ID: 914720628

View in Genome Browser
Species Human (GRCh38)
Location 1:150285851-150285873
Sequence CTGTAGTCCCAGCTGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 2, 1: 7, 2: 15, 3: 75, 4: 594}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914720628 Original CRISPR CTGTAGTCCCAGCTGAGGCT GGG Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
900659642 1:3776186-3776208 CTGCAGCTCCTGCTGAGGCTGGG - Intergenic
900966606 1:5962993-5963015 CTCAAGTCCCAGCTGTGGCCGGG + Intronic
901008271 1:6182190-6182212 CTGTAGTCCCAGCTGCTACTGGG - Intronic
901038872 1:6352283-6352305 AAGGAATCCCAGCTGAGGCTGGG - Intronic
901072783 1:6530906-6530928 GTGTAGTCAAAGTTGAGGCTAGG - Intronic
901221190 1:7584794-7584816 CGGTTGTCACAGCTGAGGGTGGG + Intronic
901452596 1:9345091-9345113 CTGGAGTCCCACAGGAGGCTAGG + Intronic
901526836 1:9828568-9828590 CTGTAGTCCCAGCTACTACTCGG + Intergenic
901575290 1:10195887-10195909 CTGTAGTCCCAGCTGCTTCTTGG - Intergenic
901724231 1:11228223-11228245 CTGTCGTCCAAGCTGAAGCACGG + Intronic
902201715 1:14838439-14838461 CTTTCTTCCCAGCTGAGGTTTGG - Intronic
902479206 1:16702770-16702792 CTGTGGTCCCACAGGAGGCTTGG + Intergenic
902687102 1:18085311-18085333 CTGCAGGCTCAGCTGAGGATTGG + Intergenic
902749458 1:18497321-18497343 CTCTAGGCTCAGCTGCGGCTGGG + Intergenic
902816733 1:18920729-18920751 CTGTCTCCCCACCTGAGGCTTGG - Intronic
903772618 1:25773486-25773508 CTGCAGTCCCATCTCAGTCTGGG + Intronic
903837047 1:26211201-26211223 CTGTAGTTCCAGCGGAGGCCTGG + Intergenic
903926219 1:26832615-26832637 TTCTACTCCCAGCTGAAGCTGGG + Intronic
904023106 1:27483511-27483533 CTGTAATCCCAGCTGCTACTAGG + Intronic
904482568 1:30803215-30803237 CTGCAGTCCCAGCTGCTACTTGG + Intergenic
904929847 1:34078093-34078115 CTGTAGTCCCAGCTACTACTCGG - Intronic
905548003 1:38815563-38815585 CTGAAGTCACAGCTGAGACTTGG + Intergenic
905583526 1:39100091-39100113 CTGTAGTCCTAGCTGCTGGTGGG + Intronic
905659569 1:39711085-39711107 CTGTAATCCCAGCTCAAGATGGG + Intronic
905662299 1:39736938-39736960 CTGTACTCCCAGCTGCTACTCGG + Intronic
905682719 1:39885703-39885725 CTGCAGTCCCAGCTGGGGTGGGG - Intergenic
905872801 1:41414823-41414845 GTGCTGTCCCTGCTGAGGCTGGG + Intergenic
906031400 1:42723105-42723127 CTGTAGTCCCAGGCGGGACTCGG + Intergenic
906103104 1:43275577-43275599 CTGTAGTCCCATATCAGGCCAGG - Intergenic
906448166 1:45921720-45921742 CAGGAGTCACAGCTCAGGCTCGG + Intronic
906502299 1:46350271-46350293 CTGTAATCCCAGCACAAGCTAGG + Intronic
907181895 1:52578117-52578139 CTGTAGTCTCAGCTGAACCTGGG + Intergenic
908263112 1:62353924-62353946 CTGTATTTCCAGCTGAAACTGGG - Intergenic
908519418 1:64926705-64926727 CTGTAGTGCCAGTGAAGGCTGGG - Intronic
908841845 1:68288203-68288225 CTGTAGTCCCAGCTACTCCTGGG - Intergenic
909572961 1:77138502-77138524 CTGTGGTCTCATCTGAGGCTTGG - Intronic
909617623 1:77629494-77629516 CTGTAGTCCCAGCAGCAACTTGG + Intronic
910012370 1:82481212-82481234 CTGAAGTCACAGGTAAGGCTGGG + Intergenic
910142609 1:84042772-84042794 ATGTTGTCCCAGGTTAGGCTTGG + Intergenic
911655375 1:100437061-100437083 CTGTAGTCCCAGCTAATTCAGGG + Intronic
911814944 1:102336530-102336552 CTGTATTTCCAGCTGAGGCAGGG + Intergenic
912160233 1:106974150-106974172 CTGTAGTCCCAGCTACTACTTGG - Intergenic
912520250 1:110240219-110240241 CTGCTGTCCCACCTAAGGCTGGG - Intronic
913294272 1:117303735-117303757 GAATAGACCCAGCTGAGGCTGGG + Intergenic
913477384 1:119251493-119251515 CTGTAATCCCAGCCGAGGCAGGG + Intergenic
914005355 1:143728263-143728285 CTGTAGTCCCAGCTACTGGTAGG + Intergenic
914097835 1:144559513-144559535 CTGTAGTCCCAGCTACTGGTAGG + Intergenic
914301156 1:146378095-146378117 CTGTAGTCCCAGCTCCTGGTAGG - Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
915226063 1:154412376-154412398 CAGTAATCCCAGCTGAGGCCAGG - Intronic
915252683 1:154601883-154601905 TTGCAGTCTCAGCTCAGGCTTGG - Exonic
915483666 1:156204939-156204961 CTGCCATCCCAGCTGAGACTTGG + Intronic
915926918 1:160029520-160029542 CTGTAGTCCCAGCTACTCCTCGG - Exonic
915995194 1:160555204-160555226 CTGTAGTCCCAGCTACTCCTCGG - Intronic
916093097 1:161324353-161324375 CTATAATCCCAGCCGAGGCAGGG - Intronic
916233788 1:162565101-162565123 CTGTAATCCCAGCACAGGCCTGG - Intronic
916527217 1:165621922-165621944 CTGTAATCCCAGCATAGGCTAGG + Intergenic
916787698 1:168098322-168098344 CTGTAGGCCCAGCTAAGGACTGG + Intronic
917371133 1:174295503-174295525 CTGTAGTCCCAGCTGCTGGGAGG - Intronic
917437557 1:175036526-175036548 CTGTAGTCCATGCTGGGGCCTGG + Intergenic
917521559 1:175752121-175752143 CTGTAGTCCCAGCTACAGGTGGG + Intergenic
920305996 1:205018516-205018538 CAGCAGCCCTAGCTGAGGCTTGG - Exonic
920711297 1:208297468-208297490 CTGTAGAGCTCGCTGAGGCTAGG - Intergenic
920878088 1:209855828-209855850 CTGTTCTCCCAGCTGAGCCAAGG + Exonic
921298404 1:213726206-213726228 CTGTAGTCCCAGATGTGCCCAGG - Intergenic
922672215 1:227519175-227519197 CTGTGTTCTCAGCTGAAGCTGGG + Intergenic
922743896 1:228032259-228032281 CTGTCCTCCAAGCTGAGCCTTGG + Intronic
923593055 1:235337704-235337726 CTGTAGTCCCAGCTGAGGCACGG + Intronic
924822169 1:247503801-247503823 CTGTGTTCTCAGCTGAAGCTGGG + Intergenic
1063027217 10:2192241-2192263 CTGTAATCCCAGCTGTGATTGGG - Intergenic
1063293557 10:4777484-4777506 CTGTAGTCCCAGCTATAGCCTGG - Intergenic
1063337845 10:5233943-5233965 CTGTATTCCCAGCTAAATCTAGG - Intergenic
1064045556 10:12011473-12011495 CTGTAGTCCCAGTTATTGCTTGG + Intronic
1064923445 10:20543529-20543551 CTGAAGTCACAGCTGAAACTGGG + Intergenic
1065207738 10:23373178-23373200 CTGCAGTCCCAGCTACAGCTGGG - Intergenic
1065622791 10:27600291-27600313 CTGTAATCCCAGCCAAGGCCGGG - Intergenic
1065859859 10:29863463-29863485 CTGTAGTGCCAGCTGAAGGAGGG - Intergenic
1066231466 10:33438850-33438872 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1066267769 10:33792791-33792813 CTGTAGTCCCAGCTGGGCTGAGG + Intergenic
1066538051 10:36412726-36412748 CTGTAGTCCCAGCAGTTACTAGG + Intergenic
1067317288 10:45180627-45180649 CTGCAGCCCCAGCTCAGGCAGGG - Intergenic
1067494917 10:46753316-46753338 CTGTAGTCCCAGCTAATGGGGGG - Intergenic
1067523894 10:47027062-47027084 CTGAAGCTCCATCTGAGGCTGGG - Intergenic
1067599737 10:47587080-47587102 CTGTAGTCCCAGCTAATGGGGGG + Intergenic
1068077108 10:52270161-52270183 CTGCAGTCTCAGCAGAGACTAGG + Intronic
1068085442 10:52368230-52368252 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1068099058 10:52529164-52529186 CTGTAGTCCCAGCTGCCTCAGGG + Intergenic
1068925455 10:62531472-62531494 CTGTAGTCCCAGCTGCTGGGCGG + Intronic
1069021380 10:63492154-63492176 CTGTAGTCCCAGCTGCTTCCGGG - Intergenic
1069396862 10:67998860-67998882 CTGTAGTCCCAGCTGCTCGTTGG - Intronic
1069636223 10:69926455-69926477 TGGTTGTCACAGCTGAGGCTCGG - Intronic
1069673478 10:70230846-70230868 CTGTACTCCCAGGCTAGGCTGGG + Intronic
1070087330 10:73250083-73250105 CTGTAGTCCCAGCTACTCCTGGG + Exonic
1070242989 10:74701816-74701838 ATGTAGTCCCAGCTGCTACTTGG + Intronic
1071252140 10:83829843-83829865 CTTTAGGCCAAACTGAGGCTTGG + Intergenic
1071651271 10:87394966-87394988 CTGTAGTCCCAGCTAATGGGGGG + Intergenic
1071681098 10:87706634-87706656 CTGTAGTCCCAGCTACTTCTAGG + Intronic
1072254490 10:93608287-93608309 CTGTAGTCTCAGCTGAGACTGGG - Intergenic
1072343445 10:94478583-94478605 CTGTAGTCCCAGCTGCTATTTGG + Intronic
1073087462 10:100902375-100902397 CTATAGTCCCAGCTGAGGTAGGG - Intergenic
1073908116 10:108308172-108308194 CTGTAGTCCCACGGGAGGCTGGG - Intergenic
1074121921 10:110499150-110499172 CTGTAGGCTCAGCTCAGGATGGG - Intronic
1076514318 10:131034625-131034647 CTGTAGCCCCAGCTCAGCCCTGG - Intergenic
1076626859 10:131826405-131826427 CTGGAGGCCCAGCACAGGCTGGG - Intergenic
1076691609 10:132226556-132226578 CAGCAGCCCCAGCTGAGACTGGG - Intronic
1077068467 11:655952-655974 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
1077298039 11:1835135-1835157 CTGTGGTGCCAGCTGGGGCCGGG - Exonic
1077300195 11:1843172-1843194 CTCAGGTCTCAGCTGAGGCTTGG - Intergenic
1077336873 11:2009266-2009288 CTGTAGGGTCAGCAGAGGCTGGG - Intergenic
1077806812 11:5598322-5598344 CTCTTGTCAAAGCTGAGGCTTGG - Intronic
1078436154 11:11327613-11327635 CTGCAGACCCAGCAGTGGCTTGG + Intronic
1079797645 11:24826048-24826070 CTGTAGTCCCAGCTACTACTCGG + Intronic
1080702002 11:34651811-34651833 CTGTCATCACATCTGAGGCTGGG + Intronic
1081469462 11:43356501-43356523 CTGCAATCTCATCTGAGGCTTGG - Intergenic
1081566310 11:44263330-44263352 GTGTACTCCCAGCTGAGGTGAGG + Exonic
1081589841 11:44414363-44414385 CTGTAGTCTCATCAGAAGCTTGG + Intergenic
1081619414 11:44610265-44610287 CTGTGGTCCTAGCTGGGACTTGG + Intronic
1081687017 11:45049856-45049878 CTGTACTCCAGGCTGAGGCTTGG - Intergenic
1081775592 11:45674225-45674247 CTGGGGTCCCAGCTGGGGCAGGG - Intergenic
1083039490 11:59671786-59671808 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
1083864744 11:65447521-65447543 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1083957839 11:65995883-65995905 CTGTAGTCCCAGCTATGGAGAGG + Intergenic
1084080710 11:66822559-66822581 CTGTAGTTTCTGCTGAGCCTGGG - Exonic
1084276031 11:68051405-68051427 CTGTAGTCTCAGGTGAGGGGAGG - Intergenic
1085029174 11:73259281-73259303 CTGTAGTCCCAGCTACTTCTCGG + Intergenic
1086114935 11:83238881-83238903 CTGTAGTCCCAGCTACTACTTGG + Intronic
1086467977 11:87075087-87075109 CTGTAGTCCCAGCTACTGGTCGG - Intronic
1086782184 11:90921101-90921123 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1087747749 11:101969141-101969163 CTGTAGTCCCAGCTGCTTGTGGG - Intronic
1087758639 11:102081767-102081789 CTGTAGTCCCAGCTTTGGGGAGG + Intronic
1087783817 11:102331761-102331783 CTGTAATCCCAGCTAAGGGAAGG - Intronic
1087913526 11:103780925-103780947 CTGTAGTCCCAGCTAGGGCGTGG - Intergenic
1088695326 11:112361423-112361445 CTGCTGCCCCAGCTAAGGCTGGG + Intergenic
1088797279 11:113274398-113274420 CAGTGGCACCAGCTGAGGCTGGG + Intronic
1089315637 11:117589100-117589122 CACCAGTCCCATCTGAGGCTTGG - Intronic
1089487392 11:118857533-118857555 CTGTAGTCCCAGCTTAAGCCTGG - Intergenic
1090080937 11:123612186-123612208 CTGTAGTCCCAGCTAATGGGAGG - Intronic
1090120524 11:124022549-124022571 CTGCAATCTCATCTGAGGCTGGG - Intergenic
1090175231 11:124642968-124642990 CTGGAGTCTCATCTGAGGCTTGG - Intronic
1202819857 11_KI270721v1_random:64448-64470 CTGTAGGGTCAGCAGAGGCTGGG - Intergenic
1091468796 12:708873-708895 CTGTAGTCCCAGCTGCTGGGGGG - Intergenic
1091496366 12:976539-976561 CAGCAGTCCCAGCTGAGCCCAGG + Intronic
1092281596 12:7101794-7101816 CTTGAGTGACAGCTGAGGCTGGG - Intronic
1092372521 12:7928911-7928933 CTGTAGTCCCAGCTACTACTCGG - Intronic
1092547148 12:9462005-9462027 CTGTAGTCCCAGCTACTCCTAGG + Intergenic
1093455394 12:19360205-19360227 CTGTAGTCCCAACTGCTACTGGG + Intronic
1094505790 12:31060059-31060081 CTGTAGTCCCAGCTACTCCTAGG - Intergenic
1094812387 12:34151283-34151305 CTGTGTTCTCAGCTGAAGCTGGG - Intergenic
1095460286 12:42436363-42436385 CAGTAATGCCAGCTGAGGCCAGG - Intronic
1095735827 12:45555285-45555307 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1096269107 12:50149863-50149885 CTGTAGTCCCAGCTACTACTTGG - Intronic
1096354275 12:50927148-50927170 CTGTAGTCCCAGCTGCTGGGAGG - Intronic
1097383957 12:58927273-58927295 CTGTAGTCACAGTTGTGCCTGGG - Intergenic
1097836707 12:64280799-64280821 CCATAGTCTCATCTGAGGCTTGG - Intronic
1098886036 12:75961816-75961838 CTGTAGTCCCAGCTTACTCAGGG - Intergenic
1098970424 12:76849184-76849206 CTGTAATCCCAGCTGCTGGTGGG + Intronic
1099262097 12:80396373-80396395 CTGTAGTTTCATCTGAGGTTTGG + Intergenic
1099612557 12:84892910-84892932 CTGTAGTCCCAGCTACTTCTGGG - Intronic
1100055345 12:90502711-90502733 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1100625531 12:96327670-96327692 CTGTAGTCCCAGCTATGGTGGGG - Intronic
1100845110 12:98650237-98650259 TTGTAATCCCAGCTGAGGCGTGG + Intronic
1101012649 12:100467047-100467069 CTGTAGTCGCAGCTGCTACTTGG + Intergenic
1101380350 12:104208821-104208843 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1101725619 12:107385884-107385906 CTGTGGTCCTGGCTCAGGCTAGG - Intronic
1102273684 12:111562308-111562330 CTGTAGTCCCAGCTACAGATGGG + Intronic
1102312880 12:111860859-111860881 CTGTAATCCCAGCACAGGCATGG + Intronic
1102348085 12:112172359-112172381 CTGGAGGCCCCGCTGAGGCCAGG - Intronic
1102532901 12:113559847-113559869 CTGTAGTCCCAGCTCCAGCCTGG - Intergenic
1103295887 12:119886710-119886732 CTGTAGTCCCAGCTGCTTGTGGG + Intergenic
1103386567 12:120537181-120537203 CTGTAGTCCCAGCTGTGAAGAGG + Intronic
1103469994 12:121172507-121172529 CTGTAGTCCCAGCTGCCGGGAGG + Intronic
1103850048 12:123927167-123927189 CTGTAGTCTCAGCTGCTACTGGG - Exonic
1103940576 12:124499351-124499373 CTGTGGTCCCTGCTGAGCCCCGG + Intronic
1105386731 13:19937251-19937273 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1105926834 13:25016611-25016633 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG + Intergenic
1106420813 13:29584252-29584274 CTGTAGTCCTAGCAGAGGGCTGG - Intronic
1106731058 13:32541834-32541856 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1106739165 13:32620529-32620551 CTGTAGTCCCAGCAGCTACTTGG + Intronic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107334685 13:39342227-39342249 CTGTAATCCCAGCCGAGGTGGGG - Intergenic
1107977777 13:45706332-45706354 CTGAAGTCCCATCTGTGGATTGG - Intronic
1110488274 13:76071705-76071727 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1110884627 13:80617812-80617834 CTATAGTCCCAGCTGCTACTTGG + Intergenic
1111580907 13:90222473-90222495 CTGTAGTCCCAGCTACGGGCGGG + Intergenic
1111934386 13:94544565-94544587 CTGCAGTCCCTGCTTAGGCGAGG - Intergenic
1111940568 13:94602187-94602209 CTGGAGGTCCAGGTGAGGCTGGG - Intronic
1112427160 13:99313105-99313127 CTGTAGTCCCAGCTACTACTCGG - Intronic
1112534867 13:100243016-100243038 CTGTAGTCCCAGCTAAGTGGGGG - Intronic
1113471758 13:110551962-110551984 CTGTAGTCCCAGCTGAGAGGTGG + Intronic
1113827167 13:113265291-113265313 CTGTAGTCCCAGCTATGGGAGGG + Intronic
1115433306 14:33346107-33346129 CTGTAATCCCAGCTGAGGGGAGG + Intronic
1116159384 14:41249488-41249510 CTGTAATCCCAGCTGCTACTTGG + Intergenic
1116356637 14:43938712-43938734 CTGTAGAGCCAGCGGAAGCTGGG + Intergenic
1116614650 14:47119186-47119208 CTGTAGTCCCAGCTACGGGGTGG - Intronic
1116810785 14:49537957-49537979 CTGTAGTCCCAGCTCATGGTAGG - Intergenic
1118758470 14:68862916-68862938 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1119112455 14:71987640-71987662 CTGTAGTCCCAGCTATGGGAAGG - Intronic
1119288185 14:73473313-73473335 CTCTGGTCCCAGCTGAGCCCAGG - Intergenic
1119335685 14:73831642-73831664 CTGTAGTCCCAGCTACTGCGGGG - Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119511467 14:75214984-75215006 CTGTAGTCCCAGCTGCTGGGAGG - Intergenic
1119738607 14:76999626-76999648 CAGTCGTTGCAGCTGAGGCTTGG + Intergenic
1120052650 14:79885264-79885286 CTGTTGTCCCAGCTGCTGCGAGG - Intergenic
1120216911 14:81690213-81690235 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1120980067 14:90281301-90281323 CTGTGGTCCCAGCTAAGGTGTGG + Intronic
1121093339 14:91198467-91198489 CTGTAGTCCCAGCTATGCTTGGG - Intronic
1121751268 14:96359247-96359269 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1122260533 14:100517719-100517741 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1122490852 14:102115019-102115041 CTGTAGTCCCACCTGCTACTCGG + Intronic
1124018860 15:25902110-25902132 CTGCAGGCTCATCTGAGGCTGGG - Intergenic
1124106274 15:26740632-26740654 CTGTCTCCACAGCTGAGGCTTGG + Intronic
1124571142 15:30865122-30865144 CTGTAGTCCCAGGTGCAGATTGG + Intergenic
1124648852 15:31460256-31460278 CTGTAGTCCCAGCTGGTGGCGGG - Intergenic
1126031801 15:44506540-44506562 CTGTAGTCCCAGCTACTGTTTGG - Intronic
1127126024 15:55812797-55812819 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1127435216 15:58950567-58950589 CTGTAGTCCCAGCTATCGGTGGG - Intronic
1127485126 15:59411788-59411810 CTGTAGTCCCAGCTGAGTCTGGG + Intronic
1127945196 15:63744445-63744467 CTCTAGACCCACCTGAGGCTTGG - Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128463724 15:67891059-67891081 CTGTAATCCCAGCTGAAGCAGGG - Intergenic
1128611814 15:69080009-69080031 CTGTAGTCCCAGCTACGGGGAGG - Intergenic
1128831673 15:70774930-70774952 CTGTAGTCCCAGCTACTGGTCGG + Intergenic
1128874881 15:71193831-71193853 CTGTAGTCCCAGGGGGGACTAGG - Intronic
1129323314 15:74786777-74786799 CTGTAGCCCCAGATGACCCTAGG + Intronic
1129356019 15:74992436-74992458 CTGTAGTCCCAGCTGCTGGGAGG - Intronic
1129413619 15:75362794-75362816 CTGGAGTCCCAGCCCAGGCCTGG - Intronic
1130330098 15:82915588-82915610 CTGTAGTCCCAGCTGCTGGGAGG + Intronic
1130563276 15:84975101-84975123 CAGTAATCCCAGGTGAGGCCTGG + Intergenic
1130897934 15:88184983-88185005 CTGAAGTCTCAGATGAAGCTAGG - Intronic
1131037204 15:89230723-89230745 CTGAAGGCCCACCTGAGACTGGG + Intergenic
1131543925 15:93299721-93299743 TTGAAGTCCCAGCTTGGGCTTGG - Intergenic
1132302825 15:100787109-100787131 CTCTAGACCCAGGTGAGGATCGG + Intergenic
1132806726 16:1778400-1778422 GTGCAGTCCCAGCAGGGGCTGGG + Intronic
1133048840 16:3105270-3105292 CTGTAGTCCCAGCTACTGGTGGG + Intergenic
1133050797 16:3116163-3116185 CCGAGGTCTCAGCTGAGGCTGGG + Intronic
1133161217 16:3913035-3913057 CTGCAGTTTCAGCTGGGGCTGGG - Intergenic
1133902781 16:9993105-9993127 CTGTAGTCCCAGCTACTCCTCGG + Intronic
1133950925 16:10391772-10391794 CTGTAGTCCCAGCTGCTGGAGGG + Intronic
1134281265 16:12819118-12819140 CTGTAATCCCAGCTGCTGCTAGG + Intergenic
1135117622 16:19737037-19737059 CTGTAGTCCCAGCTGCTCATGGG + Intronic
1135257375 16:20951864-20951886 CTGTAGTCCCAGCTACTCCTTGG - Intronic
1135327109 16:21533464-21533486 CTACAGTCCCAGCTGACACTGGG + Intergenic
1135404346 16:22187492-22187514 CTTTAGTCCCAGCTCAGGTGGGG + Intronic
1135546970 16:23372982-23373004 CTGTAGTCCCAGCTGTGCAGGGG + Intronic
1135702501 16:24644414-24644436 CTGTAGTCCCAGCTTCTTCTTGG - Intergenic
1136337425 16:29619304-29619326 CTACAGTCCCAGCTGACACTGGG + Intergenic
1136371436 16:29839060-29839082 CTGTAATCCCAGCTACTGCTCGG + Intronic
1136990056 16:35146567-35146589 CTGTAGTCCCAGCATAAGCCAGG + Intergenic
1137665670 16:50247485-50247507 CTGTAATCCCAGCTGCTACTCGG - Intronic
1137690936 16:50427061-50427083 CTGTGATCTCATCTGAGGCTCGG + Intergenic
1137840471 16:51636430-51636452 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1137993187 16:53180796-53180818 CTGTAGTCCCAGCTAATACTGGG - Intronic
1138012337 16:53394222-53394244 CTGTAGTCCCAGCTACTGCGGGG + Intergenic
1139482869 16:67240401-67240423 CTGTAATCCCAGCTACTGCTGGG + Intronic
1139939181 16:70592200-70592222 CTGCTGGCCCGGCTGAGGCTGGG + Intronic
1139953003 16:70680958-70680980 CTGCATTCCCAGCTGAGGTGAGG - Exonic
1140109605 16:71992120-71992142 CTGTAATCCTAGGTGTGGCTTGG - Intronic
1140239428 16:73187982-73188004 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1141186588 16:81791858-81791880 CAACAGTCCCAGCTAAGGCTGGG - Intronic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1141996620 16:87640044-87640066 CTGGAGTTCCAGCTGAGGGGGGG + Intronic
1142040223 16:87888648-87888670 CTACAGTCCCAGCTGACACTGGG + Intronic
1142581156 17:943697-943719 CTGTAATCCCAGCTACGACTCGG + Intronic
1143132155 17:4685668-4685690 CTGTAGTCCCAGCTATTGGTGGG + Intronic
1143493765 17:7298896-7298918 CTGTAGTCCCAGCTCAGGAGTGG - Intergenic
1143760720 17:9101868-9101890 CTGTAGTCCCAGCTGCTGGGAGG + Intronic
1144298880 17:13904730-13904752 ATGTAGTCCCAGCAGAGAATGGG + Intergenic
1144501766 17:15794040-15794062 CTGTAGTCCCAGCTGCTGGGGGG - Intergenic
1145163942 17:20596704-20596726 CTGTAGTCCCAGCTGCTGGGGGG - Intergenic
1145227226 17:21140144-21140166 CTGTAGTCCCAGCTAGGGGGAGG - Intronic
1145742302 17:27285547-27285569 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1145882587 17:28363358-28363380 CTCTAATCCCAGCTGAAGCCTGG + Exonic
1145949690 17:28806502-28806524 CTGTAGTCCCTTCGGTGGCTGGG + Intronic
1147332358 17:39706435-39706457 CTGGAGTTGCAGCTGAGGCATGG - Intronic
1147354737 17:39885891-39885913 CTGTAGTCCCAGCTCCTTCTAGG + Intergenic
1147504519 17:41002315-41002337 CTGTAATCCCAGCTGCTACTTGG - Intergenic
1148057678 17:44810894-44810916 CTGTAGTCCCAGCTACTGCAGGG - Intronic
1148212916 17:45819014-45819036 CAGGAGTCCCATCAGAGGCTGGG - Intronic
1148817930 17:50344148-50344170 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1148840445 17:50492705-50492727 CTGTAGTCCCAGCTACTGGTGGG + Intergenic
1148930705 17:51125049-51125071 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1149828234 17:59848975-59848997 CTGTAGTCCCAGCTACTGGTGGG - Intergenic
1150178936 17:63093872-63093894 CTGTAGTCCCAGCTACTACTTGG - Intronic
1150236162 17:63594518-63594540 CTGTGATCCCAGCTGAGGCATGG + Intergenic
1150398362 17:64837911-64837933 CTGTAGTCCCAGCTGCGTGGAGG - Intergenic
1150889915 17:69135810-69135832 CTGGAATCTCACCTGAGGCTGGG + Intronic
1151138050 17:71966537-71966559 CTGTAGCCCAACCTGAGACTTGG + Intergenic
1151225985 17:72648747-72648769 CTGGGGTCCCAGCTGGGACTGGG + Intronic
1151386004 17:73755820-73755842 CTGGAGCCTCAGCTGAGGCCTGG - Intergenic
1151440481 17:74125698-74125720 CTGTAGTCCCAGCTGTGCTTGGG - Intergenic
1151517148 17:74604007-74604029 CTGCTGTCCCAGGTGAAGCTGGG - Intergenic
1151801007 17:76379778-76379800 TTGTCGTCCTTGCTGAGGCTGGG - Intronic
1152255160 17:79234851-79234873 CTGTAGTCCCAGCTACTGGTAGG - Intronic
1152292134 17:79445949-79445971 CAGTTGTCACAGCTGTGGCTGGG + Intronic
1152431771 17:80252222-80252244 CTGAGGTCACAGCTGAAGCTGGG + Intronic
1152592401 17:81220146-81220168 CAGTGGACCCAGCTGAGGCTGGG - Intronic
1152681031 17:81668030-81668052 CTGTGGTTCCAGACGAGGCTTGG + Intronic
1152699943 17:81813756-81813778 CTGGACGCCCAGCTGAGGCTGGG + Exonic
1152815811 17:82407089-82407111 CTGTAATCCCAGCTGTAGCTGGG + Intronic
1153840882 18:9006692-9006714 CTGTAATCCCAGCTGCTACTGGG - Intergenic
1153896573 18:9567473-9567495 CTGTAATCCCAACTGAGGACAGG - Intronic
1154104235 18:11506273-11506295 CTCTAGTCCCAGCTGCGTCAGGG + Intergenic
1154218626 18:12433545-12433567 CTGTAGTCCCAGCTGTCGGGAGG - Intergenic
1154260472 18:12827505-12827527 CTGGAGTCCCAGCTGGGGTTGGG - Intronic
1155480776 18:26285088-26285110 CTGTAGTCCCAGCTACCGCAGGG - Intronic
1155750460 18:29416874-29416896 CTATCCTCCCAGCTCAGGCTTGG + Intergenic
1156386673 18:36611405-36611427 CTGAAGTCTCATCTGAGACTTGG + Intronic
1156552431 18:38031702-38031724 CTGTAGTCCCAGCTGCTACTTGG - Intergenic
1157851469 18:51056494-51056516 CTGTAGTCCCAGCTGCTCCGGGG + Intronic
1158459770 18:57635943-57635965 CTGTAGTCCCAGCTACGGGGAGG - Intergenic
1159527594 18:69612991-69613013 CTGTAGTCCCAGCTTCAGGTGGG - Intronic
1160202072 18:76804290-76804312 CTGTAATCCCAGCTGAGGGGAGG + Intronic
1160337707 18:78057422-78057444 CTGTAGTCCCAGCTCCTCCTGGG + Intergenic
1160830248 19:1101199-1101221 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1161532383 19:4797810-4797832 ATGTAGTCCCAGCTGCTACTGGG + Exonic
1161798896 19:6404394-6404416 CTGGGGTCCCAGATGGGGCTAGG - Intergenic
1162505714 19:11083475-11083497 CTGTAGTCCCAGCTGCGGAGAGG - Intergenic
1162704922 19:12548337-12548359 CTGTAGTCCCAGCTGCTGGGTGG - Intronic
1162978646 19:14223875-14223897 CTGTAGTCCCAGCTGCTCCCTGG - Intergenic
1163058783 19:14743055-14743077 CTGTAGTCCCAGCTACTCCTCGG - Intronic
1163261820 19:16195524-16195546 CTGTAGTCCCAGCTGAGCCAAGG + Intergenic
1163504003 19:17693747-17693769 CAGTAGTCCCAGATCAGCCTGGG - Intergenic
1163812380 19:19441685-19441707 CTGTAGTCCCAGCTACTGTTGGG - Intronic
1164972916 19:32547797-32547819 CTGAAGGCCCATCTGGGGCTGGG - Intergenic
1165210896 19:34235016-34235038 CTGTAGTCCCAGCTGCCGGGAGG - Intergenic
1166408712 19:42542135-42542157 CTGTAGTCCCAGCTACTACTCGG - Intronic
1166740509 19:45112092-45112114 CTGTAATCCCAGCTGGGATTTGG - Intronic
1166801281 19:45458922-45458944 CTGTAGTCCCAGCTACTACTTGG + Intronic
1167049054 19:47067662-47067684 CTGGGGTCCCGGCTGAGGCGAGG + Exonic
1167143278 19:47666831-47666853 CTGTAATCCCAGCCAAGGCAGGG - Intronic
1167508021 19:49881348-49881370 AGGTAGGCCCAGCTGAGGCCTGG - Exonic
1167514993 19:49918186-49918208 CTGTAGTCCCAGCTAACGGGAGG - Intronic
1167519882 19:49948120-49948142 CTGAAGTCTCAGCTGACGCTGGG - Intronic
1168288827 19:55347308-55347330 CTGGGGTCCCAGCAGGGGCTGGG - Exonic
1168312948 19:55470488-55470510 CTGTGGTCTCATCTGAGGTTGGG + Intergenic
1168648858 19:58080027-58080049 CTGTAGTCCCAGCTGCGTGGGGG - Intronic
1202713245 1_KI270714v1_random:28676-28698 CTGTGGTCCCACAGGAGGCTTGG + Intergenic
925098483 2:1226431-1226453 CTGTATTCCCAGTTGGTGCTGGG - Intronic
925287200 2:2723580-2723602 CTGTTGTCCTATCTGAGGTTTGG - Intergenic
925919049 2:8626687-8626709 CTGCAGGCCCAGCTGAGACGAGG + Intergenic
926239586 2:11074712-11074734 ATGTTGTCCCACCTGAGGCAAGG - Intergenic
926770775 2:16373025-16373047 CTGTAGTCCCAGCTACTGCAGGG - Intergenic
926820591 2:16847663-16847685 CTGTAGTCCCAGGTGGGTCGAGG - Intergenic
926886638 2:17604421-17604443 CTGTACTGCCAGCTCTGGCTGGG - Intronic
928930755 2:36621194-36621216 CTGGAATCCCAGCTCAGGCTTGG + Intronic
929058075 2:37895796-37895818 CTGTAGTCCCAGCTATGGGGAGG + Intergenic
929161497 2:38836968-38836990 CTGTAGTCCCAGCAAGGGGTTGG - Intronic
929734129 2:44527216-44527238 CTGTAGTCCCAGCTACTACTAGG - Intronic
929991153 2:46788062-46788084 CTGTAGTCCCAGTTGCTACTTGG + Intergenic
931986861 2:67750635-67750657 CTGTACTCCCAGCTGAGGCAGGG + Intergenic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
932880545 2:75497726-75497748 CTGTAGTCCCAGCTACTTCTGGG + Intronic
934475427 2:94590303-94590325 CTGTAATCCCAGCTGGGGTGGGG - Intronic
934504976 2:94883017-94883039 CTGTAGTCCCAGCTATGGGGGGG - Intergenic
934558359 2:95299374-95299396 CTGTAGTCAGAGCTCAGGTTGGG + Intronic
934757658 2:96835588-96835610 CTGTAGTCCCAGCTATGGGGAGG - Intronic
935402221 2:102671981-102672003 CTGTAATCCCAGCTGCTACTTGG + Intronic
935432621 2:102992664-102992686 CTGTAGTCCCAGCTGCTGAGGGG + Intergenic
935671858 2:105562729-105562751 CTGTAGTCCCAGCTATGTCGGGG + Intergenic
935837907 2:107075556-107075578 CTGTTCTCCCAGCCCAGGCTGGG + Intergenic
936651618 2:114433751-114433773 CTATAGTACCAGCTTAAGCTTGG + Intergenic
937297735 2:120819917-120819939 CTCAAGACCCAGCTCAGGCTGGG - Intronic
938112855 2:128580824-128580846 TTGTAATCCCTGCTGAGGCAGGG - Intergenic
938679782 2:133677936-133677958 CCATAATCCCAGCTGAGGCAGGG - Intergenic
939590458 2:144057934-144057956 CTGTAGTCCCAGCAGCTACTTGG - Intronic
939635849 2:144581920-144581942 CTGCAGCCCCAACAGAGGCTTGG + Intergenic
939872526 2:147541180-147541202 CTGTGATCTCATCTGAGGCTTGG - Intergenic
940119218 2:150244669-150244691 CTGTAGTCCCAGCTGTCGGGAGG + Intergenic
940305469 2:152221214-152221236 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
940517139 2:154697425-154697447 CTGCAGGCTCAACTGAGGCTCGG + Intergenic
940844903 2:158629854-158629876 CTGTAATCCCAGCTGAGGCTGGG - Intronic
941262348 2:163313693-163313715 ATGTACTACCAGCTGTGGCTTGG - Intergenic
941677193 2:168356297-168356319 CTGTAGTCCCAGCTGCTTGTGGG + Intergenic
941838727 2:170055172-170055194 CTGTAGTCCCAGCTACTGTTGGG + Intronic
941901907 2:170687084-170687106 CTGTAATCCCAGCTGAGTGAGGG + Intergenic
941936968 2:170989762-170989784 CTGTAGTCCCAGCTTGAGCCCGG + Intergenic
943127377 2:183811523-183811545 CTGTAGTCCCAGCTGCTTGTGGG + Intergenic
943332123 2:186572286-186572308 CTGTAGTCCCAGCTGCTACTTGG + Intergenic
943349314 2:186778996-186779018 CTGGAGTCACAGCTGATCCTAGG - Intergenic
943608417 2:190003739-190003761 CTGTAATCCCAGCTACTGCTCGG + Intronic
944587994 2:201189700-201189722 CTGAAGTTCAAACTGAGGCTGGG + Intronic
944657406 2:201889925-201889947 CTGTAGTCCCAGCTACTGCGAGG + Intronic
944695313 2:202195393-202195415 CTGTAGTCCCAGCTACTTCTTGG + Intronic
944838229 2:203600683-203600705 CTGTAGTCCCAGCACTTGCTGGG + Intergenic
945068447 2:205967102-205967124 CTGTAGTCCCAGCAGCTACTTGG - Intergenic
946184639 2:217973231-217973253 CTGCAGTCCCAGCTCGGACTCGG + Intronic
946497091 2:220205696-220205718 CTGTAGTCCCAGCTACTACTCGG - Intergenic
947324717 2:228961678-228961700 CAGTAGGTCCAGCTGAGGTTGGG + Intronic
947551668 2:231050911-231050933 CAGGAGCCCCAGCTGGGGCTGGG - Intergenic
948588696 2:239036380-239036402 CTGCAGTCCCAGCTCCGCCTGGG + Intergenic
948930241 2:241127241-241127263 CTCCAGTCCCAGCTGAGGATGGG - Exonic
1169365167 20:4986208-4986230 CTATAATCCCAGCAGAGGCGGGG + Intronic
1169650505 20:7861434-7861456 TTGTAGTCCCAGCTGCTGCTTGG + Intergenic
1170649755 20:18228517-18228539 CTGTAGTCCCAGTTGATGGCGGG - Intergenic
1170740033 20:19047992-19048014 CAGGAGTCCCATCTGAGACTTGG - Intergenic
1170770099 20:19325321-19325343 CTGTAGTCCCAGCTACTGGTGGG + Intronic
1171950893 20:31420729-31420751 CTGTAGTCACTGCTGTGGTTTGG - Intergenic
1172147825 20:32769208-32769230 CTGTAGTCCCAGCTACTACTAGG - Intronic
1172372547 20:34406144-34406166 CTGTAGTCCCAGCTGCTGGGGGG - Intronic
1172415809 20:34766503-34766525 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1172576327 20:36011560-36011582 CTGTAATCCCAGCTGAATCCAGG + Intronic
1172706688 20:36887317-36887339 CCGGAGTCCCACCTGCGGCTCGG + Intronic
1173579729 20:44138502-44138524 CTGTAGTCCCAGGTGCTGTTCGG - Intronic
1173693336 20:44983485-44983507 CTGTAGTCCCAGCTAACTTTTGG + Intronic
1173729805 20:45320241-45320263 CTGTAGTCCCAGCTATGGGGTGG + Intergenic
1174021609 20:47534791-47534813 CTGTAGTCCCAGCTGTTGGGTGG + Intronic
1174235020 20:49082639-49082661 CTGTAGTCCCAGCTATCGCGAGG - Intronic
1174832164 20:53823125-53823147 CTGTAGTCCCAGCAGCTACTTGG + Intergenic
1174915010 20:54644755-54644777 CTGTAATCCCAGCTGAGTCAGGG + Intronic
1175011865 20:55745610-55745632 CTGCACGCCCATCTGAGGCTTGG - Intergenic
1175019184 20:55826292-55826314 CTGTGGTCCCATCTAAGGCTGGG + Intergenic
1175103510 20:56596981-56597003 CTGTAATCCCAGCTGCTACTCGG + Intergenic
1175280524 20:57801203-57801225 CTGTTGTCACAGCTCAGCCTGGG + Intergenic
1175413360 20:58785815-58785837 CTGTATGCCCAGCTCATGCTAGG + Intergenic
1178707136 21:34885672-34885694 ATCAAGACCCAGCTGAGGCTTGG + Intronic
1179240917 21:39591321-39591343 CTGTAGTCCCAGCTGAGCCTGGG + Intronic
1179948507 21:44696756-44696778 CTGTGGTCCACGCAGAGGCTGGG + Intronic
1180632322 22:17238205-17238227 CTGTAGTCCCAGCTACTACTGGG + Intergenic
1181014860 22:20062994-20063016 CTGTAATCCCAGCTGACGGCTGG + Intronic
1181481361 22:23201263-23201285 CTGCATTCCCTGCTGGGGCTTGG + Intronic
1182820842 22:33214857-33214879 CAGCTGTCCCAGCTGAGGCCAGG - Intronic
1182854504 22:33505269-33505291 CTGTAGCCTCTGCAGAGGCTGGG + Intronic
1183205221 22:36414204-36414226 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1184342290 22:43892483-43892505 CTGTAGTGGTAGGTGAGGCTTGG - Intergenic
1184493729 22:44825460-44825482 CTGTAGACACAACAGAGGCTGGG - Intronic
1184872930 22:47252189-47252211 CTGTCGTCCCACCTGAGTGTGGG - Intergenic
1184963004 22:47945183-47945205 CTGGGGTCTCATCTGAGGCTCGG - Intergenic
1185249245 22:49791130-49791152 CTGGAATCCCAGCTGTGGCGTGG + Intronic
1185253796 22:49820476-49820498 CTGTATTCCCAGCTGAGGCTGGG + Intronic
949525705 3:4901268-4901290 CTGTAGTCCCAGCTGAGAGGTGG - Intergenic
949958001 3:9285988-9286010 CTGTAGTCCCAGCTGCTGGGAGG + Intronic
949982399 3:9509964-9509986 CTGAAGACCCAGCTGCTGCTAGG + Intronic
951382997 3:22008477-22008499 CTGTAGTCCCAGCTACTACTCGG - Intronic
951529222 3:23682996-23683018 CTGTAGTCCCAGCTGCTTGTGGG - Intergenic
953870427 3:46621635-46621657 CTGTAGTCCCAGCTACTGCGGGG + Intronic
953879131 3:46682573-46682595 CTGTTTTCCCAGCTGTGGCATGG + Intronic
954160783 3:48720246-48720268 CTGTAGTCCCAGGTGTAGCGTGG + Intronic
954219377 3:49143696-49143718 CAGTGGTCACAGCTGAGGCCTGG + Intergenic
954781768 3:53067221-53067243 CTGTAGTCCCAGCTACAACTTGG + Intronic
955278155 3:57567837-57567859 CTGTAATCCCACCTGAGGTCAGG + Intergenic
955790432 3:62583582-62583604 CCATAATCCCAGCTCAGGCTTGG + Intronic
956156485 3:66303819-66303841 CTGTGATCTCATCTGAGGCTAGG + Intronic
956613917 3:71152289-71152311 TTATGGTCCCACCTGAGGCTTGG - Intronic
956877372 3:73476828-73476850 CTGAAGGCTCAGCTGAGGGTCGG - Intronic
957199514 3:77113988-77114010 CTGAAGTCCCAGCTGATGAGAGG + Intronic
958193183 3:90209433-90209455 CTGTAGTCCCAGCTACAACTCGG + Intergenic
958416484 3:93880377-93880399 CTGTAGTCCCAGCTACAACTCGG + Intronic
959064162 3:101640391-101640413 CTGTCGTTGCAGCTGAGGTTTGG - Intergenic
959699536 3:109285740-109285762 CTGTAGTCCCAGCTGCTCCTAGG - Intergenic
959701620 3:109304145-109304167 CTGTAATCCCAGCTGAGACTCGG + Intronic
959868463 3:111299660-111299682 CTCTGGACCCAGCTGGGGCTAGG - Intronic
960144486 3:114186248-114186270 CTGTAATCCCAGCTGAGATTGGG - Intronic
961494861 3:127284234-127284256 CTGAAGCCCCACCTCAGGCTGGG + Intergenic
961530561 3:127537516-127537538 CTGGAGTCCCAGGAGAGGCCAGG - Intergenic
961556705 3:127701090-127701112 CTGTAGTCCCAGCTACTGCGGGG + Intronic
961740433 3:129030061-129030083 CTGTAGTCCCAGCTAATTGTGGG + Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
963623961 3:147647585-147647607 CTGTAAGCCCAGCTGAGGCTGGG - Intergenic
963917660 3:150874136-150874158 CTGTAGTCCCAGCTAATCCAGGG - Intronic
964069210 3:152611510-152611532 CTGTAGTCCCAGCTACAGGTGGG - Intergenic
964718601 3:159749189-159749211 CTGTAGTCCCAGCTACTGGTGGG + Intronic
964886485 3:161489365-161489387 CTGTAGTCCCAGCTACTACTTGG - Intergenic
965572680 3:170187523-170187545 CTGTAGTCCCAGCTTACTCGGGG - Intergenic
965798829 3:172469714-172469736 CTGTAATCCCAGCTGAGGCAGGG + Intergenic
966187813 3:177244025-177244047 CTGTAATCCCAGCTCTGTCTAGG + Intergenic
967058950 3:185854431-185854453 CTGTAGTCCCAGCTACTACTCGG + Intergenic
968135587 3:196217412-196217434 CTGTAGTCCCAGCTTACTCATGG + Intronic
968543624 4:1183011-1183033 CTGTAATCCCAGCTGAGGTCAGG + Intronic
968733406 4:2282819-2282841 CTGTAGTCCCAGCTACGGGGAGG + Intronic
969011609 4:4068443-4068465 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
969627584 4:8315589-8315611 CTGCAGTGCCTGCTGTGGCTGGG - Intergenic
969674818 4:8608694-8608716 CTGAAGTCCCAGACCAGGCTGGG - Intronic
969742465 4:9041442-9041464 CTGTAGTCCCAGCAGCTACTCGG - Intergenic
970493325 4:16598791-16598813 CTTTATTCCCAGCTGAGACTAGG - Intronic
971221845 4:24716106-24716128 CTGTAATCCCAGCTGATTCCAGG - Intergenic
971337744 4:25739580-25739602 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
971529665 4:27670644-27670666 CTGAAGGCCCAGCTGATACTTGG + Intergenic
972353320 4:38257782-38257804 CTATAGTCCCAGCTAATTCTGGG - Intergenic
972536011 4:40000466-40000488 CTGTAATCCCAGCTGAGGCTGGG + Intergenic
972797625 4:42437796-42437818 CTGTAGACCCAGCCGAGAGTTGG - Intronic
973881077 4:55271768-55271790 CTGTAGTCCCAGCTCAGTAGGGG - Intergenic
975613106 4:76220877-76220899 CTGTGGTCCCAGCTGATCCCAGG - Intronic
975978003 4:80121148-80121170 CTGTAGTCCCAGCTGCTACTCGG + Intronic
976248393 4:83026285-83026307 CTGTAGTCCCAGCTGCTGGGAGG - Intergenic
976649760 4:87422225-87422247 CTGTAGTCCCAGCTACGTCGGGG + Intergenic
978172888 4:105695049-105695071 CTGTAGTCCCAGCTGTTTGTGGG - Intronic
978222089 4:106289222-106289244 CTCTAGTCCCAGCTCTGTCTAGG - Intronic
978691583 4:111518998-111519020 CTGTAGTCCCAGCTGCTGGGAGG + Intergenic
979662944 4:123279291-123279313 CTGTAATCCCAGCTGAGGCTGGG + Intronic
980539662 4:134177296-134177318 CTGTAGTCCCAGCTGTTGGGAGG - Intergenic
980613228 4:135184914-135184936 CTCTCCTTCCAGCTGAGGCTGGG - Intergenic
981080956 4:140638566-140638588 CTGTAATCCCAGCTGTACCTGGG + Intronic
981147517 4:141342825-141342847 CTGTAATCCCACTTGAGGCCAGG + Intergenic
982019871 4:151192064-151192086 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
984047865 4:174824086-174824108 CTGAATTCCTAGCTGAGGCCAGG + Intronic
984808977 4:183777144-183777166 CATCAGTCCCAGCTGTGGCTAGG + Intergenic
984870582 4:184321538-184321560 CTGTAATCCCAGCTGACTATGGG - Intergenic
985010040 4:185573114-185573136 CTGTAGTCCCAGCTGACAGGAGG - Intergenic
985115313 4:186584441-186584463 CTGTGGTTTCATCTGAGGCTGGG - Intergenic
985314163 4:188636934-188636956 CTGTAGTCCCAGCTACGGGGAGG + Intergenic
986243191 5:5979995-5980017 GAGTTGACCCAGCTGAGGCTTGG - Intergenic
986601128 5:9474250-9474272 CCGTACACCCAGCTGAGGCCAGG + Intronic
988649221 5:33130062-33130084 CTGTAATCCCAGCTAAGATTCGG - Intergenic
989147736 5:38265295-38265317 CTGGAGTCCCACCTCAGCCTCGG - Intronic
990958342 5:61366015-61366037 CTGTAGTCCCAGCTACTGGTGGG - Intronic
991058519 5:62345422-62345444 CTGTAATCCCAGCTGCTACTTGG + Intronic
991334018 5:65526700-65526722 CTGTAGTCCCAGCTGTGTGGAGG + Intronic
992060083 5:73035623-73035645 CTGTAGTCCCAGCTAATTTTGGG - Intronic
992563395 5:77974019-77974041 CTGTAGTCCCAGCTACTACTAGG - Intergenic
992782131 5:80137514-80137536 CTGTAGTCCCAGCTGCTACTCGG + Intronic
993396460 5:87395745-87395767 CTGTAGTCCCAGCTGCTGAGAGG + Intronic
993832166 5:92773768-92773790 CTGTAGTCCCAGCTACTGCGGGG + Intergenic
994024873 5:95070735-95070757 AGGCAGTCCCAGCTGCGGCTTGG + Intronic
994954216 5:106506600-106506622 CTGTAGTCCCAGCTACTTCTTGG + Intergenic
995496125 5:112745688-112745710 CTGTAGTCCCAGCTATGGTGTGG - Intronic
997989182 5:138529863-138529885 CTGTAGTCCCAGGCTAGGGTGGG - Intronic
998386367 5:141759350-141759372 CTGTAGTCCCAGCTACTGGTGGG - Intergenic
999162219 5:149511204-149511226 CTGTAGTCCCAGCTACAGGTAGG + Intronic
999177965 5:149645284-149645306 CTGTAATCCCAGCGGAGGCGAGG - Intergenic
999328068 5:150655773-150655795 CTGTAGTCCCAGCTACTGCGGGG - Intronic
999760231 5:154694376-154694398 CTATAGTCCCAGCTGTGGGGAGG - Intergenic
1000351797 5:160358166-160358188 CTGGAGTCCCAGAGGAGTCTTGG + Intronic
1000619056 5:163461659-163461681 CTGTAGTCCCAGCTGACTACAGG + Intronic
1001107140 5:168864085-168864107 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1001550870 5:172601578-172601600 CTATAATCCCAGCTGAGGCAGGG - Intergenic
1001955010 5:175843021-175843043 CTGTAATCCTAGCTCAGCCTGGG - Intronic
1002431723 5:179207970-179207992 CTGTGGCCCCTGCTGTGGCTGGG - Intronic
1003477269 6:6495001-6495023 CTGTAGTCACACCTCTGGCTAGG + Intergenic
1004214135 6:13685803-13685825 CTGTAGTCCCAGCTAATGGGAGG + Intronic
1004864788 6:19842375-19842397 CTCTAGTCCCTGCTTAGGATAGG + Intergenic
1005373206 6:25156089-25156111 CTGTAGTACCAGCTACAGCTTGG + Intergenic
1005740604 6:28787231-28787253 CTGTAGTCCCAGCTACGGGGAGG - Intergenic
1006246103 6:32737896-32737918 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1006367530 6:33624231-33624253 CTGTAGGCCCATCTAATGCTGGG + Intronic
1007474656 6:42111232-42111254 CTGTAGTCCCAGCTACAGATGGG - Intronic
1007759089 6:44121815-44121837 CTGTAGTCCCAGCTACAGCCCGG + Intronic
1008899187 6:56591831-56591853 CTGTAGTCCCAGCTGGTGGCGGG + Intronic
1010792912 6:80085370-80085392 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1012163415 6:95917218-95917240 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1012261204 6:97089654-97089676 CTGTAATCCCAGCTGAGGCCTGG + Intronic
1013045632 6:106482108-106482130 CTGCAGTTTCATCTGAGGCTTGG + Intergenic
1013234115 6:108182114-108182136 CTGTAGTCCCAGCAGCTACTCGG + Intronic
1013776139 6:113680353-113680375 CTGTAGTCCCAGCTGCTTCAGGG - Intergenic
1014700825 6:124685982-124686004 CTGTGTTCTCAGCTGAGGCTTGG + Intronic
1014726879 6:124981903-124981925 CTGTAGTCCCAGCTGCTCCTGGG + Intronic
1014932035 6:127346338-127346360 CTGTAGTCCCAGCTAAACCTGGG + Intergenic
1014977207 6:127902201-127902223 CTGTAGTCCCAGCTGTGAGGAGG + Intronic
1015208859 6:130672595-130672617 CCGTGTTCTCAGCTGAGGCTCGG - Intergenic
1015495900 6:133883036-133883058 CTGCCATCCCAGCTGAGGCCTGG + Intergenic
1015496336 6:133887872-133887894 GTGAATTCCCAGCTGAGCCTAGG + Intergenic
1015728804 6:136326988-136327010 CAGTTGTCCCAGCTGATTCTTGG - Intergenic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1015982365 6:138852157-138852179 CTGTAGTCCCAGCTACTCCTTGG + Intronic
1016077260 6:139811034-139811056 CTGTAGTCCCAGCTACTCCTCGG - Intergenic
1016359784 6:143254913-143254935 CTGTAGTCCCAGCTGTCGGGAGG + Intronic
1016409829 6:143771347-143771369 CTGTAGTCCCAGCTTGAGCCTGG - Intronic
1017478083 6:154819864-154819886 CTGCAGTCCCAGCTGCTGCAGGG + Intronic
1017696143 6:157018336-157018358 CTGTAGTCCCAGCTGTTGGGAGG - Intronic
1018104213 6:160467630-160467652 CAGTACTCCCACCTGACGCTGGG + Intergenic
1018112458 6:160548570-160548592 CAGTACTCCCACCTGATGCTGGG + Exonic
1018130817 6:160731118-160731140 CAGTACTCCCACCTGACGCTGGG - Exonic
1018368943 6:163149753-163149775 CTGGAGTCCCTGCTGCGGATCGG + Intronic
1018419854 6:163631667-163631689 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1019573860 7:1726751-1726773 CTCATGTCCCACCTGAGGCTGGG - Intronic
1019705466 7:2495283-2495305 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
1019900004 7:4012832-4012854 CTGTAATCCCAGCTGAGGATTGG - Intronic
1019906514 7:4069118-4069140 CTCTAGCCTCAGATGAGGCTGGG + Intronic
1020234657 7:6346487-6346509 CTGTAGTCCCAGCTGCTTGTGGG - Intronic
1021284643 7:18765495-18765517 CTGTAGTCCCAACTGACGGGAGG + Intronic
1022727426 7:32993700-32993722 CTGTAATCTCAGCTGAGGCAGGG + Intronic
1023279524 7:38555291-38555313 CTGTAGTCCCAGCTGTGGGTAGG + Intronic
1023679372 7:42668916-42668938 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1025004352 7:55343202-55343224 TCTAAGTCCCAGCTGAGGCTGGG - Intergenic
1025046157 7:55693949-55693971 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1026846391 7:73701081-73701103 ATGCAGTCTCAGCTGAGGGTTGG + Intronic
1026902766 7:74046206-74046228 CTGGAATCCCAGGTGAGGCAAGG + Exonic
1027853108 7:83473968-83473990 CTGTAGTCCCAGCTGCTCCAAGG + Intronic
1028465613 7:91148260-91148282 CTGTGGTCCCAGCTGAGGTGGGG + Intronic
1028587187 7:92463844-92463866 CTGTAGTCCCAGCTGCTGGGAGG + Intergenic
1029127500 7:98304774-98304796 CTGTAATCCCAGCTGAGGTCAGG - Intronic
1029129793 7:98321429-98321451 GTGTATTCCCAGCAGAGGCAGGG - Intronic
1029646405 7:101859161-101859183 TTGCAGTCCCTGCTGAGCCTGGG + Intronic
1030048513 7:105518644-105518666 CTGTAATCCCAGTTGAGGCAGGG - Intronic
1030100241 7:105939454-105939476 CTGTAGTCCCAGCTACTCCTCGG + Intronic
1030425240 7:109368580-109368602 CTGTAGTCCCAGCTACTCCTTGG + Intergenic
1030533207 7:110735751-110735773 CTGTAGTCCCAGCTTGAGCCTGG + Intronic
1030604309 7:111623039-111623061 CTGTAGTCCTAGGTGAGGTGAGG - Intergenic
1031049254 7:116928512-116928534 CTGCAATCTCATCTGAGGCTTGG + Intergenic
1031929707 7:127672485-127672507 CTGTAGTCCCAGCTACTACTCGG + Intronic
1031985952 7:128164871-128164893 CTGTGGGCCCAGATGAGACTGGG + Intergenic
1032281715 7:130508580-130508602 CTGGAGTTCCAGATGAGGATGGG - Exonic
1033371979 7:140717391-140717413 CTGTGATCCCAGCTGAGGTCGGG - Intronic
1034103093 7:148468105-148468127 CTATTGTCTCATCTGAGGCTGGG + Intergenic
1034182499 7:149149044-149149066 CTGTAGTCCCAGCTAGGCCGGGG + Intronic
1034511321 7:151537318-151537340 CTGTAGTCTCAGCTGATGGGGGG - Intergenic
1035563472 8:626388-626410 CTGCAGACCCGGCAGAGGCTAGG - Intronic
1036886588 8:12559723-12559745 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
1036894199 8:12618803-12618825 CTGTAGTCCCAGCAGCTACTCGG + Intergenic
1036943567 8:13073418-13073440 CTGTAATCCCAGGTGACACTCGG + Intergenic
1037150011 8:15626013-15626035 CTATAGTTCCAGCTGTGGCGAGG + Intronic
1037868838 8:22472002-22472024 CTGTAGTCCCAGCTGAGGACTGG + Intronic
1037894065 8:22640300-22640322 CTGTAGTCCCAGCTGTACGTGGG - Intronic
1038117480 8:24573716-24573738 GTGTAGTCCTAGCAGAGTCTGGG - Intergenic
1038417018 8:27404524-27404546 CTGGAGTCCCTGCTGCGGGTGGG - Intronic
1038477373 8:27877700-27877722 CTGTTCTCCCACCTAAGGCTTGG - Intronic
1038708180 8:29915755-29915777 CTGTAGCCCCAGCTGCTACTTGG - Intergenic
1039502341 8:38027994-38028016 TTGTAATCCCAGCTAGGGCTGGG + Intergenic
1040831776 8:51684908-51684930 CTGCTGTCTCATCTGAGGCTGGG - Intronic
1041589534 8:59560887-59560909 CTGTAATGCCAGCTGAGGTCAGG + Intergenic
1041909419 8:63072488-63072510 CTGTAATCCCAGCTGAGGTCAGG - Intronic
1042529765 8:69803069-69803091 CTGTAATCCCAGATCAGCCTGGG + Intronic
1042542032 8:69916956-69916978 CTGTAGTCTCAGCTGCTACTTGG + Intergenic
1042561805 8:70077541-70077563 CTGTAGTCCCAGCTCAGTCCTGG - Intergenic
1042839278 8:73107613-73107635 CTGTAGTCCCAGCCCTGGGTGGG - Intronic
1042928299 8:73989171-73989193 CTGTGGTCCCAGCTGAGCCCAGG + Intergenic
1044026520 8:87179031-87179053 CTGTAGTCTCAGCTGCTACTTGG - Intronic
1044664879 8:94624653-94624675 CTGTAGCCCCAGCTGTGGGGAGG + Intergenic
1044844555 8:96367272-96367294 CTGTCGTCTCATCTGAGGTTTGG - Intergenic
1045376352 8:101578269-101578291 CTGTGGTCCCAGCTCCTGCTGGG - Intronic
1045822035 8:106350061-106350083 TTGAAGTCACAGCTGAGGCAAGG + Intronic
1045985504 8:108245344-108245366 CTGTAGTCCCAGCTACTTCTGGG + Intronic
1047985600 8:130229937-130229959 CTGTGGTCCCAGCTGCTACTCGG + Intronic
1048189203 8:132272949-132272971 CTGAAGTCTCATCTGAGGCAAGG + Intronic
1048741650 8:137567310-137567332 CTGTAGTCCCAGTTAAGGATAGG - Intergenic
1048887289 8:138918561-138918583 AGGCAGTCCCAGCTCAGGCTGGG - Intergenic
1049408449 8:142461934-142461956 CTGTAGCGCAAGGTGAGGCTGGG + Intronic
1049447388 8:142637597-142637619 CTGTGGTCCCAGCTGGGCCATGG - Intergenic
1050311603 9:4358932-4358954 CTGTAGTTCAAGATGTGGCTGGG + Intergenic
1050516658 9:6451601-6451623 CTGTAGTCCCAGCTACTACTCGG - Intronic
1051111376 9:13641076-13641098 CTGTGGTCCCAGCTAAGTCGGGG + Intergenic
1051144384 9:14010877-14010899 CTGTAGTCCCAGCTACTGGTTGG - Intergenic
1051152676 9:14100585-14100607 CTGTAGTCCCAGCTACGGAGGGG + Intronic
1052918043 9:33939320-33939342 CTGTAGTCCCAGCTACTACTTGG - Intronic
1053144818 9:35705289-35705311 CTGTAGGCCCAGATGAGGGTCGG + Intronic
1053366741 9:37528183-37528205 ATGTAGACCAAGCTGAGGCGGGG - Intronic
1053682639 9:40495759-40495781 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054281075 9:63129170-63129192 CTGTAATCCCAGCTGGGGTGGGG - Intergenic
1054295738 9:63331273-63331295 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054393757 9:64635768-64635790 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054428405 9:65140981-65141003 CTGTAATCCCAGCTGGGGTGGGG + Intergenic
1054501974 9:65880564-65880586 CTGTAATCCCAGCTGGGGTGGGG - Intronic
1055425774 9:76194877-76194899 CTGGAGTCACAGCTGAGGAGAGG + Intronic
1055533360 9:77210364-77210386 CTGTAGTCCCAGCTACTGCAGGG - Intronic
1057231052 9:93321488-93321510 CCCTGCTCCCAGCTGAGGCTTGG - Intronic
1057706401 9:97398168-97398190 CTGTGGTCTCAACCGAGGCTGGG - Intergenic
1058208687 9:102139810-102139832 CTATAGTCTCATCTGAGGTTTGG + Intergenic
1058315590 9:103561386-103561408 CTGTAGTCCCAGCTGCTCCTCGG - Intergenic
1058405071 9:104663562-104663584 CTGTAATCCCAGCTCCTGCTGGG + Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059061889 9:111041654-111041676 CTGTAGTCCCAGCTGTTGGGAGG + Intergenic
1059421131 9:114193135-114193157 CTCTGGGCCCAGCTGAGGCAGGG + Intronic
1060201784 9:121655605-121655627 CTGTAGTTCCAGCTCAGCCGCGG + Intronic
1061085574 9:128396277-128396299 CTGTAGTCCCAGCTACTCCTCGG + Intergenic
1061334316 9:129921335-129921357 CTGTAGTCCTAGCGGAGGCTGGG - Intronic
1061436257 9:130564132-130564154 CTGAGGTTCCATCTGAGGCTTGG - Intergenic
1061515156 9:131085501-131085523 CTGCAAACCCGGCTGAGGCTGGG - Intronic
1061527520 9:131179120-131179142 CTGTAGTCCCAGCAGCTACTTGG - Intronic
1061768030 9:132894867-132894889 CTGGTGTTCCAGCTGAGGCAGGG - Exonic
1062162055 9:135086211-135086233 CTGCAGTCCCAGCTTACACTGGG + Intronic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062590956 9:137274463-137274485 CTGGGGACCCAGGTGAGGCTGGG + Intergenic
1062627100 9:137448298-137448320 CTGTGTTCCCAGCTGAGGGAGGG - Exonic
1185507866 X:643169-643191 CTGGTGTCCCAGGAGAGGCTTGG + Intronic
1185507931 X:643387-643409 CTGGTGTCCCAGGAGAGGCTTGG + Intronic
1185652603 X:1659970-1659992 GTGTGGTCCCAGGTGAGGCCTGG + Intergenic
1186068336 X:5790445-5790467 CTGTAGTCCCAGCTAAGTGGAGG + Intergenic
1186282574 X:8009302-8009324 CTGTAGTCCCAGCTACTACTTGG - Intergenic
1186464315 X:9772688-9772710 CTGTGGTCCCAGCTGCTGTTGGG + Intronic
1186471797 X:9827611-9827633 GTGTAGTCTGTGCTGAGGCTGGG + Intronic
1187346672 X:18471641-18471663 CTGTAATCCCAGCTAAGGTAGGG - Intronic
1188645616 X:32563215-32563237 CTGTAGTCCCAGCTGCTACTTGG + Intronic
1189343160 X:40219906-40219928 CAGTGGTCACAGCTGAGGCTAGG - Intergenic
1189824371 X:44902102-44902124 CTGTAGTCCCAGCTACTACTTGG + Intronic
1190103382 X:47540463-47540485 CTGTAGTCCCAGCTACTGGTGGG + Intergenic
1190196200 X:48320760-48320782 CTATAGTCCCAGCTGAGTCTGGG - Intergenic
1190272352 X:48875799-48875821 CTGTAGTCCCAGCTACTACTCGG + Intergenic
1190333726 X:49250516-49250538 CTGCAGTCTAAGCTGAGGCATGG + Exonic
1192043064 X:67643622-67643644 AGGTGGTCCCAGCTGGGGCTTGG + Intronic
1192467149 X:71365589-71365611 CTGTAGTCCCAGCTGTTGGGGGG - Intergenic
1194908580 X:99610191-99610213 CTGTGATCTCATCTGAGGCTCGG + Intergenic
1196799901 X:119533066-119533088 CTGTAGTCCCAGCTACTACTTGG + Intergenic
1196972693 X:121126677-121126699 CTGTAATCCCAGCTGAGGCAGGG - Intergenic
1197109387 X:122755369-122755391 CTGAAGTCTCACCTGAGACTAGG + Intergenic
1197193534 X:123675516-123675538 CTGTAGTCCCAGCTGTACTTAGG + Intronic
1197752121 X:129971997-129972019 CTGTAGTCCCAGCTACTACTCGG - Intergenic
1197780356 X:130153225-130153247 CTGTAGTCCCAGCTACTCCTCGG + Intronic
1198532511 X:137560211-137560233 CTGTAGTGTCAGCAGAGGCTAGG - Intergenic
1199191888 X:144980693-144980715 CTCTAGACCCAAGTGAGGCTTGG + Intergenic
1200926368 Y:8658535-8658557 CAGAACTCACAGCTGAGGCTTGG - Intergenic
1201637285 Y:16137981-16138003 CTGTAGTCCCAGCTATGGGGAGG + Intergenic