ID: 914713438

View in Genome Browser
Species Human (GRCh38)
Location 1:150235287-150235309
Sequence TGCGGCCAACTCATCTTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914713438_914713441 6 Left 914713438 1:150235287-150235309 CCTAAAAAGATGAGTTGGCCGCA No data
Right 914713441 1:150235316-150235338 AAAAGTTGGACTAACTTCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 128
914713438_914713445 26 Left 914713438 1:150235287-150235309 CCTAAAAAGATGAGTTGGCCGCA No data
Right 914713445 1:150235336-150235358 AGGCGCCTATGGCTGCGGCAGGG 0: 1
1: 0
2: 1
3: 6
4: 118
914713438_914713444 25 Left 914713438 1:150235287-150235309 CCTAAAAAGATGAGTTGGCCGCA No data
Right 914713444 1:150235335-150235357 CAGGCGCCTATGGCTGCGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 153
914713438_914713439 -8 Left 914713438 1:150235287-150235309 CCTAAAAAGATGAGTTGGCCGCA No data
Right 914713439 1:150235302-150235324 TGGCCGCACTGCAGAAAAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 95
914713438_914713443 21 Left 914713438 1:150235287-150235309 CCTAAAAAGATGAGTTGGCCGCA No data
Right 914713443 1:150235331-150235353 TTCTCAGGCGCCTATGGCTGCGG No data
914713438_914713442 15 Left 914713438 1:150235287-150235309 CCTAAAAAGATGAGTTGGCCGCA No data
Right 914713442 1:150235325-150235347 ACTAACTTCTCAGGCGCCTATGG 0: 1
1: 0
2: 0
3: 1
4: 111
914713438_914713446 27 Left 914713438 1:150235287-150235309 CCTAAAAAGATGAGTTGGCCGCA No data
Right 914713446 1:150235337-150235359 GGCGCCTATGGCTGCGGCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914713438 Original CRISPR TGCGGCCAACTCATCTTTTT AGG (reversed) Intronic
No off target data available for this crispr