ID: 914725453

View in Genome Browser
Species Human (GRCh38)
Location 1:150323424-150323446
Sequence ACTTGAGGTAAGGCATTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914725444_914725453 18 Left 914725444 1:150323383-150323405 CCTGTAATCCCAGAACTTTCGGA 0: 58
1: 8197
2: 315159
3: 266706
4: 141787
Right 914725453 1:150323424-150323446 ACTTGAGGTAAGGCATTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 76
914725448_914725453 9 Left 914725448 1:150323392-150323414 CCAGAACTTTCGGAGGTCAAGGT 0: 1
1: 49
2: 2279
3: 39300
4: 144743
Right 914725453 1:150323424-150323446 ACTTGAGGTAAGGCATTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 76
914725446_914725453 10 Left 914725446 1:150323391-150323413 CCCAGAACTTTCGGAGGTCAAGG 0: 1
1: 125
2: 6163
3: 107167
4: 233315
Right 914725453 1:150323424-150323446 ACTTGAGGTAAGGCATTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914725453 Original CRISPR ACTTGAGGTAAGGCATTACC TGG Intronic
905554335 1:38870438-38870460 ACTTGAGGCCAGGCATTCCTGGG + Intronic
907429700 1:54405114-54405136 GCTTGAGGTAACGCGTTCCCTGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
910697742 1:90039092-90039114 ACTTCATGTAAGGATTTACCAGG - Intergenic
913001557 1:114585688-114585710 ATTTGAGGTAAGGGATTAACAGG + Intronic
913022388 1:114801091-114801113 ACTTGGGGTAAGGTATTAAGGGG + Intergenic
914725453 1:150323424-150323446 ACTTGAGGTAAGGCATTACCTGG + Intronic
914894312 1:151654725-151654747 ACATGAAGGAAGGCATTCCCTGG + Intronic
917352466 1:174092364-174092386 ACAGGAGGAAAGGCAGTACCTGG + Intergenic
921838880 1:219807357-219807379 ACTGGAGTTTAGGTATTACCTGG - Intronic
922754873 1:228090204-228090226 ACTTGAGGGCAGGCACTCCCAGG - Intronic
1066047633 10:31607230-31607252 ACTGGAGCTAAGGCATTCACAGG + Intergenic
1068716058 10:60189995-60190017 GCTTGAGTTCAGGCATAACCTGG - Intronic
1075098353 10:119488507-119488529 ACTTGAGGTCAGGAGTTACTTGG + Intergenic
1078936118 11:15951656-15951678 ACTTGAAGTAATACACTACCTGG - Intergenic
1081365450 11:42229785-42229807 ACATGAGGTAAGGCATTTGGGGG + Intergenic
1083971880 11:66082642-66082664 ACCTGAGGTCAGGAGTTACCTGG + Intronic
1084079661 11:66813202-66813224 ACTTGAGGACAGGTATTATCTGG + Intronic
1089447167 11:118562474-118562496 ATTAGATGTAAGGCATTAACTGG + Intronic
1090099030 11:123774289-123774311 ACTTCATGTAAGGCATTCCCTGG - Intergenic
1099759238 12:86895854-86895876 ACTTGAGGTTAGGGAGTTCCAGG + Intergenic
1099759265 12:86895990-86896012 ACTTGAGGTTAGGGAGTTCCAGG + Intergenic
1101250912 12:102934348-102934370 ACTGGAGGAATTGCATTACCTGG - Intronic
1103681497 12:122697582-122697604 ACTTCAGGTAAGGCATTGTGGGG + Intergenic
1103683229 12:122711013-122711035 ACTTCAGGTAAGGCATTGTGGGG + Intergenic
1114307441 14:21436999-21437021 ACTTGAGGTAAGGAGCTAGCGGG + Intronic
1115950182 14:38712547-38712569 AGCTGAGGTGAGGTATTACCAGG - Intergenic
1116561999 14:46391588-46391610 ACTTGTGATAAGCCATTAACTGG + Intergenic
1119086350 14:71742857-71742879 ACTTAAGGAAAGACATGACCTGG - Intergenic
1121953507 14:98193325-98193347 CCTTGAGGTCAGGGATGACCAGG + Intergenic
1128435410 15:67643001-67643023 ACTTTGGGTTAGGAATTACCTGG + Intronic
1130117883 15:81021364-81021386 ATGTGAGGTAAGGCCTTATCTGG - Intronic
1130879570 15:88043494-88043516 ACTTGAGGTCATGCAGTGCCAGG + Intronic
1131362959 15:91810646-91810668 ACTTGAGGGAATTCATTGCCAGG + Intergenic
1134873033 16:17668808-17668830 ACTTAAGGTAAAGCTTTACATGG - Intergenic
1143762870 17:9117439-9117461 TCTTGAGGTAATGCTTTACTTGG - Intronic
1145878113 17:28335252-28335274 TCCTGAGGAAAGGCAGTACCGGG - Intronic
1146780687 17:35668965-35668987 ACTGGATGCAAGGCATTACAAGG - Intronic
1153638264 18:7131991-7132013 TCTTGAGGTTAGGTATGACCAGG - Intergenic
1159769374 18:72530703-72530725 ACTTGATGTAAGGGAATTCCCGG + Intergenic
1166541464 19:43608489-43608511 ACTACAGGTAATGCATCACCAGG - Intronic
1167252693 19:48409087-48409109 ACATGAGGGAAGGCATCACATGG + Intronic
937285458 2:120748108-120748130 ACTTTAGGAAAGGCATGATCTGG + Intronic
941804020 2:169692390-169692412 ACATGATGGAAGGCATTACATGG + Intronic
946336365 2:219039462-219039484 ATTTGAGGTAAGTCATTATAGGG - Intronic
1168899421 20:1349380-1349402 ACTTGAGGAATCACATTACCTGG - Intronic
1171777100 20:29379148-29379170 ACTTGAGGAATTCCATTACCTGG - Intergenic
1173025701 20:39305540-39305562 GCTTGCGGTGAGGCAGTACCTGG + Intergenic
1173339081 20:42137845-42137867 ACATGAGGTCAGGCAGTCCCAGG - Intronic
1174773340 20:53321838-53321860 ACATGAGATCAGGCATCACCGGG - Intronic
1179660342 21:42870485-42870507 ACTTTAGGAAAAGAATTACCAGG + Intronic
1182946446 22:34327321-34327343 ACTTGAAGTTAAGCATTCCCTGG - Intergenic
1183257526 22:36771959-36771981 ATTTGGGGTAAGGGATTACTAGG - Intronic
949956192 3:9270865-9270887 ACCAGAGGTAAGGCATTTCCGGG - Intronic
959370031 3:105511914-105511936 AATTGAGGTAGTGAATTACCAGG - Intronic
964261681 3:154846356-154846378 ATTTGAGAAAAGGCATTATCTGG + Intergenic
966616949 3:181923777-181923799 ATTTATGGTAAGGCATGACCAGG + Intergenic
969077510 4:4591829-4591851 ACTTGTGGGAAGGCAATAACAGG - Intergenic
975396646 4:73882421-73882443 AATTGTGGTAATTCATTACCTGG - Intergenic
975814336 4:78202220-78202242 AATGGAGGTTTGGCATTACCTGG + Intronic
978717069 4:111857586-111857608 ACTTGAGGTCAGCCATGGCCTGG + Intergenic
980318682 4:131239563-131239585 ACTGGAGGTATTACATTACCTGG - Intergenic
988530962 5:32026798-32026820 AATTGAGGTAAGGTAATAACAGG - Intronic
989034010 5:37150661-37150683 AATGGAGGGAAGGCATTAACAGG - Intronic
997374347 5:133386352-133386374 ACTTGAGTGAAGGCACCACCAGG - Intronic
997931861 5:138078939-138078961 ACTTCTGGAAAGGTATTACCAGG - Intergenic
999226613 5:150030646-150030668 ACTTGAGGGAATGCTTTCCCGGG - Intronic
999752841 5:154642572-154642594 TCTTGAGGCATGGCAGTACCCGG - Intergenic
1004016440 6:11736122-11736144 ACTTGAGGTCAGGAATTAGCCGG - Intronic
1004525610 6:16404598-16404620 ACTGGAGGAAAGACTTTACCAGG - Intronic
1007893938 6:45328125-45328147 GCTTGTGGTAAGGCCTTTCCTGG - Intronic
1008930570 6:56934454-56934476 TCTTGAGCTAACGCATTTCCAGG - Intronic
1009482399 6:64175698-64175720 GCATGAGGTAAGGCATTGTCCGG + Intronic
1010555849 6:77278178-77278200 ACTTGCGGTTAGGCCTAACCAGG + Intergenic
1012715756 6:102667323-102667345 AGTTTAGGAAAGGTATTACCTGG - Intergenic
1015791486 6:136968509-136968531 ATATGAGGTTATGCATTACCGGG + Intergenic
1026526425 7:71157359-71157381 AATTGAGGTAATGCATTGGCTGG + Intronic
1036030857 8:4970804-4970826 ACTAGAGCTAGGGTATTACCTGG - Intronic
1045046736 8:98286125-98286147 ACATGAGGGAAGGCATCACATGG - Intronic
1055204496 9:73711805-73711827 AAATGTGGTAATGCATTACCAGG + Intergenic
1061199033 9:129125542-129125564 CCTTGAGCTAAGACAATACCTGG - Intronic