ID: 914727330

View in Genome Browser
Species Human (GRCh38)
Location 1:150338813-150338835
Sequence CACTTACAAATGCAGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914727330_914727334 13 Left 914727330 1:150338813-150338835 CCAAGCTCCTGCATTTGTAAGTG 0: 1
1: 0
2: 1
3: 17
4: 212
Right 914727334 1:150338849-150338871 ATAGGCTGTTTTTAGCTTTTGGG 0: 1
1: 0
2: 1
3: 21
4: 316
914727330_914727336 24 Left 914727330 1:150338813-150338835 CCAAGCTCCTGCATTTGTAAGTG 0: 1
1: 0
2: 1
3: 17
4: 212
Right 914727336 1:150338860-150338882 TTAGCTTTTGGGGTTAATGTAGG 0: 1
1: 0
2: 2
3: 17
4: 291
914727330_914727335 14 Left 914727330 1:150338813-150338835 CCAAGCTCCTGCATTTGTAAGTG 0: 1
1: 0
2: 1
3: 17
4: 212
Right 914727335 1:150338850-150338872 TAGGCTGTTTTTAGCTTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 224
914727330_914727332 -5 Left 914727330 1:150338813-150338835 CCAAGCTCCTGCATTTGTAAGTG 0: 1
1: 0
2: 1
3: 17
4: 212
Right 914727332 1:150338831-150338853 AAGTGATGTATCATATATATAGG 0: 1
1: 0
2: 4
3: 39
4: 342
914727330_914727333 12 Left 914727330 1:150338813-150338835 CCAAGCTCCTGCATTTGTAAGTG 0: 1
1: 0
2: 1
3: 17
4: 212
Right 914727333 1:150338848-150338870 TATAGGCTGTTTTTAGCTTTTGG 0: 1
1: 0
2: 6
3: 47
4: 507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914727330 Original CRISPR CACTTACAAATGCAGGAGCT TGG (reversed) Intronic
900614592 1:3559582-3559604 CACTTACAAACCCAGTGGCTTGG + Intronic
901747242 1:11382111-11382133 CAATTACAAATTCTGGAACTAGG - Intergenic
903922872 1:26813523-26813545 CACTTATAAATTCAGAAACTTGG - Intergenic
908044035 1:60148976-60148998 AACTTTCATATGCAGGAGCCAGG + Intergenic
908552043 1:65218432-65218454 GTCTTCCAAATGCAGAAGCTAGG + Intronic
911849217 1:102794711-102794733 CACTGTAAAATGCAAGAGCTAGG + Intergenic
912186130 1:107278056-107278078 CATGGACAAATGCAGGGGCTGGG - Intronic
914727330 1:150338813-150338835 CACTTACAAATGCAGGAGCTTGG - Intronic
918039059 1:180901130-180901152 CACTTACAACTGGGGGACCTTGG + Intergenic
918167790 1:181967019-181967041 AACTGACAAGTGGAGGAGCTGGG + Intergenic
922860043 1:228808679-228808701 CTCTTAAAAATGCATGAGTTTGG + Intergenic
923543048 1:234903212-234903234 CACTCACAGATACAGCAGCTCGG - Intergenic
1063538118 10:6905123-6905145 TATTTACAAAAGCAGGTGCTAGG + Intergenic
1065729067 10:28694047-28694069 TACTAAGAAATGCTGGAGCTGGG + Intergenic
1067478979 10:46583453-46583475 CTGTTAGAAATGCAGGATCTTGG - Intronic
1067615759 10:47758348-47758370 CTGTTAGAAATGCAGGATCTTGG + Intergenic
1067993835 10:51246405-51246427 CATTTACAAAAACAGGAGGTGGG - Intronic
1068388165 10:56359310-56359332 CACTTACCACTGCATGATCTTGG - Intronic
1069999206 10:72363735-72363757 CACTTAGAAGAGCAGGAGCCAGG - Intergenic
1072523608 10:96252344-96252366 TTGTTAGAAATGCAGGAGCTGGG - Intronic
1072868033 10:99085309-99085331 TAGCTACAAATACAGGAGCTTGG - Intronic
1074107582 10:110400068-110400090 CAGTTACAATAGGAGGAGCTGGG + Intergenic
1074139725 10:110661336-110661358 CACTGGCAACTGCTGGAGCTGGG - Intronic
1074320370 10:112396473-112396495 TACTTACAAAGGCAGGTGGTAGG + Intronic
1075316522 10:121457872-121457894 CACATACAGATGCAAGAGCTTGG + Intergenic
1076264573 10:129099619-129099641 CATTTACAAAAGCAGGTGGTGGG + Intergenic
1078606826 11:12784558-12784580 ACCTTACAGATGCAGGAGCAGGG + Intronic
1078911320 11:15735095-15735117 CACATACCAAATCAGGAGCTAGG - Intergenic
1079277897 11:19058724-19058746 CACTTAAAAATACAGGTGCAGGG - Intronic
1080006347 11:27411664-27411686 CACTTACAAGTTTATGAGCTAGG - Intronic
1080721090 11:34849331-34849353 CACTTACACATTTGGGAGCTGGG - Intergenic
1081875790 11:46407569-46407591 CAAGCACAAATGCAGGAGGTGGG + Intronic
1083697765 11:64454014-64454036 CATTTACACATTCAGGAGCTGGG - Intergenic
1084130277 11:67128276-67128298 CACTTATAATCCCAGGAGCTGGG - Intronic
1084235480 11:67785501-67785523 GACTTACAAAAGCAGGAGACTGG - Intergenic
1085285914 11:75360712-75360734 CACTTAAAAATACAGGAAGTAGG + Intergenic
1085381211 11:76120571-76120593 CATTTATAAATGTATGAGCTTGG - Intronic
1086179111 11:83928673-83928695 CACTTACTAATGGATGATCTTGG + Intronic
1086368596 11:86133719-86133741 CATCAACAAATGGAGGAGCTGGG - Intergenic
1086927039 11:92651835-92651857 CACTTAGAAGTTCAAGAGCTGGG - Intronic
1090667943 11:128927279-128927301 AACGTGCAAATGCAGGGGCTTGG - Intergenic
1095408996 12:41901644-41901666 CACTTACAGAGGCTGGAGGTGGG + Intergenic
1101328789 12:103740580-103740602 CACTTACCACTGCAGGGACTAGG - Intronic
1101572064 12:105962808-105962830 CTGTTACAAATGCAGAATCTTGG - Intergenic
1101750189 12:107577060-107577082 TACTTACAAATGCAGATGGTAGG - Intronic
1101751279 12:107584585-107584607 TTCTAACAAATGCAGGAACTTGG + Intronic
1103225765 12:119286137-119286159 CACTTATAAAAGTAGGAGATAGG + Intergenic
1105035360 12:132916323-132916345 CACTTATAAATTCAACAGCTTGG - Intronic
1105504385 13:20997761-20997783 CTCTTAGCAAGGCAGGAGCTGGG + Intronic
1107265006 13:38542980-38543002 CATTTACAAAGGCACGAGCTTGG - Intergenic
1107460664 13:40598753-40598775 TGGTTACAAATGCAGGACCTTGG + Intronic
1107758393 13:43650535-43650557 GACTTTCAAACCCAGGAGCTTGG + Intronic
1110081731 13:71322050-71322072 ATCTTACAAATGCTGTAGCTTGG + Intergenic
1110730843 13:78877092-78877114 CACCTACAAGTGCAGGAGAGAGG - Intergenic
1111091162 13:83449932-83449954 CACTTAAAAATGCATGATATTGG - Intergenic
1113559850 13:111269857-111269879 CAAGTACAAAGGCAGGAGGTAGG - Intronic
1114234452 14:20812333-20812355 CAATTTGAACTGCAGGAGCTTGG + Intergenic
1114430788 14:22658670-22658692 CACTTATAAAAGCATGGGCTTGG - Intergenic
1116544793 14:46151615-46151637 AATTAACAAATCCAGGAGCTGGG - Intergenic
1116574784 14:46558874-46558896 TATTTACAAAAGCAGGAGCCAGG - Intergenic
1116621554 14:47210720-47210742 AAATTACAATTGCAGGGGCTGGG + Intronic
1116903125 14:50380357-50380379 TACTTCCAATTGCAGCAGCTGGG + Intronic
1119224837 14:72937152-72937174 CACTTACAAATGAAAAACCTGGG + Intronic
1121869761 14:97396327-97396349 CATGTACAAATGCAGGCTCTGGG - Intergenic
1122185457 14:99989843-99989865 CAAGTATAAAAGCAGGAGCTGGG - Intronic
1123493165 15:20799155-20799177 CAGTTAAGAATGCAGGAGCGGGG + Intergenic
1123549671 15:21368257-21368279 CAGTTAAGAATGCAGGAGCGGGG + Intergenic
1123830004 15:24125964-24125986 CATTTACATATACATGAGCTTGG + Intergenic
1123844910 15:24289905-24289927 CATTTACATATACATGAGCTTGG + Intergenic
1123860063 15:24456584-24456606 CATTTACATATACATGAGCTTGG + Intergenic
1126399354 15:48253495-48253517 CACTTACATATGCAACAGCATGG - Intronic
1127906146 15:63377865-63377887 CACCTACAAAAGGAGGAGATGGG - Intronic
1129920556 15:79315980-79316002 CACTTGAAAATGTAGAAGCTTGG + Intronic
1130402445 15:83570163-83570185 CTCCAATAAATGCAGGAGCTTGG - Intronic
1131557959 15:93415604-93415626 CAGTTGCAGATCCAGGAGCTGGG + Intergenic
1202958002 15_KI270727v1_random:95475-95497 CAGTTAAGAATGCAGGAGCGGGG + Intergenic
1133441707 16:5826579-5826601 TATTTACAAAAGCAAGAGCTGGG + Intergenic
1135037567 16:19090764-19090786 CTCTTACAGATGCAGGTCCTTGG + Intergenic
1135049747 16:19183150-19183172 CACTTGCAAGTGTAGGAGCCAGG - Intronic
1135112238 16:19699319-19699341 CACTTACAGATGAAGCAGCTGGG + Intronic
1136268760 16:29136145-29136167 CACAGACAAATACAGGAGTTGGG - Intergenic
1138143956 16:54592119-54592141 CACGTCCAAAAGCAGGATCTGGG + Intergenic
1140068389 16:71628184-71628206 CACTTGCAACTGCAGGACCTGGG + Intronic
1142072065 16:88096511-88096533 CACAGACAAATACAGGAGTTGGG - Intronic
1143032882 17:3977456-3977478 CACTTCCAAAGGCAGCTGCTGGG + Intergenic
1143096361 17:4480582-4480604 TTCTTACAAATGCAGACGCTGGG - Intronic
1143992242 17:10975528-10975550 CCTTTGCAAATGAAGGAGCTGGG - Intergenic
1144774517 17:17778514-17778536 CATATACATATGCAGGAGCTGGG + Intronic
1146861828 17:36308944-36308966 CTCTTACAATTGAATGAGCTGGG - Intronic
1147092156 17:38113048-38113070 CTCTTACAATTGAATGAGCTGGG - Intergenic
1147105053 17:38207451-38207473 CTCTTACAATTGAATGAGCTGGG + Intergenic
1147469417 17:40645569-40645591 AACTTACTGTTGCAGGAGCTGGG + Exonic
1147511415 17:41072123-41072145 CAGCTAGAAATGCAGCAGCTGGG - Intergenic
1147520501 17:41167847-41167869 CAACTAGAAATGCAGCAGCTGGG + Exonic
1147547194 17:41411217-41411239 AACATACAAATGCATGAGCATGG + Intergenic
1154450713 18:14473692-14473714 CAGTTAAGAATGCAGGAGCGGGG + Intergenic
1158238834 18:55353340-55353362 CTCTTACATATGCAGGCGCAAGG + Intronic
1158875558 18:61731589-61731611 CACTATGAAATGCAGAAGCTAGG - Intergenic
1159797452 18:72862255-72862277 CTCTTAAAAATGCAGGTGCCTGG - Intronic
1165448900 19:35871232-35871254 CACTCACAAATTCACCAGCTGGG - Exonic
1165480074 19:36057948-36057970 CACTTGCAGATGTAGGATCTTGG + Intronic
1168085875 19:54046325-54046347 CATTTACAAAGTCAGGAGGTAGG - Intronic
925105663 2:1288891-1288913 GACCTGCAAATGCAGGGGCTGGG - Intronic
925809399 2:7684348-7684370 CACTTACAGAGGCAGCAGCAAGG - Intergenic
926079203 2:9970312-9970334 CACTTACTCCAGCAGGAGCTTGG - Intronic
926108008 2:10164654-10164676 TACTTACAGATGCAGGGACTAGG + Intronic
926127360 2:10279747-10279769 AACTTACAAAGGGTGGAGCTGGG - Intergenic
928663640 2:33528870-33528892 CATTAATAAATGCAGGTGCTTGG - Intronic
929635807 2:43520184-43520206 CACTAACAAAAGCAGGATTTTGG - Intronic
939100240 2:137887360-137887382 GACTTAAAAATTCAGGAGCATGG - Intergenic
939388871 2:141539857-141539879 CACTTAAAAATGTAAGAGCATGG + Intronic
943795288 2:191985257-191985279 CATTTATAAATTTAGGAGCTAGG + Intronic
944463601 2:199978118-199978140 CACTTAAAAAGTCAGAAGCTAGG - Intronic
947717640 2:232349924-232349946 CACTTACAAAGCCCAGAGCTTGG + Intergenic
948036115 2:234859397-234859419 CTCTAAGAAATGCAGGATCTGGG + Intergenic
948190510 2:236054767-236054789 CGCTTCCAAAGGCAGGAGCTGGG - Intronic
1173105512 20:40129748-40129770 CACTTACATAAACAGGACCTAGG - Intergenic
1173841049 20:46157585-46157607 CCCTGACAAATGCGGGAGATGGG - Intergenic
1174376318 20:50128890-50128912 CACTCACAGAAGCAGGGGCTGGG + Intronic
1174996676 20:55577486-55577508 CACTTACAATTGGAGGAGTCTGG - Intergenic
1176445520 21:6816882-6816904 CAGTTAAGAATGCAGGAGCGGGG - Intergenic
1176823688 21:13681915-13681937 CAGTTAAGAATGCAGGAGCGGGG - Intergenic
1182017990 22:27056733-27056755 CACCTGCAAATGCAGGTCCTGGG + Intergenic
1182527692 22:30931643-30931665 CACTTACACAGGCAGGCACTTGG + Intronic
1183836078 22:40454519-40454541 CATTTAAGAATGGAGGAGCTTGG - Intronic
949471127 3:4398003-4398025 CACTTACAGATGAGGAAGCTGGG + Intronic
950148699 3:10669535-10669557 GAGTTACAAATACAGGAGCTGGG + Intronic
952339855 3:32436458-32436480 CATTTACAAATGCAGGTTCCAGG + Intronic
952946148 3:38478970-38478992 CCCTTACAAATGCTGAAGCTGGG + Intronic
953454979 3:43033676-43033698 AAATTACAAAAGCAGGTGCTTGG - Intronic
953494481 3:43374194-43374216 CAATTAGAAATGCAGGAAATGGG - Intronic
954285975 3:49619487-49619509 GACTTGCAAATGGTGGAGCTGGG - Intronic
954532041 3:51329532-51329554 CAATAACAAATGCAGGGGCCCGG + Intronic
955803927 3:62714071-62714093 AACTTATAAATTAAGGAGCTGGG + Intronic
956051312 3:65251399-65251421 AAGGAACAAATGCAGGAGCTAGG - Intergenic
965392746 3:168125178-168125200 GACTTAAAAATGGAGGAGATAGG - Intergenic
965449697 3:168822461-168822483 CACTTACAGAGGCAGGCACTAGG + Intergenic
969178351 4:5417433-5417455 CACTGACAAATGCTGAAGATTGG - Intronic
969628970 4:8324336-8324358 GACTCACAGAGGCAGGAGCTGGG - Intergenic
970075979 4:12221171-12221193 CACTTTAAAATGAAGAAGCTGGG - Intergenic
970504996 4:16719706-16719728 CACTTATAAATGCATTACCTGGG - Intronic
970521341 4:16887321-16887343 CACTTCCATAATCAGGAGCTTGG + Intronic
972151782 4:36100148-36100170 TACTTACAAATGGAGAAACTGGG - Intronic
972425149 4:38926196-38926218 AACTACCAGATGCAGGAGCTGGG + Intronic
972699809 4:41483141-41483163 GACATACAAAGGCAGGACCTAGG + Intronic
974167789 4:58226083-58226105 AAGTTACAAAGGCAGTAGCTTGG - Intergenic
975619047 4:76277182-76277204 CAGTTATAAAGGCAAGAGCTTGG + Intronic
976318091 4:83681002-83681024 CAATTACAAATGCTGTAGCAAGG + Intergenic
977374421 4:96183345-96183367 TTCTTACAAATGCAGAAGCTTGG - Intergenic
978635936 4:110807319-110807341 CTCTTACAAATGCTGGATTTGGG + Intergenic
979503366 4:121465370-121465392 CAGTTACTAATTCAGCAGCTTGG + Intergenic
982283768 4:153713621-153713643 CCCTAACAAATGGAGGAGCTTGG + Intronic
986817997 5:11433774-11433796 CAATTCCCAATGCAGGAGGTGGG - Intronic
988822400 5:34900120-34900142 CACTGAACAATGCAGGGGCTAGG + Intergenic
988861410 5:35284246-35284268 AAATTACAAATTAAGGAGCTGGG - Intergenic
989738667 5:44741147-44741169 CTCTTCCAACTGCAGGAGCTGGG - Intergenic
990947987 5:61269720-61269742 CACTCAAAAATGAAGGAGTTGGG + Intergenic
994523094 5:100866758-100866780 CACTTACAAATCAATGACCTTGG - Intronic
994681982 5:102899659-102899681 CACCAAAAAGTGCAGGAGCTGGG - Intronic
995648382 5:114339500-114339522 CTCTTTAAAATGCAGGAGATGGG + Intergenic
997499421 5:134360463-134360485 CACCTACAATTCCAGGAGTTGGG - Intronic
999121839 5:149215763-149215785 CATTTGTATATGCAGGAGCTTGG - Intronic
999931033 5:156432954-156432976 CAGATACACATGCAGGAGCTAGG - Intronic
1001217202 5:169866976-169866998 CACTTACAAGTCCGGGACCTTGG + Intronic
1004871401 6:19908167-19908189 CTCTTACAAATGAAGATGCTTGG - Intergenic
1005648122 6:27861660-27861682 AACTTACAAATATAGAAGCTGGG + Intronic
1005823999 6:29621470-29621492 CACTCAGAAATACAGGGGCTGGG - Intronic
1007707998 6:43803136-43803158 CTCTTACACAATCAGGAGCTTGG + Intergenic
1008301240 6:49842819-49842841 GACTAGCAAATGGAGGAGCTAGG - Intronic
1008541415 6:52549553-52549575 CTGTTTCACATGCAGGAGCTTGG - Intronic
1008743775 6:54643360-54643382 CACTTACAAATGAAAGAGAATGG - Intergenic
1011093982 6:83637715-83637737 CTTGTACAAATGTAGGAGCTGGG - Intronic
1011270001 6:85568630-85568652 AACTTACAAATGCAGTAGGGAGG + Intronic
1013193128 6:107820809-107820831 CTCTTGCAAATGCAGAAGTTTGG + Intronic
1016381501 6:143487326-143487348 AACTTACAAAAGCTGGTGCTTGG - Intronic
1017440949 6:154463814-154463836 CAGTGTAAAATGCAGGAGCTGGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018359341 6:163051124-163051146 AACTTAAAAATTCAGTAGCTAGG - Intronic
1018660298 6:166079642-166079664 CAATTGCAAGTGCAGGTGCTTGG + Intergenic
1019200285 6:170308181-170308203 CACTCACTAATGATGGAGCTGGG - Intronic
1020902948 7:14028180-14028202 CAGTTAAAAATGCAGGAGGTTGG - Intergenic
1022494960 7:30847077-30847099 CACCTACAAATGCAGACACTGGG - Intronic
1023215116 7:37854020-37854042 CCCTTACCAATGCTGGAGTTAGG + Intronic
1023355341 7:39361831-39361853 CACCTACAAATGTTTGAGCTCGG + Intronic
1024121641 7:46247981-46248003 CTCTAACAAATGCCTGAGCTGGG + Intergenic
1027615526 7:80418796-80418818 CACTTACAAAAGCAGGAAACAGG - Intronic
1029955234 7:104631824-104631846 CACTTACAAAGGTTGTAGCTAGG - Intronic
1030815777 7:114035183-114035205 CCCTCACAAATGCTGGAGCTGGG + Intronic
1031441641 7:121801641-121801663 CACTTATAAATCCAGTAGTTTGG - Intergenic
1031932065 7:127695500-127695522 AACTTACAAATGAAGAAACTAGG - Intronic
1033811883 7:145023861-145023883 CACTTGCAAAAGCAGGTGGTGGG - Intergenic
1036673656 8:10811165-10811187 CATTTACAAATGAAGAAGCTGGG + Intronic
1037091322 8:14922652-14922674 CACTTACAAATGAAATAGTTTGG + Intronic
1037813366 8:22099345-22099367 CACTTACACGTGCAGGAGCTGGG - Exonic
1039173183 8:34772556-34772578 CATTTATAAATGCAGAAGCTTGG - Intergenic
1042913443 8:73850366-73850388 GACCTACAAATGCAAGTGCTAGG - Intronic
1044638578 8:94354030-94354052 CACATACAAATGAAGGAAGTTGG + Intergenic
1046619618 8:116514570-116514592 CACTTACAAGAGCAGAATCTTGG - Intergenic
1047018163 8:120745587-120745609 TACTGACAAATGAGGGAGCTAGG - Intronic
1047128640 8:121992380-121992402 CATTTATAAATACAGGACCTTGG - Intergenic
1047158580 8:122350543-122350565 CACTTACAAATGCAAGGTCAGGG - Intergenic
1047326740 8:123846011-123846033 CACTTACAAATGTAAGAAATAGG - Intergenic
1047821463 8:128525853-128525875 TACTTACAAATGCAAGACATAGG + Intergenic
1048559745 8:135521181-135521203 GACTCAGAAATGCAGGGGCTGGG - Intronic
1049907171 9:228887-228909 CACTCACAAGTCCAGGACCTTGG + Intronic
1050658764 9:7859498-7859520 CACTTAGAAATGCAGATTCTGGG + Intronic
1050728585 9:8681054-8681076 CACTAACAAAGTCAGGAGATAGG - Intronic
1051066657 9:13112470-13112492 TACTTGCAAATGCTGGAACTTGG + Intronic
1051556055 9:18383939-18383961 CTGTTACAAATGCAGAATCTGGG - Intergenic
1051810443 9:21042762-21042784 CACTGATACATGCAGCAGCTTGG - Intergenic
1052769946 9:32678422-32678444 CCCTTTGAAATGCAGGGGCTTGG + Intergenic
1054711327 9:68514072-68514094 TACTTAGAAATGCAGAATCTCGG + Intronic
1054872325 9:70059335-70059357 CCCTTACAAATGAAGAAACTAGG + Intronic
1054941513 9:70747881-70747903 AACTTGGAAATGCAGGAGCCAGG + Intronic
1057794245 9:98144328-98144350 CATTTACAAGTGCAGAGGCTGGG + Intronic
1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG + Intronic
1060777653 9:126387865-126387887 CACTTCCAGATGCATGACCTTGG - Intronic
1062064049 9:134516710-134516732 CATTTATAAATGAGGGAGCTGGG - Intergenic
1203523675 Un_GL000213v1:67643-67665 CAGTTAAGAATGCAGGAGCGGGG + Intergenic
1185995755 X:4946970-4946992 CACTTTCATATGCAGTAGCCTGG + Intergenic
1186162930 X:6796847-6796869 CACTTATAAATGGATGAGATGGG + Intergenic
1186661276 X:11669847-11669869 GACTTAAAAAAGCAGGAGTTTGG + Intergenic
1189946482 X:46185757-46185779 CGCTTACAAATGTATGATCTTGG - Intergenic
1192261236 X:69506758-69506780 CCCTGACAAAGGAAGGAGCTGGG + Intronic
1192680495 X:73248553-73248575 CACATCCAGATGCAAGAGCTGGG - Intergenic
1193022321 X:76803474-76803496 CAATTCCAAATGCTGGAGGTGGG + Intergenic
1193386825 X:80882916-80882938 CAGCCACAAGTGCAGGAGCTGGG + Intergenic
1193809303 X:86032986-86033008 CATTATCAAATGAAGGAGCTAGG + Intronic
1196562160 X:117162844-117162866 CAGTAACAGATGCTGGAGCTTGG + Intergenic
1198790424 X:140339628-140339650 CAGGAAGAAATGCAGGAGCTAGG + Intergenic
1201557398 Y:15277755-15277777 CACTTATAAATGGATGAGATGGG + Intergenic