ID: 914708053

View in Genome Browser
Species Human (GRCh38)
Location 1:150187688-150187710
Sequence GGAGTGCTACTGCATCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914708053_914708055 -9 Left 914708053 1:150187688-150187710 CCCACTTGATGCAGTAGCACTCC No data
Right 914708055 1:150187702-150187724 TAGCACTCCCACACACATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914708053 Original CRISPR GGAGTGCTACTGCATCAAGT GGG (reversed) Intergenic
No off target data available for this crispr