ID: 914720731

View in Genome Browser
Species Human (GRCh38)
Location 1:150286726-150286748
Sequence ATGCTGTAGTAGGTGGGACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914720731_914720736 -7 Left 914720731 1:150286726-150286748 CCCAGTCCCACCTACTACAGCAT 0: 1
1: 0
2: 0
3: 8
4: 134
Right 914720736 1:150286742-150286764 ACAGCATCTCCTGTCATCCCTGG 0: 1
1: 0
2: 3
3: 36
4: 324
914720731_914720740 14 Left 914720731 1:150286726-150286748 CCCAGTCCCACCTACTACAGCAT 0: 1
1: 0
2: 0
3: 8
4: 134
Right 914720740 1:150286763-150286785 GGTGAGCCTATGAAACTATCTGG 0: 1
1: 0
2: 2
3: 20
4: 198
914720731_914720741 19 Left 914720731 1:150286726-150286748 CCCAGTCCCACCTACTACAGCAT 0: 1
1: 0
2: 0
3: 8
4: 134
Right 914720741 1:150286768-150286790 GCCTATGAAACTATCTGGAGAGG 0: 1
1: 0
2: 0
3: 9
4: 103
914720731_914720743 20 Left 914720731 1:150286726-150286748 CCCAGTCCCACCTACTACAGCAT 0: 1
1: 0
2: 0
3: 8
4: 134
Right 914720743 1:150286769-150286791 CCTATGAAACTATCTGGAGAGGG 0: 1
1: 0
2: 2
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914720731 Original CRISPR ATGCTGTAGTAGGTGGGACT GGG (reversed) Exonic
903313291 1:22477897-22477919 ATCCAGTAGTAGGTGGGAAAGGG - Intronic
903501930 1:23805222-23805244 ATCCTGAAGCAGGTGGGAATGGG - Intronic
904227174 1:29031717-29031739 AGGCTGTATTAGGTAGAACTAGG - Intronic
905891655 1:41521954-41521976 ATGCGTCAGTAGGTGGGGCTGGG - Intronic
910753980 1:90666274-90666296 ATGATGTAGTAGGTTGCATTAGG - Intergenic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
914720731 1:150286726-150286748 ATGCTGTAGTAGGTGGGACTGGG - Exonic
918066232 1:181103896-181103918 AAGCTGTAGGAGGTGGGAACAGG - Intergenic
920688691 1:208129392-208129414 ATGTTGTAGCAGCTGGGGCTGGG + Intronic
923722565 1:236479613-236479635 ATGGAGTAGAAGCTGGGACTTGG - Intronic
1068422451 10:56812821-56812843 TTGCTGTGGAAGGTGTGACTTGG + Intergenic
1069875716 10:71561818-71561840 ATAAGGGAGTAGGTGGGACTGGG + Intronic
1069997426 10:72351316-72351338 CTGCTGCAGGAGGTGGGACAAGG - Intronic
1072526826 10:96279238-96279260 ATGAGGTAGGAGGTGGGGCTTGG + Intergenic
1073747872 10:106490579-106490601 ATCCTGTAGTGGGAGGGAATAGG - Intergenic
1075247821 10:120839750-120839772 ATGCTAGAGTTGGTGGGAGTTGG + Intergenic
1078578192 11:12518621-12518643 TTGCTGGGGAAGGTGGGACTCGG + Intronic
1087651973 11:100878406-100878428 ATGCGGTAGTAGGAGGGAATAGG + Intronic
1089062940 11:115641142-115641164 ATGTTGTAGTAAGCGGGATTAGG + Intergenic
1091179640 11:133592142-133592164 ATGCTGTAATGGGTTGCACTGGG - Intergenic
1097891060 12:64778422-64778444 ATACTGTAGTATGTGGGAAGAGG + Intergenic
1100390742 12:94144656-94144678 TTCCTTCAGTAGGTGGGACTTGG - Intergenic
1106147823 13:27066533-27066555 ATGTTGTATTATGTGGGTCTTGG - Exonic
1107339045 13:39386638-39386660 ATGTTTTACTAAGTGGGACTTGG + Intronic
1108368946 13:49747807-49747829 ATTTTGTGGAAGGTGGGACTTGG + Intronic
1110551934 13:76820404-76820426 GTGCTGTTGGAGGTGGGCCTAGG - Intergenic
1110717415 13:78721798-78721820 ATGCAGCAGTGGGTGGGACGGGG - Intergenic
1112349084 13:98618006-98618028 ATGCTGTAGTTACTGGTACTAGG - Intergenic
1114350029 14:21839992-21840014 ATGCAGTTGTTGGTGGGAATGGG + Intergenic
1116056019 14:39864910-39864932 ATGCTGTAGTAACTTTGACTTGG + Intergenic
1116076185 14:40114037-40114059 ATGCTTTAGGAGGTGGTTCTGGG - Intergenic
1117128344 14:52656948-52656970 ATGAGGTAGAAGGTAGGACTTGG + Intronic
1117611728 14:57490158-57490180 ATTGTGTAGCAGGTGGGATTTGG + Intronic
1118693059 14:68358932-68358954 ATCCTAGAGAAGGTGGGACTGGG + Intronic
1118737335 14:68711452-68711474 GTGCTGTAGGAGGTGGGTCTTGG - Intronic
1118844097 14:69533349-69533371 AAGCTGTGGTTGGTGGGCCTTGG + Intergenic
1119871525 14:78022114-78022136 GCCCTGTAGTAGGTGTGACTTGG + Intergenic
1121529451 14:94641967-94641989 ATGCTGTGATGGGTGGGGCTAGG - Intergenic
1121614177 14:95301726-95301748 AGGCTCAAGTAGGTGGGGCTTGG - Intronic
1126210574 15:46097054-46097076 ATGCTGCAGTAGAAGGGGCTTGG - Intergenic
1131074823 15:89488746-89488768 ATTCTGTATTTGGTGGGGCTGGG + Intronic
1132896195 16:2230473-2230495 ATGCTGTGGGAGGTGGGGCGGGG + Intronic
1133105047 16:3501996-3502018 AGGCGGTAGGAGGTGGCACTGGG + Intronic
1133396879 16:5454594-5454616 ATTCTGCAGTAGGTGGCCCTTGG + Intergenic
1133970522 16:10564572-10564594 ATGAGGTAGGAGGTGGGACTGGG - Intronic
1135770744 16:25216706-25216728 AGGCTGTAGAAGGTGGGAGATGG - Intronic
1137554888 16:49464285-49464307 ATTCTGTAGAAGGTGGGGGTGGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1146551156 17:33781435-33781457 ATGATGGAGTGGGTGGGATTGGG + Intronic
1150672062 17:67209305-67209327 ATGCTGAAGTAGGCCGGACGCGG + Intronic
1151461553 17:74257310-74257332 AGGCTGGGCTAGGTGGGACTGGG - Intronic
1152247708 17:79193928-79193950 ATGGTGGAGGAGGTGGGAGTGGG + Intronic
1153850076 18:9085714-9085736 TTTCTGGAGTAGCTGGGACTAGG + Intergenic
1162433015 19:10640666-10640688 ATGCAGCAGTAAATGGGACTGGG + Intronic
1163598355 19:18233331-18233353 AAGCGGTAGAAGGTGGAACTGGG + Exonic
1165954392 19:39492960-39492982 AGGCTGGAGTAGGAGAGACTGGG - Intronic
1166841310 19:45698834-45698856 TGGCTGTAGAAGGTGGGATTGGG - Exonic
1167297848 19:48662253-48662275 AAACTATAGTAGGTGGGGCTGGG + Intronic
1167675127 19:50879095-50879117 ATGTTGTTGAAGGAGGGACTAGG + Exonic
1168475489 19:56671966-56671988 AGGCTGTAGTGGGCGGGGCTCGG - Intergenic
925476967 2:4227941-4227963 ATCCAGAAGTAGGTGGGGCTGGG + Intergenic
925722916 2:6845671-6845693 ATTCTGTAGTAGTTGGGTTTGGG + Intronic
927147063 2:20173223-20173245 ATTCTGTAGGTGGAGGGACTGGG + Intergenic
927266165 2:21153582-21153604 ATTCTTTAGTAAGTGGTACTGGG + Intergenic
930491849 2:52083691-52083713 ATGCTGAAGAAGGTGGGGGTGGG - Intergenic
931943452 2:67278715-67278737 ATTTTGAAGGAGGTGGGACTTGG - Intergenic
934656387 2:96118588-96118610 ATGCTGCAGGAGCTGAGACTGGG + Intergenic
936412039 2:112268588-112268610 ATGGTGGAGTTTGTGGGACTAGG + Intergenic
942408898 2:175685866-175685888 GTGCTGTGCTAGGTGGGACATGG - Intergenic
945470383 2:210222364-210222386 ATAATGTAGTAGGCGGGGCTTGG + Intronic
1170703743 20:18727101-18727123 CAGCTGTAGTACCTGGGACTTGG + Intronic
1173444339 20:43104328-43104350 ATGTTGTAGCTGGTGGCACTGGG - Intronic
1179302932 21:40128628-40128650 ATGCTGTAGGGGGTGTGACAGGG + Intronic
1180136387 21:45864970-45864992 AGGCTGTAGTTGGTGGGAACTGG - Intronic
1181478394 22:23182023-23182045 ATGCGGTAGGTGGTGGGGCTTGG - Exonic
1182298700 22:29326306-29326328 ATGCAGTAGTGTGGGGGACTGGG + Intergenic
1182347772 22:29678798-29678820 TTGCTGCAGTGGGTGGCACTGGG + Intronic
1183937045 22:41268601-41268623 TGGCTGTAGTTGGTGGGACCTGG + Intronic
1184640068 22:45865998-45866020 ATGCTGTAATTGGAGTGACTTGG + Intergenic
1185083664 22:48724120-48724142 TTGCTGCAGTAGGAGAGACTTGG + Intronic
950771597 3:15315700-15315722 ATGTTCTAGGAGGTGGAACTGGG - Intronic
952621491 3:35348666-35348688 AAGCTTTAGTAGGTGGCAATAGG - Intergenic
953349912 3:42207682-42207704 ATGCTGTGGCATCTGGGACTCGG + Intronic
954785321 3:53088330-53088352 TTGATGTTGTAGCTGGGACTGGG - Intronic
956444441 3:69312199-69312221 ATGCTGGATTTGGAGGGACTGGG + Intronic
959389284 3:105754119-105754141 ATTGTGTAGGAGGTGGGGCTGGG + Intronic
961770202 3:129244010-129244032 ATGGTGTAATAGGTTGGGCTTGG + Intergenic
967237871 3:187405299-187405321 ATGGTGTATTACGTGGGAATTGG - Intergenic
967293041 3:187940384-187940406 ATGAGGTAGTAGGTTGGGCTGGG - Intergenic
969698879 4:8754753-8754775 ATGAGGTAGGAGGTGGGGCTTGG + Intergenic
971911001 4:32797989-32798011 ATGAGGTAGGAAGTGGGACTCGG + Intergenic
974808699 4:66917196-66917218 ATGCTGGAGTAGGTTGCACTAGG - Intergenic
977255607 4:94736983-94737005 ATGGTGTGGTAGGTGAGAGTTGG + Intergenic
978174913 4:105718240-105718262 ATGTTGTTGGAGGTGGGACCTGG + Intronic
980543834 4:134231109-134231131 ATGCTGTTGTAAGTGGGGGTAGG + Intergenic
982954774 4:161749942-161749964 ATGCTGTAATGGTGGGGACTGGG - Intronic
983292934 4:165829126-165829148 ATGCTTAAGAAGGTGGCACTTGG - Intergenic
983428685 4:167620079-167620101 AGGCTGTAGTAGGTAGGATAAGG + Intergenic
984579508 4:181494931-181494953 AAGATGAAGTAGGTGGGAATTGG - Intergenic
986097702 5:4576114-4576136 ATACTGTTGTATGTGGCACTGGG - Intergenic
989068870 5:37490008-37490030 AGGCTGTGGTAGGTGGGACGGGG + Intronic
989498002 5:42131822-42131844 AAGCTGTAGTAGGCGGGGCAGGG - Intergenic
990325989 5:54675755-54675777 ATGCTGTACTAGGAGAGCCTGGG + Intergenic
992027181 5:72681719-72681741 AGGCTGTGGTTGCTGGGACTAGG - Intergenic
994533117 5:100992064-100992086 ATGCTGTAGTTCCTGGGACAAGG - Intergenic
997008414 5:129848100-129848122 ATGCTGTAACAGGTGTAACTAGG - Intergenic
1001175947 5:169469056-169469078 GTGCAGTAGTAGGTGGCACAGGG - Intergenic
1008290178 6:49705479-49705501 AAGCTGCAGTAGGTGGGAAATGG - Intronic
1008394805 6:50994040-50994062 ATACTGGAGAAGGAGGGACTTGG + Intergenic
1011330036 6:86194112-86194134 ATTCTGTAGTTGGTCTGACTAGG + Intergenic
1011514408 6:88136857-88136879 TTGCTACTGTAGGTGGGACTAGG + Intergenic
1012634919 6:101525938-101525960 GTGCTGTAGAAGGTGTGACAGGG + Intronic
1012967116 6:105687030-105687052 TGGCTGTAGCAGCTGGGACTTGG - Intergenic
1014724469 6:124958304-124958326 ATGCTGTAGGAGATTGGTCTAGG + Intergenic
1016321968 6:142856236-142856258 GTGGTGCAGTAGGTGGAACTGGG - Intronic
1017503876 6:155049497-155049519 GTGCTGTAGTAACTGTGACTTGG + Intronic
1017986325 6:159445974-159445996 ATGCTGCTGTAGGTGGAGCTGGG + Intergenic
1019746148 7:2701408-2701430 ATGCTATAGTGGGAGGGGCTGGG + Intronic
1021297638 7:18928165-18928187 ATGCTGTAGTAGGTTGAACAGGG - Intronic
1021710517 7:23411647-23411669 ATGCTGTGTTAGGTGCTACTTGG - Intronic
1024050381 7:45617413-45617435 CAGCTGTGATAGGTGGGACTGGG + Intronic
1027233657 7:76285793-76285815 CGGCTGTGGTAGCTGGGACTGGG - Exonic
1028437712 7:90823599-90823621 AAGTTGTAGTAGGAGGGAGTAGG + Intronic
1028918437 7:96285612-96285634 ATGCTGTAGGAGGTGGAAGGAGG - Intronic
1029244773 7:99191121-99191143 ATGGTGAAGCAGGTGGGTCTGGG - Intronic
1031823728 7:126535768-126535790 ATGATGAGGTAGGAGGGACTTGG - Intronic
1037291436 8:17353277-17353299 GGGCTGTGGTAGGTGGGAATGGG + Intronic
1045483803 8:102614351-102614373 AAGCTGTGGTGGGTGGGACTAGG - Intergenic
1047814529 8:128448281-128448303 AAGCTGTAATAAATGGGACTGGG + Intergenic
1054995865 9:71388584-71388606 AGGCTGAAATAGGTAGGACTGGG - Intronic
1057325922 9:94063141-94063163 ATGCTGTATCATGTGGGACAAGG + Intronic
1060374321 9:123105127-123105149 ATGCTGTAGTAGCAGGGATGAGG + Intergenic
1060744240 9:126119815-126119837 ATTCTGGAGCAGGTGGGACGAGG + Intergenic
1060840586 9:126790258-126790280 ATGCAGCAGAAGGTGGTACTGGG + Intergenic
1061822095 9:133234613-133234635 ATCCTTCAGGAGGTGGGACTGGG - Intergenic
1187939776 X:24370401-24370423 GTGATGTAGTAATTGGGACTGGG - Intergenic
1188861261 X:35259311-35259333 ATACTGTGTTGGGTGGGACTTGG + Intergenic
1193028822 X:76875567-76875589 ATGATCCAGTAGGTGGTACTAGG - Intergenic
1196032034 X:111101763-111101785 ATGGTGCAGTGGGTGGGATTTGG + Intronic
1197890759 X:131268208-131268230 ATCCTGTAAAAGGTGGCACTTGG - Intergenic
1199639822 X:149848958-149848980 CTGCTGGAGGAGGTGGGAATTGG + Intergenic
1199713265 X:150487445-150487467 GTGCTGTAGTAGATGGGGTTGGG - Intronic
1200138092 X:153884749-153884771 TTGCTGCAGGTGGTGGGACTTGG - Intronic