATCGTGCAGG - Intergenic
926714681 2:15914771-15914793 CCAACCTTCTGCACTTCAGCAGG + Intergenic
931143753 2:59492675-59492697 TAGTCCTTATGAACTGCTGCAGG - Intergenic
938298975 2:130197003-130197025 CCTTCCTGCTCAACTGCTGTGGG + Intronic
938337248 2:130510989-130511011 CCATCCTTCTGCAGTAATGCAGG - Intergenic
938352589 2:130609746-130609768 CCATCCTTCTGCAGTAATGCAGG + Intergenic
938457748 2:131477511-131477533 CCTTCCTGCTCAACTGCTGTGGG - Intronic
939447476 2:142328881-142328903 CCATCCTACTGAATAGCTCCTGG - Intergenic
942014149 2:171793929-171793951 CCATCCCTCTGAACCTCTCCAGG - Intronic
944743467 2:202634604-202634626 CCATCCCTGGGAACTGCTCCGGG + Intergenic
945487370 2:210412755-210412777 CCATCCTTATACACTGCTGGTGG - Intergenic
948615638 2:239196973-239196995 CCCTCTGTCTGCACTGCTGCTGG + Intronic
1169149725 20:3279876-3279898 CCACTCTTCTGAATGGCTGCTGG + Intronic
1170254794 20:14328764-14328786 CCACCATGCTGAACTGCAGCTGG - Intronic
1172991273 20:39038754-39038776 GCATCCTTCTGTGCTGCAGCGGG + Exonic
1173128238 20:40360525-40360547 CCATGCTTATCAATTGCTGCAGG - Intergenic
1173203194 20:40969154-40969176 CCCTCTTCCTCAACTGCTGCCGG - Intergenic
1173858355 20:46265988-46266010 CCATCCTACTGAACTACTGGGGG + Intronic
1174687027 20:52465802-52465824 CCACCCTTCTTCACTGTTGCAGG - Intergenic
1174836390 20:53859659-53859681 CCATCCATCCAAACTGCTGTAGG - Intergenic
1176096038 20:63345024-63345046 ACCTGCCTCTGAACTGCTGCTGG - Exonic
1177756501 21:25355001-25355023 CCATCCCTCTAAACTTCTGGGGG - Intergenic
1179980834 21:44894880-44894902 CCCTCCTGCTGACCTGCAGCAGG + Intronic
1181234967 22:21443208-21443230 GCACCCTCCTGAACTGCTGTGGG + Intronic
1181667469 22:24408040-24408062 CCCTCCTTCCAGACTGCTGCGGG + Intronic
1181683871 22:24515242-24515264 CGATCCTTCCGAACTGCGTCTGG - Exonic
1182494284 22:30695194-30695216 GCAGCCATCGGAACTGCTGCAGG + Exonic
1183927904 22:41218927-41218949 CCCTCCTACTGAAATGCTCCAGG - Intronic
1184776994 22:46628234-46628256 CCATCCGTCTGTCCTGCTCCAGG + Intronic
1185386473 22:50533824-50533846 CCTTCCTACTGAACTCCTACAGG + Intergenic
952524844 3:34199230-34199252 CCATCCTCCAGACGTGCTGCAGG - Intergenic
953211290 3:40877560-40877582 GCAGCCTTCTAAACTGCTGCTGG + Intergenic
953411219 3:42691481-42691503 GCAGCCATCTGCACTGCTGCAGG + Intronic
953493119 3:43366169-43366191 CCATTTTTGAGAACTGCTGCTGG - Exonic
954597871 3:51842255-51842277 TCTTCTTTCTGAACTGCAGCCGG + Intergenic
954775267 3:53011521-53011543 CCTTCCTGCTGGTCTGCTGCTGG - Intronic
955023717 3:55146635-55146657 CCATCTTCCTGAACTGGTGGTGG + Intergenic
955665550 3:61345826-61345848 CCATCCATGTGCACTCCTGCAGG + Intergenic
961485487 3:127212928-127212950 TCATCCTCCTGCAGTGCTGCAGG + Intergenic
962652663 3:137512419-137512441 CCATCCCTCTGGACTCCTGTAGG - Intergenic
965610204 3:170535629-170535651 CCATCCTCCTGATCACCTGCTGG - Intronic
966338625 3:178900149-178900171 CCTTCATTCTGAGCTGCTACAGG - Intergenic
966932428 3:184684595-184684617 TCCTCCTTCTGAATGGCTGCAGG - Intronic
967209371 3:187153720-187153742 CAATCCTTTTGAACTGTTCCAGG + Intronic
968872450 4:3248715-3248737 CCTGCCTTCTGAACTGGGGCTGG - Exonic
972249652 4:37286757-37286779 CCCTCCTTAGGAACTGCTCCAGG - Intronic
974466692 4:62266225-62266247 CTATGCTTCTTAACTGCTACAGG + Intergenic
977317865 4:95473835-95473857 CCATCCTTCTGAAACTGTGCTGG - Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
981101610 4:140835088-140835110 TAAACTTTCTGAACTGCTGCGGG - Intergenic
982771471 4:159400940-159400962 CCACCCTGCAGAACTGCTGCTGG + Intergenic
985943864 5:3161984-3162006 ACCACCTTCTGACCTGCTGCAGG + Intergenic
986818877 5:11444013-11444035 CCAACATTCTGCACTGCTGATGG - Intronic
987298916 5:16579375-16579397 CCATTCTGCTAAACGGCTGCTGG + Intronic
989140021 5:38192736-38192758 CCATCTTTCTGTTCTTCTGCTGG + Intergenic
990962337 5:61407881-61407903 GCATCCTCCTGCACTGCTGGTGG + Intronic
995137996 5:108701141-108701163 CTATCCTCCAGAACAGCTGCAGG + Intergenic
995355780 5:111236422-111236444 TCATCCTTGTGAATTGGTGCTGG - Intronic
996091539 5:119356308-119356330 CCTCCCCTCTGAACGGCTGCGGG - Intronic
996097406 5:119413531-119413553 CCATCATTCTCAGCTGCTGCGGG + Intergenic
996717269 5:126598060-126598082 CCATCCTTCTGAACCAATTCTGG + Intergenic
997673028 5:135691931-135691953 CCATGTTTCTGGGCTGCTGCAGG - Intergenic
999126933 5:149252759-149252781 CTACCCTTATGAACTGCTGCTGG + Exonic
1001696122 5:173671297-173671319 CCAGCCTTCTCACATGCTGCCGG + Intergenic
1002795444 6:467734-467756 CCATCCTGCTTAGCTGCAGCTGG - Intergenic
1004512780 6:16296256-16296278 GCATCCTGGTGGACTGCTGCAGG - Intergenic
1007501932 6:42305086-42305108 CCATCCTGCTGAGGTGCTGTAGG + Intronic
1008030924 6:46692985-46693007 CATTCCTTCTGAACTTCTGTCGG + Exonic
1011509898 6:88088834-88088856 GCCTCCTTCAGAGCTGCTGCCGG + Intergenic
1013108807 6:107048811-107048833 CCACCCTTCTGTAGTTCTGCTGG - Intronic
1013275363 6:108579771-108579793 CAAGCCTTCTGGACTGCTACTGG - Intronic
1013445833 6:110225611-110225633 CCATCCACCTGCATTGCTGCAGG + Intronic
1014095722 6:117458464-117458486 GCAACCTTCTGCACTGCTGGAGG - Intronic
1015547532 6:134376765-134376787 TCTTCCTTCTGACCTCCTGCAGG - Intergenic
1015937307 6:138416445-138416467 CCATCCTTCAGCAAGGCTGCTGG + Exonic
1017219339 6:151948427-151948449 GCAGCCTCATGAACTGCTGCTGG + Intronic
1019580800 7:1761261-1761283 CCATCCGTCTTCACCGCTGCCGG - Intergenic
1022120804 7:27306268-27306290 CCAACCTTGTGACCTTCTGCTGG - Intergenic
1023428284 7:40062862-40062884 CCGTCCACCTGAACTGCTACTGG + Exonic
1024512970 7:50217596-50217618 CCCGCCCTCTGAAATGCTGCTGG - Intergenic
1024751490 7:52470778-52470800 CCAGCCTTTTCAAATGCTGCAGG - Intergenic
1027340214 7:77199568-77199590 CGATCCTGCTGAATTGCTTCGGG + Exonic
1028694229 7:93690399-93690421 CCCTCCTTCTGACCTCCTGCTGG - Intronic
1034386536 7:150745280-150745302 GCATCCTCCAGCACTGCTGCTGG - Intronic
1034827057 7:154275215-154275237 CCATCCTTCAGAGCTGCTGCTGG - Intronic
1035075247 7:156173544-156173566 CCATCCCTCTGAGCTGAGGCTGG + Intergenic
1035367014 7:158355616-158355638 ACATCCCTCTGCACTGCTGCGGG - Intronic
1037262009 8:17020027-17020049 CCATCCCACTAAACTTCTGCAGG + Intergenic
1037694421 8:21210942-21210964 GCATCCTCCTGTTCTGCTGCCGG + Intergenic
1039581582 8:38671175-38671197 CAATCCTTCTCAAGTTCTGCTGG - Intergenic
1043374136 8:79628522-79628544 CAATCCTTGTGCACTGCTGGTGG - Intronic
1043886918 8:85611594-85611616 GCATCCCTCTGAAGAGCTGCAGG - Intergenic
1045224576 8:100231999-100232021 TTTTCCTTCTGAAGTGCTGCGGG + Intronic
1045281859 8:100756363-100756385 GCATCCGTCTGAACTGCTGCTGG + Intergenic
1045544666 8:103117928-103117950 CCATGCTTCTGTGCTGCTGGAGG - Intergenic
1046030973 8:108783951-108783973 CTATCCTTCTGAAGAGCTGAAGG - Exonic
1047387369 8:124422479-124422501 CCAACAGACTGAACTGCTGCAGG - Intergenic
1048253513 8:132886975-132886997 CCATCCTTCTTAGCAGCTTCAGG - Exonic
1049729396 8:144168118-144168140 CCCTCCACCTGAGCTGCTGCAGG - Intronic
1052741208 9:32394702-32394724 ACATCCTTCTATCCTGCTGCGGG + Intronic
1054718894 9:68584123-68584145 CCTTCCTTCTAACCTGCTGTGGG - Intergenic
1059535420 9:115075989-115076011 CCATCCCACTGAGCTGGTGCTGG - Intronic
1059752863 9:117265118-117265140 CCTATCTTCTGAACTGCTTCTGG - Intronic
1062262045 9:135667645-135667667 CCAGCCTACTGAGCTGCAGCGGG + Intergenic
1062429902 9:136522430-136522452 CCATCCTGCTGGTCTCCTGCGGG - Intronic
1185516300 X:701623-701645 ACATACTTCAGAGCTGCTGCAGG - Intergenic
1186941278 X:14510358-14510380 CTTTCCTTCTCAACTCCTGCTGG + Intergenic
1188551237 X:31367055-31367077 CCATCCTTCTAAAGTGCTTTTGG - Intronic
1188970314 X:36607244-36607266 CCATCCTTCTGCCCTGCTCTGGG + Intergenic
1189777206 X:44481197-44481219 CCATTCATCTGAACTGCTTTGGG + Intergenic
1193044321 X:77035235-77035257 CCATCCTTAAGAACTATTGCTGG - Intergenic
1198379621 X:136071601-136071623 CCGTCCTCCTGCCCTGCTGCAGG + Intergenic