ID: 914719967

View in Genome Browser
Species Human (GRCh38)
Location 1:150281823-150281845
Sequence GATGGAGGAGCCGCCCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914719967 Original CRISPR GATGGAGGAGCCGCCCCAGC GGG Intergenic
900890281 1:5444577-5444599 CATGGTGGAGCAGCCCAAGCAGG - Intergenic
900976466 1:6019913-6019935 GAGGGCGGAGCAGGCCCAGCAGG + Intronic
901056570 1:6451204-6451226 GAGGGAGGCTCCACCCCAGCCGG + Intronic
901908276 1:12433357-12433379 GATGGAGGAATGGCGCCAGCAGG - Intronic
902856492 1:19210092-19210114 GATGAAGGAGTTGCCGCAGCTGG - Exonic
903642729 1:24870971-24870993 GATGGAGATGCCGGCCCAGAGGG + Intergenic
903829914 1:26168628-26168650 GATGCACCAGCCTCCCCAGCTGG + Intergenic
904042461 1:27592645-27592667 GAAGGAGGGGGCTCCCCAGCTGG + Intronic
904829732 1:33299051-33299073 ACTGGAGGCGCCGCCCCACCCGG + Exonic
905308624 1:37034894-37034916 GCTGGAGGAGACGCGCCCGCCGG + Intergenic
905544338 1:38785880-38785902 GATGGCTGAGGAGCCCCAGCTGG - Intergenic
910569542 1:88684433-88684455 CATGGAGGCGCAGCCCCTGCTGG - Exonic
912272652 1:108226846-108226868 GATGAAGAACCCTCCCCAGCTGG - Exonic
912295568 1:108467476-108467498 GATGAAGAACCCTCCCCAGCTGG + Exonic
914379599 1:147104574-147104596 GGTGGAGGAAACGCCCCACCTGG + Intergenic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG + Intronic
917141687 1:171841671-171841693 GATGGAGGAGCTGATCCCGCTGG + Exonic
918480771 1:184974503-184974525 CCTGGAGGAGGCGCCCCAGAAGG - Exonic
1063272135 10:4522219-4522241 GATGGAAGAGCAGCCCCGCCTGG - Intergenic
1065322419 10:24521852-24521874 GAAGGAGGAGCCACACAAGCTGG + Exonic
1065916312 10:30357219-30357241 GATGGAGGAGTCGGCAGAGCAGG + Intronic
1066669171 10:37818640-37818662 GATGCAATAGCAGCCCCAGCAGG + Intronic
1067031338 10:42880151-42880173 GCGGGAGGAGCAGCCACAGCGGG + Intergenic
1072744563 10:97930653-97930675 GGTGGAGGAGCTGCCCGACCAGG + Intronic
1075556349 10:123435322-123435344 GATGCAGCAGCTGCCCCAGCAGG + Intergenic
1077187299 11:1241047-1241069 GCTGGAGGAGCTGGGCCAGCAGG + Exonic
1077246485 11:1541788-1541810 GATGGAGGGGCTGCCCAGGCAGG - Intergenic
1077392106 11:2304909-2304931 CAGGGAGGAGCTGCCCCAGCTGG - Intronic
1079127957 11:17732171-17732193 GACACAGGAGCCTCCCCAGCAGG - Intergenic
1079242374 11:18729695-18729717 GGTGGAGGAGGCAGCCCAGCAGG - Exonic
1079630398 11:22667200-22667222 GTTGGCAGAGCCACCCCAGCGGG - Intronic
1080746470 11:35112596-35112618 CATGGAGGAGCAGGACCAGCAGG + Intergenic
1081492715 11:43580152-43580174 GATGGAGGAGGGGGCCGAGCGGG + Intronic
1083277261 11:61603820-61603842 GAAGGAGGAGCCGCCCTCCCTGG - Intergenic
1083701939 11:64485280-64485302 GATGGAGGCGCCGCCCCACTGGG - Intergenic
1083878312 11:65536303-65536325 GTCGGAGGACCCGACCCAGCTGG + Exonic
1084214200 11:67638851-67638873 GATGACGTACCCGCCCCAGCAGG - Intronic
1084438664 11:69158204-69158226 GATGGAGGGGCCGGCCTTGCAGG + Intergenic
1084594466 11:70108764-70108786 CATGGAGATGCCGCCCCGGCTGG - Intronic
1089776087 11:120837103-120837125 GATGGACGAGCCTCCTCAGTAGG + Intronic
1091320410 11:134645593-134645615 GTTGGGGGAGCAGCCCCCGCTGG + Intergenic
1091613867 12:2034449-2034471 GATGGAAATGCAGCCCCAGCTGG - Intronic
1091667803 12:2431770-2431792 AATGGAGGAGTCCCCCAAGCAGG + Intronic
1096240911 12:49959888-49959910 GGGGGAGGAGCTGCTCCAGCAGG + Intergenic
1096601995 12:52735982-52736004 GCTGGAGGTGCCGCCCAGGCTGG - Intergenic
1097054725 12:56242701-56242723 GATGGAGGGACCGGCCGAGCAGG + Exonic
1102554632 12:113718975-113718997 CAGGGAGGAGCAGCCCCAGGAGG - Intergenic
1103447209 12:121002032-121002054 GACAGAGGAGCTGCCCCACCAGG - Exonic
1105438156 13:20394798-20394820 GGTGGGGCAGCAGCCCCAGCAGG + Intergenic
1111971436 13:94921331-94921353 GATGGAGAAGGGACCCCAGCCGG + Intergenic
1113128162 13:107003621-107003643 CTTGGAGGAGCCTCCACAGCTGG + Intergenic
1113940891 13:114018165-114018187 GTAGGAAGAGCCGCACCAGCGGG + Exonic
1114476446 14:22998537-22998559 GATTGAGGAGCTGCGGCAGCTGG - Exonic
1115754826 14:36520058-36520080 GAGGGAGGAGCAGCCCCGGCAGG - Exonic
1121600669 14:95200600-95200622 GCAGGAGGAGCCTCCCCATCAGG + Intronic
1122409600 14:101519115-101519137 GCTGGGTGACCCGCCCCAGCAGG + Intergenic
1127774676 15:62255550-62255572 CATGGAGGAGCGGGCACAGCTGG - Intergenic
1128794096 15:70452180-70452202 GGTGGAGGGGCCGCCCGCGCTGG + Intergenic
1129210154 15:74063754-74063776 GATGGAGGAGTCGGCAGAGCAGG + Intergenic
1129270620 15:74417558-74417580 GCTGGAGCAGGCGCCCCAGGGGG - Intronic
1129403868 15:75301648-75301670 GATGGAGGAGTCGGCAGAGCAGG - Intergenic
1129738226 15:77977346-77977368 GATGGACCAGGCGCTCCAGCTGG - Intergenic
1131282934 15:91035204-91035226 CATGGAGGAGCGGGCACAGCTGG - Intergenic
1132430086 15:101753362-101753384 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132430126 15:101753706-101753728 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132430236 15:101754667-101754689 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132430390 15:101756054-101756076 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132430564 15:101757626-101757648 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132430613 15:101758061-101758083 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132430709 15:101758932-101758954 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132430863 15:101760322-101760344 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132431026 15:101761809-101761831 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132431124 15:101762705-101762727 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132431245 15:101763757-101763779 CATGGAGGAGTCGGCCGAGCAGG + Intergenic
1132571580 16:646665-646687 CAGGGATGAGCGGCCCCAGCTGG - Intronic
1133063978 16:3193067-3193089 GTTGGAGGAGCCACCACACCCGG + Intergenic
1133130863 16:3675483-3675505 CATGGAGGACCCTTCCCAGCAGG - Intronic
1133705951 16:8354723-8354745 TAAGGAGAAGCCACCCCAGCTGG + Intergenic
1136683956 16:31983408-31983430 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136784582 16:32926960-32926982 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG + Intergenic
1137280452 16:46972942-46972964 GAGGGAGGAGCTCCCGCAGCCGG + Intronic
1138022535 16:53497556-53497578 GATGGAGGAGAAGGCCTAGCAGG - Intronic
1139473934 16:67193072-67193094 GATCGAGGAGCTGCAGCAGCGGG + Exonic
1142174364 16:88638465-88638487 GAAGGAAGAAGCGCCCCAGCTGG + Intergenic
1142364068 16:89640488-89640510 CATGGAGCAGCAGCCCCTGCAGG + Intergenic
1203087241 16_KI270728v1_random:1190966-1190988 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1142501345 17:334905-334927 GAAGGAGGAGCCGCACTTGCTGG - Intronic
1142668765 17:1477727-1477749 GAGGGAGGTGCCGCCCCAGTTGG - Intronic
1143119218 17:4596819-4596841 GCTGGAGGGGCCCCCGCAGCAGG + Intronic
1143498204 17:7324313-7324335 GATGCAGGACCAGCCCCGGCAGG - Intronic
1145010115 17:19363128-19363150 CTCGGAGGAGCCTCCCCAGCTGG + Intronic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145841892 17:28002037-28002059 GATGGAGGAGCTGACCCAGGAGG + Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146374635 17:32285821-32285843 GATGGGGGAGCCGCCACCACTGG + Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147144881 17:38479111-38479133 CATGGAGGAGGTGCCCCAGGAGG - Intronic
1148208658 17:45795054-45795076 TCTGGAGGAGCTGACCCAGCAGG + Intronic
1148549397 17:48541746-48541768 GCAGGAGGCGCCGGCCCAGCCGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150285498 17:63951621-63951643 GAAGAAGGAGCCGCCCGAGGAGG - Exonic
1150358053 17:64505483-64505505 GGGGGAAGCGCCGCCCCAGCGGG - Intronic
1151681432 17:75624772-75624794 GCTGCAGGGGCCGCACCAGCTGG - Intergenic
1152510833 17:80786616-80786638 AATGGAAGAGCCGCAGCAGCTGG + Intronic
1152636384 17:81432243-81432265 GATGGTGCAGCCGCCCCGGCAGG + Intronic
1153308337 18:3652970-3652992 GAAGGAGGGGCCACCCGAGCTGG - Intronic
1157506126 18:48228038-48228060 GATGGAGAGGCCGCCCCACCTGG + Intronic
1157687061 18:49651047-49651069 GATGCAGGAGCCCCTCCACCTGG - Intergenic
1158404311 18:57147368-57147390 GATGGGGCCGCCGCCCCCGCTGG - Exonic
1158609723 18:58928192-58928214 GTGGGAGGAACAGCCCCAGCTGG - Intronic
1160051571 18:75438855-75438877 GATAGAGGTGCCCCCCGAGCAGG + Intergenic
1161849762 19:6732235-6732257 GATGGAGCAGCCTCCGGAGCAGG - Intronic
1162958900 19:14114665-14114687 GAGGGAGCAGCGGCCCCAGGGGG - Intronic
1163654127 19:18535805-18535827 GAGAGAGGAGCCGGCCCAGGAGG + Intronic
1164156248 19:22599283-22599305 CATGGAGGAGCGGGCACAGCTGG + Intergenic
1164733429 19:30523040-30523062 TTTGGAGGAGCTGCCCCAACTGG + Intronic
1165097441 19:33417326-33417348 GCTGGTGGAGCCCCCTCAGCTGG + Intronic
1165695106 19:37894971-37894993 GATGGAGGAGCCGCTGCTGGTGG + Exonic
1165749919 19:38253393-38253415 GGGGAAGGGGCCGCCCCAGCTGG - Intronic
1166276705 19:41758853-41758875 GCCGGAGCAGCCGCCCCTGCCGG + Intronic
1166733647 19:45072034-45072056 GCTGGAGCCGCCGCCACAGCAGG - Exonic
1167436527 19:49481581-49481603 GAAGGAGGGGAGGCCCCAGCGGG + Intronic
1167568610 19:50272648-50272670 GATGGTGGAGCAGCAACAGCGGG + Exonic
1167676495 19:50889667-50889689 GAGGTAGGAGGGGCCCCAGCTGG - Intergenic
1167697513 19:51024052-51024074 GCTGGACGTGCTGCCCCAGCCGG + Exonic
925159347 2:1673118-1673140 GATGGATGAGAGGCCACAGCTGG + Intronic
926122815 2:10254114-10254136 GACGGAGGAGCTGCCAAAGCTGG - Intergenic
927211953 2:20644519-20644541 GATGGAGGAGCAGACCTAGGGGG - Intronic
927847487 2:26479142-26479164 GCTGCAGGAACGGCCCCAGCAGG - Intronic
927948055 2:27149228-27149250 GGAAGAGGAGCCGCCTCAGCAGG + Exonic
928090238 2:28369326-28369348 GAGAGAGGGGCAGCCCCAGCTGG - Intergenic
929585179 2:43109325-43109347 GATGGAGGAGCAGTCACAGTGGG + Intergenic
930026382 2:47031695-47031717 GATGGAGGGGCCCCCTCAGCTGG - Intronic
934682551 2:96295490-96295512 GAATGATGAGCCGCACCAGCTGG + Exonic
937100097 2:119261976-119261998 GATGGAAGAGTAGGCCCAGCGGG + Intronic
938795995 2:134718797-134718819 GGTGCGCGAGCCGCCCCAGCTGG - Exonic
942493908 2:176518995-176519017 GATGCAGGGGCTTCCCCAGCAGG - Intergenic
946219994 2:218217657-218217679 GGTGTAGGGGCTGCCCCAGCGGG + Intronic
946406698 2:219495783-219495805 GATTGAAAAGCTGCCCCAGCAGG + Intronic
948612282 2:239177506-239177528 GCCGGAGGAAACGCCCCAGCGGG + Intronic
948636323 2:239340124-239340146 GAGGGAGCAGCAGCACCAGCAGG - Intronic
1169046318 20:2536957-2536979 GGTGGCTGAGACGCCCCAGCAGG - Intronic
1169806550 20:9566112-9566134 GTCGGAGGAGGAGCCCCAGCTGG + Exonic
1171123764 20:22585046-22585068 GAGGCCGGAGCCGCCCCAGAGGG - Intronic
1176035423 20:63033977-63033999 GATGGAGGAACAGGCCCAGGAGG + Intergenic
1178913415 21:36693847-36693869 GCTGGAGGGGCCAACCCAGCGGG + Intergenic
1180609260 22:17085133-17085155 GCAGCAGGAGCAGCCCCAGCAGG - Exonic
1180953306 22:19730399-19730421 GATTGAGGAGTAGCCACAGCGGG - Intergenic
1181026690 22:20131338-20131360 GCTGGAGGAGCCCGGCCAGCGGG - Intronic
1181778117 22:25174423-25174445 GATGGAGGGGCCGCCTCCACCGG + Exonic
1182211316 22:28679702-28679724 GATGGAGCAGTCGCCGCCGCCGG - Exonic
1183301408 22:37060837-37060859 GCTGGAGGAGCAGCAGCAGCAGG + Exonic
1183429683 22:37758021-37758043 GCTGGAGAAGCTGCCCCTGCGGG + Exonic
1183683780 22:39350257-39350279 GAAGGAGGAGCGGCGGCAGCGGG - Intronic
1184046690 22:41976661-41976683 GGTCCAGGAGCCGCCCCCGCGGG - Intronic
1184264326 22:43339000-43339022 GCTGGAGGCTCAGCCCCAGCTGG + Intronic
1184430611 22:44439817-44439839 GAAGGAGAAGCGGACCCAGCTGG - Intergenic
1184520451 22:44990978-44991000 TGTGGAGGAGCCGCGGCAGCAGG - Intronic
1184655103 22:45937122-45937144 GATGGAGGAGCCGCACTGGATGG - Intronic
1184738573 22:46413402-46413424 GAGGGAGGAGAAGCCTCAGCTGG - Intronic
1184764014 22:46562178-46562200 GGTGGAGCAGCCCCCCCAGAGGG + Intergenic
1185014650 22:48335833-48335855 CCAGGAGGAGCTGCCCCAGCAGG - Intergenic
1185039139 22:48495539-48495561 GATGGAGGAGCCTCCCCAGATGG - Intronic
951509169 3:23482426-23482448 GGTGGAGGTGTAGCCCCAGCTGG - Intronic
951635488 3:24770346-24770368 GATGGGGGAGCCCCACCTGCAGG + Intergenic
953565730 3:44030382-44030404 GATGGACGTGCCGCCGCAGAAGG - Intergenic
954456216 3:50601136-50601158 GGTGGAGGACACGCCCCAGGGGG - Intergenic
956867694 3:73385701-73385723 GCTGGAGGAGCAGCACCACCAGG - Exonic
961513495 3:127418926-127418948 GAAGGAGGAGACTGCCCAGCCGG + Intergenic
962339970 3:134574245-134574267 GATGGAGGAGCGGCTTCTGCAGG + Intronic
966775747 3:183541375-183541397 GAAGGAGGAGCTGCCACAGTTGG + Intronic
968069824 3:195777973-195777995 GATGGAGGAGCACCCCAGGCAGG - Intronic
968504710 4:966489-966511 GATGGACGAACAGCCCCTGCTGG - Exonic
968801245 4:2744541-2744563 GAAGGAGGAAGCGCCCCACCAGG + Intronic
973633520 4:52841568-52841590 GATGGAGCAGCCCAGCCAGCTGG - Intergenic
976269570 4:83217486-83217508 GATGGTGGACCCCCGCCAGCTGG + Intergenic
979189062 4:117834556-117834578 GATGGAGGAACAGCCCCTTCTGG - Intergenic
979417526 4:120461359-120461381 GATGGAGGACACCTCCCAGCAGG + Intergenic
979919549 4:126479896-126479918 AACGGAGGAGCGGCCCCTGCTGG + Intergenic
981074692 4:140579338-140579360 CTTGGAGGGGCCGCTCCAGCTGG + Intergenic
985376095 4:189340252-189340274 GAAGGAGGAGAAGACCCAGCAGG + Intergenic
985665848 5:1181207-1181229 GACCGAGGGGCCGCCCCTGCTGG + Intergenic
986195155 5:5531607-5531629 AATGGAGGAGTCGGCACAGCTGG - Intergenic
986290512 5:6395820-6395842 CATGGAGGAGCTGAACCAGCAGG + Intergenic
986799820 5:11247223-11247245 GATGGTGGCTCAGCCCCAGCAGG + Intronic
988923235 5:35963458-35963480 AATGGAGGAGCGACCCCTGCTGG - Intronic
992746278 5:79824191-79824213 AATGGAGAAGAGGCCCCAGCAGG - Intergenic
993307901 5:86293145-86293167 GATGAAGAACCCTCCCCAGCTGG + Intergenic
998939056 5:147260943-147260965 GAAGGAGAAGCCGCGGCAGCCGG - Intronic
1001937355 5:175714822-175714844 AATGGAGGTGCGGCCCAAGCTGG - Intergenic
1003834770 6:10059012-10059034 GATGCAGGAGCAGCAACAGCTGG + Intronic
1004319371 6:14620809-14620831 GCTGGAGGAGCCGTGGCAGCTGG - Intergenic
1005851724 6:29827958-29827980 GAGGGAGGGGCCGGCCCGGCGGG + Intronic
1005966604 6:30731031-30731053 GGTGGTGGAGCGGGCCCAGCAGG - Exonic
1007492682 6:42236258-42236280 CACGGAGGGGCCGCCCCTGCAGG - Exonic
1007679488 6:43624595-43624617 GCTTGAGGACCCGCTCCAGCTGG + Exonic
1015786552 6:136924444-136924466 GATGGAGGAGCTGCCCGGGGAGG + Exonic
1017163890 6:151390686-151390708 GCTGTAGGAGCCGCTGCAGCTGG + Intronic
1019170224 6:170129577-170129599 GATGGAGGGGCTGCTCCAGCAGG - Intergenic
1019287500 7:231106-231128 GCAGGAGCAGCAGCCCCAGCAGG + Intronic
1019482885 7:1274521-1274543 GATGGGGGTGCCCCCCAAGCAGG - Intergenic
1021893997 7:25216155-25216177 GATGGAGGAACGGAGCCAGCAGG - Intergenic
1024064488 7:45721118-45721140 GGTGGAGGGGCCACCTCAGCAGG + Exonic
1025229056 7:57187692-57187714 AAAGGAGGAGAAGCCCCAGCAGG + Intergenic
1026015076 7:66666181-66666203 GATGAAGGAGCCTCCTCTGCAGG + Intronic
1026776701 7:73235176-73235198 GATGGACGACCTGGCCCAGCGGG - Intergenic
1026901057 7:74037787-74037809 GAGGGAGGAGCCTACCCAGCTGG + Intronic
1027017553 7:74788546-74788568 GATGGACGACCTGGCCCAGCGGG - Exonic
1027070470 7:75157386-75157408 GATGGACGACCTGGCCCAGCGGG + Intergenic
1029284712 7:99457698-99457720 GTTAGAGAAGCCGCCTCAGCCGG + Intronic
1032340978 7:131072782-131072804 GAAGGAGGAGCTGCAGCAGCAGG + Intergenic
1034508939 7:151519256-151519278 GGTGGAGGAGCCGCGGTAGCTGG - Intronic
1034781638 7:153887218-153887240 GCTGGAGGAGCCCCCGGAGCCGG + Intronic
1035293977 7:157857471-157857493 GATGGAGGAGCCCCTTCTGCAGG + Intronic
1035360531 7:158310595-158310617 AATGGAGGAACCTCCCGAGCAGG - Intronic
1035530852 8:349870-349892 CATGAAGAAGCCGCCCCTGCAGG - Intergenic
1035569983 8:666521-666543 GAGAGAGGAGGGGCCCCAGCAGG - Intronic
1037963944 8:23118903-23118925 GAGGGGGGAGCGGCACCAGCTGG + Intergenic
1038544429 8:28414143-28414165 ACTTGAGGAGCCGCCCCAGGTGG + Intronic
1039428369 8:37505610-37505632 GCTGGAGGAGCCTCCCAGGCAGG - Intergenic
1042084976 8:65097520-65097542 GAAGGAGGAGCCACTCCAGTTGG + Intergenic
1043982689 8:86659305-86659327 CATGGAGGAGCAGGCACAGCTGG - Intronic
1047534293 8:125705079-125705101 GCTGAAGGAGCAGCCCCATCTGG + Intergenic
1049150150 8:141029784-141029806 CATGGATGCGCTGCCCCAGCTGG - Intergenic
1049237026 8:141517568-141517590 GAGGGAGGTGCGGCCCCAGGAGG - Intronic
1049349087 8:142154492-142154514 GTTGGAGAAGCAGCTCCAGCTGG - Intergenic
1049586519 8:143434955-143434977 GGTGGAGGAGCCGTGCCAGGAGG - Intergenic
1050512933 9:6413562-6413584 GATTGAGGAGCTGCGCGAGCGGG + Exonic
1055279732 9:74660669-74660691 CATGGAAGAGCTGCACCAGCTGG + Exonic
1057178378 9:93015826-93015848 GATGGAGGAGCTCACCCACCTGG - Exonic
1057227641 9:93300916-93300938 GGAGGAGGAGCCGGCCAAGCAGG - Intronic
1057383203 9:94587062-94587084 GATGCAGGAACCGCCTCAGTGGG - Intronic
1058012945 9:99998503-99998525 GATGGGGGAGCCGGGACAGCGGG - Intronic
1060215703 9:121737137-121737159 GAGGGAGGAGCCGTCCCTACAGG - Intronic
1061060903 9:128250180-128250202 GATGGAGGAGTCGGCGGAGCAGG + Exonic
1061063307 9:128261685-128261707 CATGGAGGAGCGGGCACAGCTGG - Exonic
1061329940 9:129885962-129885984 GCTGGAGGAGCCGGCCCCACAGG + Intergenic
1061970120 9:134040360-134040382 GATGTCGGAGCTGCCTCAGCTGG + Intronic
1062276677 9:135734688-135734710 CATGGAGCAGCCGCCCCGGGTGG + Intronic
1062425100 9:136502462-136502484 GACCGTGGAGCCGCCCCCGCCGG - Exonic
1185829531 X:3286915-3286937 GCTGGAGGAACAGTCCCAGCTGG - Intergenic
1187064822 X:15823133-15823155 GCCGCAGGAGCCGCCGCAGCCGG + Exonic
1190369359 X:49726705-49726727 CATGGAGGAGCGGCCAGAGCGGG + Intergenic
1191085541 X:56563778-56563800 GAAGGAGGCACCGCCGCAGCGGG - Exonic
1196871236 X:120115589-120115611 GCCGGAGGAGCCGGCCCAGGCGG - Exonic
1199762858 X:150918477-150918499 GATGGAGGAGCTGCCTCTGTAGG + Intergenic
1200234600 X:154462193-154462215 GATCGAGGGGCTGCCCCTGCTGG + Exonic