ID: 914720194

View in Genome Browser
Species Human (GRCh38)
Location 1:150282910-150282932
Sequence CCTGGCGAACAACGGGCGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914720183_914720194 21 Left 914720183 1:150282866-150282888 CCTCAGGTGGAGAGGCTTGCTGC 0: 1
1: 0
2: 2
3: 14
4: 203
Right 914720194 1:150282910-150282932 CCTGGCGAACAACGGGCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914720194 Original CRISPR CCTGGCGAACAACGGGCGGA GGG Exonic
900556954 1:3285344-3285366 CCTGGGGAACAATGGGGTGAGGG - Intronic
909677046 1:78250352-78250374 CCTGGCAAGCTACGGGCAGATGG - Intergenic
914720194 1:150282910-150282932 CCTGGCGAACAACGGGCGGAGGG + Exonic
916208697 1:162340640-162340662 CGTAGAGAACAACGGGTGGAGGG + Intronic
920210639 1:204325841-204325863 CCAGGCGAACAAGGGGTGGAAGG + Intronic
924743797 1:246814055-246814077 CATGGGGAAGAACGGGGGGAAGG - Intergenic
1073098185 10:100993168-100993190 CCTGGGGAACAGGGGGCAGAAGG - Exonic
1088212627 11:107473418-107473440 CCTGGCAAACAACTGGTGTAAGG + Intergenic
1101246141 12:102885784-102885806 GCTGGTGAACATCGGGTGGAGGG - Intronic
1119668898 14:76504009-76504031 CCTGGGGAACAAGGGGCACAAGG + Intergenic
1123036773 14:105474815-105474837 CCCGGAGGAGAACGGGCGGAGGG + Intronic
1136551971 16:30986683-30986705 CCTGGAGGCCAACGGGAGGAAGG + Exonic
1139670102 16:68486960-68486982 CCTGGCTGACAAAGGGAGGAGGG - Intergenic
1148741674 17:49896890-49896912 CCTGGGGAAGAAGAGGCGGAGGG - Intergenic
1163112519 19:15170170-15170192 CCTGGCGGACAATGGGAAGAGGG + Exonic
925230944 2:2233368-2233390 CCTGGAGACCAACGGGCTGCGGG + Intronic
927948372 2:27150785-27150807 CCAGGAGAACAACGGTCTGAGGG + Intronic
946313991 2:218897639-218897661 CCTGGCGGAGGACGGGCGGGCGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174282923 20:49452403-49452425 CCTGGCAAACAAGGTGGGGAGGG + Intronic
955106428 3:55902862-55902884 CCTGGCGGAGAGTGGGCGGATGG + Intronic
961698893 3:128726405-128726427 CCTGGCGACCGAGGGGCTGAGGG - Intronic
965544731 3:169903890-169903912 CCTGGAGAACAACGGGCCCCAGG - Intergenic
986695990 5:10354304-10354326 CCTGGCGAGCAATAGGCAGAAGG - Intronic
998957522 5:147453267-147453289 CCTGGGGAACTACCGGCGGTGGG + Intronic
1008464464 6:51815052-51815074 CTTGGCAAACAAAGGGTGGATGG - Intronic
1028232411 7:88321092-88321114 CCTGGAGAAGAACGGGTGTAGGG - Intergenic
1035619575 8:1027561-1027583 CCTGGAGAATAACGGGCGCTTGG - Intergenic
1035619611 8:1027681-1027703 CCTGGAGAATAACGGGCGCCTGG - Intergenic
1035619667 8:1027891-1027913 CCTGGAGAATAACGGGCGCCTGG - Intergenic
1035619707 8:1028071-1028093 CCTGGAGAATAACGGGCGCTTGG - Intergenic
1036454027 8:8892830-8892852 CCTGGGGAACAACGGCCTGGAGG - Exonic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1185448591 X:271334-271356 CCTGGGGCACAGCGGGAGGAAGG + Intergenic
1186427796 X:9477983-9478005 CCTGGGGATGAAGGGGCGGAAGG - Intronic