ID: 914708055

View in Genome Browser
Species Human (GRCh38)
Location 1:150187702-150187724
Sequence TAGCACTCCCACACACATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914708052_914708055 2 Left 914708052 1:150187677-150187699 CCTGGCATCTTCCCACTTGATGC No data
Right 914708055 1:150187702-150187724 TAGCACTCCCACACACATCCCGG No data
914708051_914708055 3 Left 914708051 1:150187676-150187698 CCCTGGCATCTTCCCACTTGATG No data
Right 914708055 1:150187702-150187724 TAGCACTCCCACACACATCCCGG No data
914708050_914708055 4 Left 914708050 1:150187675-150187697 CCCCTGGCATCTTCCCACTTGAT No data
Right 914708055 1:150187702-150187724 TAGCACTCCCACACACATCCCGG No data
914708053_914708055 -9 Left 914708053 1:150187688-150187710 CCCACTTGATGCAGTAGCACTCC No data
Right 914708055 1:150187702-150187724 TAGCACTCCCACACACATCCCGG No data
914708054_914708055 -10 Left 914708054 1:150187689-150187711 CCACTTGATGCAGTAGCACTCCC No data
Right 914708055 1:150187702-150187724 TAGCACTCCCACACACATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914708055 Original CRISPR TAGCACTCCCACACACATCC CGG Intergenic
No off target data available for this crispr