ID: 914721566

View in Genome Browser
Species Human (GRCh38)
Location 1:150293665-150293687
Sequence GAGGGCGAGAAACGTGTTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914721561_914721566 -1 Left 914721561 1:150293643-150293665 CCGAAGGACTTCGACTCCATGAG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 914721566 1:150293665-150293687 GAGGGCGAGAAACGTGTTTCGGG 0: 1
1: 0
2: 0
3: 6
4: 74
914721560_914721566 11 Left 914721560 1:150293631-150293653 CCTTCTCAGAGGCCGAAGGACTT 0: 1
1: 0
2: 1
3: 7
4: 103
Right 914721566 1:150293665-150293687 GAGGGCGAGAAACGTGTTTCGGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914721566 Original CRISPR GAGGGCGAGAAACGTGTTTC GGG Intergenic
904274050 1:29368980-29369002 GAGGGAGAGAGAGGTGTTTGGGG + Intergenic
906523064 1:46478668-46478690 GAGGCCCAGAAAGGTGTTTACGG - Intergenic
909545045 1:76837251-76837273 GAGGGAGATAATCGTGTTCCTGG + Intergenic
914721566 1:150293665-150293687 GAGGGCGAGAAACGTGTTTCGGG + Intergenic
916122486 1:161541052-161541074 GAGGGAGAGGAAAGAGTTTCAGG - Intergenic
916132383 1:161622489-161622511 GAGGGAGAGGAAAGAGTTTCAGG - Intronic
918661122 1:187090282-187090304 GAGGGAGAGAGGAGTGTTTCCGG + Intergenic
1063221839 10:3976023-3976045 GAGGGAGAGACAAGTGTTCCGGG - Intergenic
1065187151 10:23179354-23179376 GAGGGGCAGAAATGTGCTTCTGG - Intergenic
1066280503 10:33912950-33912972 GAGGGAGAAAAAAGTGTTGCTGG + Intergenic
1076356655 10:129858223-129858245 AAGGGAGAGAAACGTGTCACCGG - Intronic
1078638587 11:13075218-13075240 GAGGGCAAGCGACATGTTTCAGG + Intergenic
1083774035 11:64884422-64884444 AAGGGCAAGAGAGGTGTTTCTGG - Intronic
1087768136 11:102178718-102178740 GAGGGTGAGAAATTTGATTCAGG - Intronic
1087957274 11:104303978-104304000 GAGGGAGAGAAGGGTGTTCCAGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089672485 11:120066068-120066090 GAGGATGAGAAACCTGTCTCAGG - Intergenic
1100709151 12:97235413-97235435 GAGAGAGAGAAACGGCTTTCAGG - Intergenic
1103608481 12:122106231-122106253 AAGGGAGAGAAAAGGGTTTCAGG - Intronic
1104948776 12:132429407-132429429 GAGGGCCAGGAGCGGGTTTCAGG - Intergenic
1107515820 13:41128169-41128191 AAGGGAGAGAAATGTGTTTTGGG - Exonic
1119489650 14:75020080-75020102 GAAGGAGAGAAAAGTGTTTCAGG + Intronic
1119669623 14:76508560-76508582 GAGGGAGGGAACAGTGTTTCAGG + Intergenic
1121341956 14:93110744-93110766 GCTTGCAAGAAACGTGTTTCTGG - Intronic
1122877137 14:104673298-104673320 GAGGGTGAGAAACTTGCTCCAGG - Intergenic
1123056955 14:105575266-105575288 GAGGGCAAGAAACATGTTTTCGG - Intergenic
1123081255 14:105696519-105696541 GAGGGCAAGAAACATGTTTTCGG + Intergenic
1128935803 15:71745602-71745624 GAGGCCAAGAAAAGTGTCTCGGG + Intronic
1133294894 16:4746901-4746923 CAGGGAGAGAAATGGGTTTCTGG - Intronic
1134227244 16:12400512-12400534 GAGGATGAGAAAGGTGCTTCAGG - Intronic
1145251181 17:21297828-21297850 GAGGGAGAGAAACGGGCATCGGG + Intronic
1147636386 17:41966924-41966946 CAGGGCGGGAAACGAGTGTCGGG + Intronic
1150148451 17:62790657-62790679 GAGGGCGTGAAACGTGCTGAAGG - Intronic
1151180045 17:72320725-72320747 GAGGGAGAGAAACGAGATCCAGG + Intergenic
1151471690 17:74322332-74322354 GAGGGACAGAAACGGGTTCCAGG + Intergenic
1151785463 17:76272866-76272888 AGGGGCCAGAAACCTGTTTCTGG + Intergenic
1156468542 18:37363025-37363047 GAGTGGGAGAAATGAGTTTCAGG - Intronic
1164924679 19:32120395-32120417 GAGGGCAAGCAATGGGTTTCAGG - Intergenic
1167721073 19:51181189-51181211 GAGGATGAGGAACGTGTTTGAGG + Intergenic
925411368 2:3641738-3641760 GAGGGCGAGGAAGGTGGTTTGGG + Intronic
926974752 2:18503230-18503252 GAGAGCGAAAAAGGTGATTCTGG - Intergenic
932342646 2:70976091-70976113 GAAAGGGAGAAACGTGATTCTGG + Intronic
946633414 2:221697192-221697214 GAGGGAGAGAAAAATGTTTCTGG + Intergenic
947833302 2:233157242-233157264 GAGAGAGAGAAACGTATTCCTGG + Intronic
948107782 2:235428918-235428940 GTGGGCGACAAACATGATTCTGG + Intergenic
1169034423 20:2438049-2438071 GACGGAGAGAACTGTGTTTCAGG + Intergenic
1172480694 20:35269721-35269743 GAGGGGGAGAGAGGTGTGTCAGG - Intronic
1181688146 22:24543320-24543342 GAGGGGCAGAAACGTGCTCCAGG + Intronic
1181852756 22:25761717-25761739 GAGGGTGAGAAACTTCTTTCTGG + Intronic
1183688924 22:39377282-39377304 GAGGGGGAGACCCGTGGTTCAGG + Intronic
1184103866 22:42355989-42356011 GAGGGAGAGAAGGGGGTTTCTGG + Intergenic
954870212 3:53762014-53762036 GAGGGAGTCAAACGTGTTCCAGG - Exonic
960349065 3:116571930-116571952 AAGTGCGAGAAAAGTGTTTCAGG + Intronic
961658785 3:128457480-128457502 GAGGGCGAGAGACGTGCTCAAGG - Intergenic
967141971 3:186569063-186569085 GAGGGAGAGTACAGTGTTTCAGG + Intronic
973814135 4:54603299-54603321 GAGGGCCAGAAAGGGATTTCTGG + Intergenic
973827058 4:54718625-54718647 AAGGGCGAGATACATATTTCAGG - Intronic
974672103 4:65045467-65045489 GAGGGTGAGAAATGTGATACAGG - Intergenic
977257687 4:94758397-94758419 GCGGGCGGGACACGTGCTTCGGG + Intronic
978228582 4:106368736-106368758 CAGGGCGAGAGACGTCTTTGTGG - Intergenic
978987336 4:115029456-115029478 GAGGACAAGAAACTTTTTTCTGG - Intronic
982822115 4:159954273-159954295 GGGGGCGAGGACCGTGTTCCAGG - Intergenic
985882726 5:2652549-2652571 GAGGGCATGAAACGTCCTTCAGG - Intergenic
999841624 5:155433738-155433760 GAGGCCTAGAAAAGTGGTTCTGG - Intergenic
1003426145 6:5999528-5999550 GAGGGCGAGCAATCTGTTTGCGG - Intronic
1005071203 6:21863655-21863677 AAGAGCGAGTAACCTGTTTCAGG + Intergenic
1007016092 6:38468426-38468448 GAGGCAGAGAAATGTATTTCTGG - Intronic
1016985139 6:149889424-149889446 GAGGGCTGGAAAAGTATTTCAGG - Exonic
1021984317 7:26084458-26084480 GAGGGGGAGAAACAAGTTACAGG - Intergenic
1029179861 7:98692449-98692471 GAGAGAGAGAAAGGGGTTTCAGG + Intergenic
1034063674 7:148116455-148116477 GAGAGAGAGAAATGTGTTTGTGG - Intronic
1041076327 8:54173390-54173412 AAGGGCGAGAACCGTGTATTAGG - Intergenic
1046798339 8:118396954-118396976 AAGGGTGAGACACATGTTTCTGG + Intronic
1050428341 9:5535486-5535508 AAGGGCGGGAAACGTGCATCTGG - Intronic
1058859120 9:109097232-109097254 CAGGGGTAGAAAAGTGTTTCAGG + Intronic
1059740790 9:117147548-117147570 GAGGGCGAGCAAAGTGATACTGG - Intronic
1062351866 9:136143416-136143438 GAGGGCGGGAGACTTGTTCCAGG - Intergenic
1190522541 X:51295011-51295033 GAGGGCAACAGACATGTTTCAGG + Intergenic
1197965958 X:132061917-132061939 AAAGGTGAGAAATGTGTTTCTGG + Intergenic
1198046857 X:132912221-132912243 GAGGGGAAGCAACTTGTTTCAGG - Intronic
1199653581 X:149972396-149972418 GAGGGAGAGAAAAGTGTCTAAGG + Intergenic