ID: 914730750

View in Genome Browser
Species Human (GRCh38)
Location 1:150368126-150368148
Sequence CTAAACAATGAGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 7, 3: 38, 4: 400}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914730750 Original CRISPR CTAAACAATGAGAAGGAGGC AGG (reversed) Intronic
900106757 1:984798-984820 ATAAAAAATGAAAAGGAGGCCGG - Intergenic
902717894 1:18285134-18285156 GAAAACAAAGAGAAGGAGGTTGG + Intronic
904381401 1:30113552-30113574 CTTAACACTGAGAAGGCAGCAGG + Intergenic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
905847514 1:41244737-41244759 CTAAAAAAGAAGCAGGAGGCTGG - Intergenic
906119418 1:43378678-43378700 CATGACAATAAGAAGGAGGCAGG + Intergenic
906172762 1:43741598-43741620 CTTAAAAATGAAGAGGAGGCTGG + Intronic
906504290 1:46366548-46366570 CTAAAAAAAGAGAAGGGGGTTGG + Intergenic
906801938 1:48745568-48745590 ATAAGCAAAGAGTAGGAGGCAGG - Intronic
907843814 1:58185225-58185247 CTAAAAAATGAGAGGGAAGCAGG + Intronic
909728749 1:78868546-78868568 CTAATTAATCTGAAGGAGGCAGG + Intergenic
910067900 1:83175330-83175352 CAAAGCAATAAGAGGGAGGCAGG + Intergenic
910100526 1:83570664-83570686 CAAAACAAAGAGACTGAGGCAGG - Intergenic
910260336 1:85288133-85288155 TTAAAAAATGAGAAGGTGGCTGG + Intergenic
911043259 1:93608512-93608534 CTAAACACTGGGGAGGACGCTGG - Intronic
911427798 1:97742268-97742290 CAAAAGAATGACAAGGAGACTGG - Intronic
911633102 1:100204654-100204676 CTAAACAAAAAGAAGGAAGCTGG + Intronic
912602864 1:110955889-110955911 ATACACAATGAGAAGGAGGCAGG + Intronic
913206433 1:116543467-116543489 AGAAACAATGAAAATGAGGCAGG + Intronic
913962611 1:143351989-143352011 CTAAAGAATGTGCAGGAGGCTGG + Intergenic
914049825 1:144122399-144122421 CTAAACCATAAGAGGGAGGGAGG + Intergenic
914056966 1:144177574-144177596 CTAAAGAATGTGCAGGAGGCTGG + Intergenic
914122180 1:144788792-144788814 CTAAAGAATGTGCAGGAGGCTGG - Intergenic
914730750 1:150368126-150368148 CTAAACAATGAGAAGGAGGCAGG - Intronic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915350103 1:155218943-155218965 CTAAACAAAAACAAGGATGCAGG + Intergenic
915353503 1:155241181-155241203 CTAAACAAAAACAAGGATGCAGG + Intronic
915381194 1:155442246-155442268 CTAAAGAATGAGTTGGAGGATGG - Intronic
915434099 1:155890343-155890365 CCAAACATTGACAAGGAGGATGG + Intergenic
916404957 1:164489153-164489175 CTAAAAACTGAGAAGGAGCCGGG + Intergenic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
919935839 1:202250180-202250202 CTAAAGGATGAGTAGGAGGTGGG - Intronic
920186335 1:204161633-204161655 CAAAACATTGAGAATGAAGCAGG + Intronic
921109860 1:212025093-212025115 CTAAACATTGTGAAAAAGGCAGG + Intronic
922800787 1:228363941-228363963 CCAAACAAGGAGAAGGAGAAGGG - Intronic
922990060 1:229900036-229900058 CATAACAATGAGAAAAAGGCAGG + Intergenic
923066078 1:230518536-230518558 CTAAACCATCAAAAGGAGGAAGG - Intergenic
923093029 1:230753853-230753875 CTAAACAAAGGGAGGGAGGGAGG - Intronic
923629004 1:235637354-235637376 TTAAAGAATTAGAATGAGGCTGG + Intronic
1063422993 10:5928502-5928524 CTAAAGAGTGAGAGGGAGGAAGG - Intronic
1065544282 10:26803091-26803113 CTAAACAATGAGCAAGAGTTAGG + Intronic
1066007554 10:31159458-31159480 CTTAAGAAAGAGATGGAGGCAGG + Intergenic
1068490754 10:57720765-57720787 CTAAACAAAAAGAACGAAGCTGG + Intergenic
1069457843 10:68567906-68567928 CTACACCATGAGATGGAGGCTGG + Intronic
1070120629 10:73573465-73573487 TTAAAAACTGAGAAAGAGGCTGG + Intronic
1071522736 10:86341135-86341157 CTGAACAATAAGGAGGAGGGAGG - Intronic
1071704449 10:87982183-87982205 CTCTAAAATGAGAGGGAGGCAGG - Intergenic
1071737974 10:88323305-88323327 CTAAGCAAAGAGAACAAGGCTGG + Intronic
1072445743 10:95497189-95497211 GTAAACAAGGAGGAGGAGGCAGG + Intronic
1073997851 10:109336820-109336842 CTAAACAAGAAGAAGAAAGCTGG - Intergenic
1074042692 10:109808074-109808096 AGAACCAATGAGAAGGAGCCTGG + Intergenic
1074779470 10:116790663-116790685 CTAGACAATGAGATGGGGTCTGG - Intergenic
1077681620 11:4247053-4247075 CTACAGAAGGAGAAGGATGCTGG - Intergenic
1077882178 11:6359813-6359835 TAACACAAAGAGAAGGAGGCTGG + Intergenic
1078284271 11:9935506-9935528 CTAAACAAAAAGAAGAAAGCTGG + Intronic
1078709031 11:13772439-13772461 CTACACACTGTAAAGGAGGCGGG + Intergenic
1078753665 11:14188370-14188392 CTATACAATGAAGAGGTGGCAGG + Intronic
1079638777 11:22778541-22778563 GTAAATGATGAGAAGGAGCCAGG + Intronic
1081522505 11:43896705-43896727 CTAAATAATGGGAAGAAGTCAGG - Intronic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081760975 11:45576328-45576350 ACAAGCAAAGAGAAGGAGGCTGG + Intergenic
1081796963 11:45827163-45827185 CTAATAACTGACAAGGAGGCTGG - Intergenic
1081965630 11:47167483-47167505 TTAAAAAATAAGAAGGGGGCTGG + Intronic
1083026263 11:59553673-59553695 CTTAACACTGGGAAGTAGGCCGG - Intergenic
1083317068 11:61822268-61822290 CTATACAATGATAAGAAGACTGG - Intronic
1084898271 11:72291745-72291767 AAAAACAATGAAAAGCAGGCCGG + Intergenic
1085016913 11:73179705-73179727 TTAAAAAATCAGAGGGAGGCTGG - Intergenic
1085159028 11:74324025-74324047 CTGTACATTGAGACGGAGGCAGG - Intergenic
1085620784 11:78036603-78036625 CTAAAGTATGAGAATGAGCCAGG - Intronic
1086576533 11:88344619-88344641 TTAAACCATAAAAAGGAGGCTGG + Intergenic
1087447354 11:98271432-98271454 GTAAACAATTAAAAAGAGGCTGG - Intergenic
1087911078 11:103754007-103754029 CAAAACAATGAGAAGGAAAATGG + Intergenic
1088948666 11:114541878-114541900 ATAAACATTGAGAAGCAGGGAGG - Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090937838 11:131360979-131361001 CTGAACATTGAGAAGAGGGCAGG + Intergenic
1092158136 12:6298236-6298258 CAAAACAGTGAAAAGGAGGCCGG + Intergenic
1093193814 12:16106430-16106452 GTAAAGAATGACAAAGAGGCTGG - Intergenic
1096257053 12:50069588-50069610 CTAAAGAATAAAGAGGAGGCTGG - Intronic
1097216126 12:57414532-57414554 ATTAAGAATGAGAAGCAGGCCGG + Intronic
1098230341 12:68366628-68366650 GGAAACAATGAGACGGAAGCAGG - Intergenic
1098746889 12:74249239-74249261 TTAAATAATAAGAAGGAGGAAGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099306203 12:80959269-80959291 TTTAAAAATGCGAAGGAGGCAGG - Intronic
1099398331 12:82169847-82169869 CTAAAGAATGAGAAGTAGTTTGG - Intergenic
1099465279 12:82978200-82978222 CTAAAAATTAAGAATGAGGCAGG + Intronic
1100292896 12:93234614-93234636 CTCAACAAAGAGAAGGATGGGGG + Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100765401 12:97859399-97859421 CTAAACAATAAGAACAAAGCTGG + Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1103277390 12:119723992-119724014 CTTAAAAAAGAGAAGGTGGCCGG + Intronic
1105249605 13:18685985-18686007 CCACACAATGAGGAGGAGGTGGG + Intergenic
1106367488 13:29096559-29096581 GTAAGCAATTAGGAGGAGGCTGG - Intronic
1106792140 13:33166570-33166592 CCCAACAATGAGCAGGTGGCAGG - Intronic
1107098297 13:36560311-36560333 CTGCACAGTGTGAAGGAGGCAGG - Intergenic
1107104847 13:36632043-36632065 ATAAACGATGTGAAAGAGGCCGG - Intergenic
1107507670 13:41050843-41050865 CTAAAAAATCTGAAAGAGGCCGG - Intronic
1108036922 13:46299723-46299745 ATAAACAATGAGAAGAAGTAAGG + Intergenic
1108095319 13:46894522-46894544 CTAGAGAATGTGAAGGAGGAAGG - Intronic
1108350208 13:49585158-49585180 CTCAAAAAAGAGAGGGAGGCAGG + Intronic
1109540927 13:63777869-63777891 CTAAGCAATAAGAACGAAGCTGG - Intergenic
1111654499 13:91135050-91135072 TTAAATAATGAGAGGGAAGCAGG + Intergenic
1112187598 13:97142911-97142933 CAAAAAAATGAGAAGGTAGCAGG + Intergenic
1113505356 13:110812693-110812715 CTAAACACCGAGAAGACGGCAGG - Intergenic
1113841467 13:113363914-113363936 CAAAACCGAGAGAAGGAGGCCGG + Intronic
1114201305 14:20523371-20523393 CTAAATAATGATGGGGAGGCTGG - Intergenic
1114261429 14:21039336-21039358 CGATAGAATGAGAAGGAAGCAGG + Intronic
1115522076 14:34243023-34243045 ATAAGGGATGAGAAGGAGGCTGG - Intronic
1117982283 14:61353632-61353654 TTAAATAATGAGAATCAGGCTGG + Intronic
1119464742 14:74847686-74847708 CTAAAAAATGTGAGTGAGGCAGG - Intronic
1119558828 14:75573810-75573832 TTAAACAAGGAGAATGGGGCCGG - Intergenic
1119770707 14:77219203-77219225 CTCAGCAATGAGAAAGAGGAAGG - Intronic
1120252657 14:82077968-82077990 CTCAACAATCAGAGGGAGGTAGG - Intergenic
1120688594 14:87566959-87566981 GTAAACAATGAGTAAGAGGTGGG - Intergenic
1120818527 14:88889786-88889808 CTGAAGATTGAAAAGGAGGCAGG + Intergenic
1121200615 14:92114116-92114138 ATAAAGAATTACAAGGAGGCTGG - Intergenic
1121701889 14:95961041-95961063 GTAAAGAAAGAGATGGAGGCTGG + Intergenic
1123419693 15:20121648-20121670 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1123446171 15:20331888-20331910 CTAAACCATAAGAGGGAGGGAGG - Intergenic
1123528916 15:21128184-21128206 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1124258043 15:28162030-28162052 ATAAAAAATTAGAAGAAGGCCGG + Intronic
1124920922 15:34025373-34025395 ATAAAAAATGAGCAGGAAGCAGG + Intronic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125770900 15:42165170-42165192 CTTAAAAATGTGAGGGAGGCTGG - Intronic
1126752442 15:51890784-51890806 CTTAAAAATGAGAAGGGGGATGG - Intronic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1128068397 15:64778050-64778072 CTAAAAAAAGAAAAGAAGGCCGG - Intergenic
1128151532 15:65366368-65366390 CTAAAGAAAAAGAAAGAGGCAGG + Intronic
1128151537 15:65366406-65366428 ATAAAGAAAGAGAAGGAGGGAGG + Intronic
1128878231 15:71219758-71219780 ATAAACAATGAAACCGAGGCTGG + Intronic
1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG + Exonic
1129994055 15:79989596-79989618 CCAAACCAAGAGAAGGACGCTGG + Intergenic
1131408911 15:92189563-92189585 CATTACAATGAAAAGGAGGCAGG + Intergenic
1133083446 16:3342581-3342603 CTGAACAATAAAAACGAGGCCGG + Intergenic
1134279577 16:12805651-12805673 CCAAGAAATGTGAAGGAGGCCGG + Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1138086690 16:54139995-54140017 CTAATAAATGAGAAGGAGGCAGG - Intergenic
1138204741 16:55116227-55116249 CAACACAGTGAGAAGGAAGCAGG + Intergenic
1139714778 16:68804042-68804064 CTAAGCAATAAGAAGGAGAAAGG + Intronic
1139718591 16:68834376-68834398 CAAAAAAATAAAAAGGAGGCTGG - Exonic
1139762925 16:69201985-69202007 GTAAACAAGGAGAATGAGTCAGG - Intronic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1141776471 16:86126428-86126450 TTAAAAAATGAGAAGTAGGCTGG + Intergenic
1143127521 17:4653064-4653086 CTAAACAACCAGAAGGAACCAGG + Intergenic
1143418701 17:6771641-6771663 GTATACAATTAGAAGGTGGCAGG + Intronic
1143655454 17:8291107-8291129 AAAAACAGTGAGAAGGAGGAAGG + Intronic
1143777722 17:9210255-9210277 CTAAACGGTGCAAAGGAGGCAGG - Intronic
1144036563 17:11371257-11371279 CTATACAATGAGAAGGGGGCTGG - Intronic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145077153 17:19866196-19866218 CTAATAAATGAAAAGTAGGCCGG + Intronic
1147115550 17:38296803-38296825 TTAAAAAAGGAAAAGGAGGCCGG - Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148260940 17:46183130-46183152 CTAAAGAATGAGTAGGAGCTGGG + Intronic
1148414128 17:47492817-47492839 TTAAAAAAGGAAAAGGAGGCCGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149366300 17:55948411-55948433 CTAAACAAAAAGAATGAAGCTGG - Intergenic
1149726056 17:58895807-58895829 CTCAAAAAAGAAAAGGAGGCCGG + Intronic
1150591210 17:66564373-66564395 TTAAACAATTAAAAAGAGGCTGG - Intronic
1151022495 17:70633759-70633781 CTAAACAATGAAAAGGAATGAGG - Intergenic
1151493571 17:74446555-74446577 CTAAACAATTGGAAGTAGGAGGG + Intronic
1152380857 17:79941689-79941711 GGGAACACTGAGAAGGAGGCTGG - Intronic
1152524739 17:80881520-80881542 TGAAAGAATGAAAAGGAGGCTGG + Intronic
1152795972 17:82306522-82306544 CAAGAAAATGAGAACGAGGCCGG - Intergenic
1153284461 18:3445426-3445448 TTAAAAAATGAGAAGAAGGCCGG + Intronic
1153635960 18:7113778-7113800 ATAAAAAATGGGAAAGAGGCCGG + Intronic
1153909827 18:9696968-9696990 CTAGACACTGAGAAGGAGGTTGG - Intergenic
1154054112 18:10994702-10994724 TTAAAGAATGAAAAGTAGGCTGG - Intronic
1154353518 18:13607130-13607152 CAAAACAATGAGTGGGTGGCCGG + Intronic
1156096307 18:33536716-33536738 CTAAACAAAAAGAATGAAGCTGG + Intergenic
1157209904 18:45733243-45733265 CTAAAGAAGGAGAAGAAGACGGG + Intronic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160146127 18:76366496-76366518 CAAAACAAAGAGAAGCACGCTGG + Intronic
1160964031 19:1737921-1737943 CTACAGAATGAGGATGAGGCCGG + Intergenic
1162497410 19:11030979-11031001 CAAGACAATGTGGAGGAGGCTGG - Intronic
1163817276 19:19474504-19474526 CAAAACACTCAGAAGGAAGCCGG - Intronic
1164572235 19:29382782-29382804 ATAAACAAGGAGAAGGAGCTTGG - Intergenic
1164706451 19:30323678-30323700 CCCAACCATGAGAAGGAGGATGG - Intronic
1164801867 19:31083635-31083657 TTAAACCATGATAAGGTGGCAGG + Intergenic
1164837762 19:31368977-31368999 CTGAACACTGGGAATGAGGCTGG - Intergenic
1165020550 19:32920778-32920800 CTATAAAATAAGAGGGAGGCTGG - Intronic
1165281732 19:34803664-34803686 CTCAACAATAAGAAGCAGGTGGG + Intergenic
1165762237 19:38328182-38328204 CTGAACTATGAGAAATAGGCAGG + Exonic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166131209 19:40746805-40746827 CTCAACAAAAAAAAGGAGGCCGG - Intronic
1166197355 19:41215892-41215914 TTAAAAAATGAGACGGGGGCCGG - Intergenic
1168084463 19:54035141-54035163 CTGGACAATTTGAAGGAGGCAGG + Intergenic
1202689214 1_KI270712v1_random:74962-74984 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1202696449 1_KI270712v1_random:130247-130269 CTAAAGAATGTGCAGGAGGCTGG + Intergenic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
926550791 2:14298712-14298734 CCAAACTAGGAGCAGGAGGCAGG - Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
928776567 2:34771625-34771647 ATAAAACATGAGAAGGAAGCTGG - Intergenic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929664994 2:43827026-43827048 CTAAAAAGTGACAAGGGGGCCGG + Intronic
929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG + Intronic
931211196 2:60197093-60197115 CTAAACAAAAAGAAGAAAGCTGG - Intergenic
931671034 2:64647597-64647619 ATAAACAATGTCAAGGAGGTGGG + Intronic
931837588 2:66115062-66115084 AGAAACAAGGAGAAGGAGGTTGG + Intergenic
932398887 2:71466335-71466357 CGAAAGGGTGAGAAGGAGGCAGG - Intronic
932823486 2:74920801-74920823 CTGGACATTGAGAGGGAGGCAGG - Intergenic
933708984 2:85311847-85311869 CTAAACATAGAAAAGGTGGCTGG + Intergenic
933957222 2:87381129-87381151 CTAAACCATAAGAGGGAGGGAGG - Intergenic
934033188 2:88065890-88065912 TTAAAAAAAGAGAAAGAGGCCGG - Intergenic
934241340 2:90273021-90273043 CTAAACCATAAGAGGGAGGGAGG - Intergenic
934271834 2:91543665-91543687 CTAAACCATAAGAGGGAGGGAGG + Intergenic
934277611 2:91587272-91587294 CTAAAGAATGTGCAGGAGGCTGG + Intergenic
935815425 2:106842699-106842721 CTGAACAGTGAGAAGGACGCCGG + Intronic
936154074 2:110037017-110037039 GTAAGCAATGAGCAGGAGCCTGG - Intergenic
936190610 2:110334398-110334420 GTAAGCAATGAGCAGGAGCCTGG + Intergenic
937498944 2:122456620-122456642 CTAAACAAAAAGAATGAAGCTGG + Intergenic
937799811 2:126070444-126070466 CTTCACATTGAGAAGGAGGAAGG - Intergenic
939041769 2:137198064-137198086 CTAAATAATGAAAAGCAAGCAGG - Intronic
939673096 2:145037983-145038005 CTAACCAAAGAGAAGGACGCAGG - Intergenic
939974399 2:148699871-148699893 CCAAACGATGATAAGGATGCGGG - Intronic
941354075 2:164467435-164467457 CTTAAATATGAGAAGGAGACTGG + Intergenic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942372242 2:175297558-175297580 CTAAGCAATGAAAATGAAGCTGG + Intergenic
943699460 2:190973956-190973978 CTCAACAAAGAGAGGAAGGCAGG - Intronic
943751854 2:191517441-191517463 ATAAACAAGGAGATAGAGGCTGG + Intergenic
944540844 2:200752090-200752112 CCAAACAAAGAGATGGAGGAAGG - Intergenic
945925394 2:215797689-215797711 GTAAATAATTAAAAGGAGGCTGG + Intergenic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946391830 2:219420786-219420808 CCCAAAAATGAGAAGGATGCAGG - Intronic
946648115 2:221861413-221861435 TTAAACACTGAGGAAGAGGCCGG - Intergenic
947286756 2:228525326-228525348 CTTAAGAATGAGAGGGAGGAGGG + Intergenic
948422388 2:237867964-237867986 CTACACCATGAAAAGGAGCCTGG - Intronic
948877462 2:240837271-240837293 CTACACACAGAGCAGGAGGCTGG + Intergenic
1173225827 20:41161946-41161968 CTAACCCATGAGAGGGAGGAAGG - Intronic
1173597501 20:44268659-44268681 CTGAAGGATGAGAAGGAGCCTGG + Intronic
1174064080 20:47852185-47852207 ATAAAGGGTGAGAAGGAGGCGGG + Intergenic
1174389024 20:50205931-50205953 TTAAGCAATGAGAAGGAGAGAGG + Intergenic
1174523561 20:51153978-51154000 CTAAACCATGCCAAGGAGGCTGG + Intergenic
1174769044 20:53281252-53281274 CTAAATAATGAGAAGCAGCCAGG + Intronic
1175354930 20:58357315-58357337 TAAAACATTAAGAAGGAGGCAGG - Intronic
1175866374 20:62179470-62179492 AGAAACATTGAGAAGGGGGCGGG - Exonic
1176456455 21:6916502-6916524 CCACACAATGAGGAGGAGGTGGG + Intergenic
1176834629 21:13781562-13781584 CCACACAATGAGGAGGAGGTGGG + Intergenic
1178178061 21:30128053-30128075 CGGAACAATGAGAAGGAGAATGG + Intergenic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178505492 21:33159341-33159363 AGAAGCAATGAGAAGGAGACTGG + Intergenic
1178559989 21:33629557-33629579 ATAAAAAATCAGTAGGAGGCTGG - Intronic
1179135463 21:38676630-38676652 GTAAACACTGGGAAGGAGCCAGG + Intergenic
1179217274 21:39378382-39378404 CAAAACAAAGAGCAGGAGTCTGG - Intergenic
1180223363 21:46374225-46374247 CTAAACAATCAGGAGGAGAGGGG - Intronic
1180552206 22:16549652-16549674 CTAAACCATAAGAGGGAGGGAGG - Intergenic
1181351823 22:22264407-22264429 CTAAACCATAAGAGGGAGGGAGG + Intergenic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182742679 22:32580011-32580033 CTACACAATGAGCAGAAGCCTGG - Intronic
1183137612 22:35904144-35904166 CTAAAAGATAAGAAGGAGCCTGG - Intronic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
949128992 3:478742-478764 CTAAACAAAAAGAATGAAGCTGG + Intergenic
949663155 3:6305043-6305065 TTAAAAAATGAAAAGGAAGCTGG + Intergenic
950523462 3:13509734-13509756 GTAAACAGTGGGAATGAGGCTGG + Intergenic
950868273 3:16207051-16207073 AGAAACAATGTGAAAGAGGCAGG + Intronic
951404018 3:22271695-22271717 TTAAATGATGAGAAGGAGACAGG - Intronic
951461860 3:22959744-22959766 TCAAAGAATGAGTAGGAGGCAGG + Intergenic
951580120 3:24153759-24153781 CCAAACAATCAAAATGAGGCAGG + Intronic
951596237 3:24321165-24321187 CTACACATTGAGATGGAGACTGG - Intronic
951862939 3:27274086-27274108 CTAAACAAAGAGTAGGCGGCAGG + Intronic
952578053 3:34798532-34798554 ATAAACAATGAGAGAGAGGAAGG + Intergenic
952767693 3:36969365-36969387 CTAATGAAAGAAAAGGAGGCTGG + Intergenic
953977179 3:47390646-47390668 CTAAAAAAGAAGAAAGAGGCTGG - Intronic
954356736 3:50088299-50088321 CTAAAAAATAAAAAGGAGGCCGG - Intronic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
954895713 3:53973168-53973190 ATAAAGAATAAGAAGGAAGCTGG - Intergenic
955250303 3:57275152-57275174 CAAAACTATTAAAAGGAGGCTGG + Intronic
955310136 3:57878137-57878159 CTAAAATTTAAGAAGGAGGCCGG - Intronic
956011165 3:64833164-64833186 CTATAGAATGAGAATTAGGCAGG + Intergenic
956107539 3:65836522-65836544 CTAAAGAAAGGGAAAGAGGCCGG + Intronic
956342868 3:68246292-68246314 CTATAAATTGAGAAGGTGGCCGG + Intronic
957136979 3:76300945-76300967 CTAAGCAATGGGAAGGAGATGGG + Intronic
957842853 3:85693589-85693611 AGAAAAAATCAGAAGGAGGCTGG + Intronic
958053809 3:88383956-88383978 CTAAAGAATAAGAAGAAGCCCGG - Intergenic
959296063 3:104535666-104535688 CTAAACAAAAAGAACAAGGCTGG + Intergenic
961797938 3:129423329-129423351 CTAAAAAATCAGAAGGGGCCAGG + Intronic
963070925 3:141304540-141304562 CTCAACACTGTGAAGGATGCTGG - Intergenic
963197178 3:142545335-142545357 CTAAAGAATGAGAAAGATCCAGG + Intronic
963349285 3:144132987-144133009 ATGAACAAAGAAAAGGAGGCTGG - Intergenic
963366083 3:144336432-144336454 CTTAAAAATTAGAAAGAGGCTGG + Intergenic
963783599 3:149511047-149511069 CTCTACAAAAAGAAGGAGGCTGG - Intergenic
963810532 3:149772315-149772337 TGAAAAAATGAGAAGGATGCCGG - Intronic
963839835 3:150093968-150093990 CTAAACTTTGTGAATGAGGCTGG + Intergenic
964230997 3:154467863-154467885 CTAAATGATGAGAAGCAGCCAGG - Intergenic
964826050 3:160829194-160829216 CTAAACAAAAACAAGGAGGAGGG - Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
966195071 3:177304953-177304975 CTTAAAGATCAGAAGGAGGCCGG - Intergenic
967149555 3:186636259-186636281 CTAAAAGATAAGAAGGGGGCAGG - Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968803865 4:2760078-2760100 CTAAAGGGTGAGAAGGAGCCAGG + Intergenic
969033132 4:4229076-4229098 CTAAAGAATGTGCAGGAGGCTGG - Intergenic
969095985 4:4733312-4733334 CTAAAGAATGGGAAGGATCCAGG - Intergenic
969227316 4:5807490-5807512 CTAAAAGATGGGAAGGAGGCAGG + Intronic
969430724 4:7152458-7152480 CTAAAGAATGAGGTGGTGGCCGG - Intergenic
970127904 4:12834908-12834930 GAAAATTATGAGAAGGAGGCCGG - Intergenic
970638694 4:18039071-18039093 GTAAACAAAGAGAAGGAGATTGG - Intergenic
971863194 4:32136224-32136246 CTGAAGGATGAGAAGGAGCCAGG + Intergenic
973088796 4:46105146-46105168 ACAAACAAAGAGAAGGAAGCTGG + Intronic
973859778 4:55051713-55051735 CTAAACAATTAGAAGGAGGAAGG + Intergenic
977428797 4:96904561-96904583 CTAAACATGGAGAGGGAGGGAGG + Intergenic
978532423 4:109729021-109729043 ACCAACAATGAGGAGGAGGCGGG + Intronic
980662192 4:135876396-135876418 CTAAAGGATGAGAAGGAGTCAGG + Intergenic
980794560 4:137664083-137664105 CTAAACAATGAGAAGGAAGTAGG - Intergenic
981046667 4:140271108-140271130 TGAAGCAATGAGAAGGAGGAGGG + Intronic
982313806 4:154011071-154011093 CTAAACAATGATAACACGGCCGG + Intergenic
982794776 4:159631345-159631367 CTAAACAAAGAGATAGAGGTAGG + Intergenic
983180832 4:164646512-164646534 ATAAACAATGGGATGGAGGTTGG + Intergenic
983631561 4:169854444-169854466 CTCAGTAATGAGAAGGCGGCAGG + Intergenic
984420136 4:179511325-179511347 ATAAACAATTAAGAGGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984963439 4:185120363-185120385 CTAAAGAATGTAAAGGAGGTTGG - Intergenic
985730056 5:1542602-1542624 CTACTCAAGGAGAATGAGGCAGG + Intergenic
985969154 5:3361796-3361818 CTAAAGAATGAGAGGAAGGCAGG + Intergenic
986004772 5:3658445-3658467 AAAAACAAAGAGAAGGGGGCTGG - Intergenic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
988043691 5:25920232-25920254 CTAAACAAAAAGAACGAAGCTGG + Intergenic
989706116 5:44332882-44332904 CAAGAGAATGAGAAGGAGACGGG + Intronic
991230004 5:64321714-64321736 CTAAGCAAAAAGAAGAAGGCTGG + Intronic
991607124 5:68413812-68413834 GTAAACAATCGGAAGGAGGAAGG + Intergenic
992450372 5:76870823-76870845 TTAAAAAATGAGGAGGAGGCTGG + Intronic
992587905 5:78260289-78260311 CTAAAGAATGAGGAGGGGCCGGG + Intronic
992662030 5:78971267-78971289 CTAAGCCAGGACAAGGAGGCAGG - Intronic
992719255 5:79543667-79543689 ATAAAGAATGAGAAACAGGCTGG - Intergenic
993220751 5:85093724-85093746 CTAAACAAAGAGAACAAAGCTGG + Intergenic
993337296 5:86676688-86676710 GTAAAAAATGAAGAGGAGGCTGG + Intergenic
994408033 5:99370493-99370515 CTACACAGTGTGAAGGAAGCAGG - Intergenic
994503546 5:100610513-100610535 CTAAACAAAAAGAACGAAGCTGG - Intergenic
994628393 5:102250691-102250713 TTAAAAAATGAGTAAGAGGCTGG + Intronic
994661331 5:102657948-102657970 CTAAAGCATGAGAAATAGGCAGG + Intergenic
995240517 5:109881147-109881169 ATAAACACTGAGCAGGAAGCAGG - Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997823192 5:137084275-137084297 CTTAGCAAGCAGAAGGAGGCAGG - Intronic
998017263 5:138742302-138742324 CTCAGGAATGAGAAGGAGCCAGG + Intronic
998040438 5:138948003-138948025 CTGAACCATGACAAGCAGGCAGG + Intronic
999028253 5:148259900-148259922 ATAAACAATTATAAGGAGGTTGG - Intergenic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999408850 5:151332160-151332182 CTTAAAAATGAGATGGAGCCGGG - Intronic
1000442172 5:161277014-161277036 TTAAACATTGAAAAGGAGGTTGG - Intergenic
1000788528 5:165576147-165576169 TCAAACAATTAGTAGGAGGCTGG + Intergenic
1001474592 5:172041438-172041460 CTAGAAAATGAGAATGAGCCTGG + Intergenic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1002459981 5:179368526-179368548 CTCAACCTTGAGAATGAGGCTGG - Intergenic
1002792277 6:445337-445359 GTAAACAAGCAGAGGGAGGCAGG + Intergenic
1003253586 6:4455074-4455096 CAAAACAGTAGGAAGGAGGCTGG - Intergenic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1005233226 6:23729020-23729042 CCAAACAATGGGAAGGATGAAGG + Intergenic
1006153865 6:32003677-32003699 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1006160173 6:32036414-32036436 CTGAAGACTGAGAAGGAGCCAGG + Intergenic
1007271423 6:40640436-40640458 AGAAAGAATGAGAAGGAGGGAGG - Intergenic
1008413145 6:51206842-51206864 TTAAAAAATGAAAGGGAGGCTGG + Intergenic
1008810688 6:55494031-55494053 CTAAAGAATGAGAAGGGGCCAGG - Intronic
1008876226 6:56331720-56331742 CTAAACAAAAAGAATAAGGCTGG - Intronic
1010812032 6:80311868-80311890 CTAAACAAAAAGAACAAGGCTGG - Intronic
1011620960 6:89242141-89242163 ATCAACAATGAGAAATAGGCCGG - Intergenic
1012433094 6:99186667-99186689 GAACACAATGTGAAGGAGGCAGG + Intergenic
1012596520 6:101047615-101047637 CCAAGCAATAAGAACGAGGCTGG - Intergenic
1013314024 6:108924219-108924241 TTGAAAAATGAGCAGGAGGCCGG + Intronic
1013425577 6:110009682-110009704 CTAAACATAGAGAGGAAGGCTGG - Intergenic
1014019687 6:116572763-116572785 CTAAACAATGAAAGGGAGAGGGG - Intronic
1015091503 6:129364234-129364256 GTAAACAAAGAGAAGGAGGACGG - Intronic
1015964393 6:138683536-138683558 CTAAACAAAGAGAAGGAAAAGGG + Intronic
1017162702 6:151380795-151380817 CTACAGAATGAGGAGTAGGCTGG - Intronic
1017288449 6:152706054-152706076 CTAAAAAAAGAGAAGGACCCTGG + Intronic
1019883465 7:3883705-3883727 CTAGACAATGGGAGGGAGGGAGG - Intronic
1021726151 7:23549883-23549905 ATAAAGAAAAAGAAGGAGGCCGG - Intergenic
1022162628 7:27726936-27726958 CCAAAAAAAGAGAGGGAGGCAGG + Intergenic
1022166232 7:27765530-27765552 CTTTACAATGGGAAAGAGGCTGG - Intronic
1022215906 7:28261276-28261298 CTAAACATTGAGAAGGACTCAGG - Intergenic
1023296584 7:38721311-38721333 AGAATCAATTAGAAGGAGGCAGG - Intergenic
1024022775 7:45386795-45386817 CTAAGCAATGAGGAGGACCCTGG - Intergenic
1024188847 7:46984670-46984692 TTATAAAATAAGAAGGAGGCAGG + Intergenic
1026296793 7:69059916-69059938 CTACACACTGAGATGGGGGCTGG - Intergenic
1026715787 7:72788273-72788295 ATTAAGAATGACAAGGAGGCCGG - Intronic
1029710370 7:102295925-102295947 CTGAACAATGAGTTGGGGGCAGG - Intronic
1030327911 7:108240969-108240991 ATAAACAAAGACAAGAAGGCAGG - Intronic
1030768406 7:113441376-113441398 ATAAGGAGTGAGAAGGAGGCAGG - Intergenic
1031350816 7:120728584-120728606 CAAAAACATAAGAAGGAGGCTGG - Intronic
1031939554 7:127773469-127773491 CTTATTAATGAGAAGGAGTCAGG + Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032931089 7:136671846-136671868 CTATACAATGAGAAAGAGAAAGG - Intergenic
1033957423 7:146868458-146868480 CTAAACAAAAAGAATAAGGCTGG - Intronic
1034286974 7:149891523-149891545 CTTAACAATGACACGGAGGCAGG + Intergenic
1034664146 7:152801377-152801399 CTTAACAATGACACGGAGGCAGG - Intronic
1035183650 7:157109088-157109110 CTAAGGAGTGAAAAGGAGGCTGG + Intergenic
1035207607 7:157304367-157304389 CTAAAATATGAAAAGCAGGCCGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036708436 8:11061768-11061790 CCAAAGAATGAGAAGAAGGAAGG + Intronic
1037450161 8:19008845-19008867 TGAAACAATGAGGAGGAGGATGG - Intronic
1038579894 8:28738890-28738912 GCAGACAAAGAGAAGGAGGCAGG - Intronic
1039162356 8:34636681-34636703 CTAAACATTGTGAAAGAGGATGG - Intergenic
1040491058 8:47922604-47922626 CTTAAAAATGAAAAGCAGGCTGG - Intronic
1040674609 8:49733707-49733729 ATAAACAATTATAAGGAGGCTGG + Intergenic
1041523067 8:58776264-58776286 CTAAACAAAAAGAACAAGGCTGG + Intergenic
1041847858 8:62352222-62352244 CTCAGCAATGGGAAGGAGTCAGG - Intronic
1042119430 8:65469002-65469024 TTAAAAAATTGGAAGGAGGCAGG + Intergenic
1042922186 8:73930961-73930983 CAAACCAATGAGAAAGAGACAGG + Intergenic
1043387626 8:79764150-79764172 TAAATCAAAGAGAAGGAGGCAGG + Exonic
1044315420 8:90745020-90745042 CTAAGCAAAAAGAAAGAGGCTGG - Intronic
1045755701 8:105538713-105538735 TAAAACAATGAGATGGAGGCTGG + Intronic
1047584054 8:126249777-126249799 CTAGACAATGAGGAGGATGGTGG + Intergenic
1047948846 8:129910952-129910974 CAAAACAATGGGAGAGAGGCCGG - Intronic
1048977509 8:139681246-139681268 TCACACAATGAGAAAGAGGCAGG + Intronic
1049126612 8:140794955-140794977 CTGAACAATGGGAAGTATGCAGG - Intronic
1050756341 9:9008520-9008542 CTAAATAATGAAGGGGAGGCCGG - Intronic
1051026888 9:12623796-12623818 CTAGAAAATGGGAAGGAGTCAGG - Intergenic
1051131009 9:13861056-13861078 GTTTGCAATGAGAAGGAGGCAGG - Intergenic
1051959937 9:22747226-22747248 CTAAACATTTAGAGGGAGGGAGG - Intergenic
1052013914 9:23443273-23443295 CTAAAAAATAAGAAACAGGCAGG + Intergenic
1052064286 9:23997624-23997646 TTGAACAATGAGAACAAGGCAGG + Intergenic
1053144999 9:35706209-35706231 CTATACACTGCCAAGGAGGCTGG - Exonic
1056310997 9:85340935-85340957 CTAAACCTTGAGAAGAAGTCTGG + Intergenic
1057026532 9:91738230-91738252 GGAAACTATGAGAAGGAGGGCGG + Intronic
1057506714 9:95640070-95640092 CTCAAGAATGGGAAGGAGTCAGG + Intergenic
1058588644 9:106537380-106537402 CTAATAAATGAGAAGTAGACTGG + Intergenic
1058815201 9:108676456-108676478 TAAAACAATGAAAATGAGGCCGG - Intergenic
1058948646 9:109882384-109882406 CTAAACATTGTGAAGGAAACTGG + Intronic
1060250467 9:121982891-121982913 GTAGACCATGAGAAGGAGCCAGG + Intronic
1060707301 9:125815848-125815870 ATCTACAATGAGAAGGAGGTAGG - Intronic
1060752373 9:126181767-126181789 CTGAACAATGGAAAGAAGGCTGG - Intergenic
1061223299 9:129265043-129265065 ATAAATAAATAGAAGGAGGCTGG - Intergenic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061674041 9:132205582-132205604 CTTAACAATGGTAAGGTGGCTGG + Intronic
1062137764 9:134938690-134938712 CCACACAATGAGGACGAGGCCGG + Intergenic
1186920837 X:14278196-14278218 CTGAACAAAGAGAACGAAGCTGG + Intergenic
1188696565 X:33199446-33199468 AAAAACAATGAGAAGGAAGCAGG + Intronic
1189033631 X:37474466-37474488 GCAAACAAGGATAAGGAGGCTGG + Intronic
1190545322 X:51519638-51519660 CTAAACAATGAGCAGGATGGTGG - Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191824779 X:65353106-65353128 CTGAGCACTAAGAAGGAGGCCGG - Intergenic
1192756627 X:74052750-74052772 GTAAACAATGAAATGAAGGCAGG + Intergenic
1193003292 X:76587039-76587061 CTAAACAAAGAGAACAAAGCTGG - Intergenic
1193347366 X:80420009-80420031 TTAAACAATTAAAAAGAGGCTGG - Intronic
1194661721 X:96635147-96635169 GTTAAAAATGAGAAGCAGGCAGG - Intergenic
1194837889 X:98703797-98703819 CTGAACAAAAAGAACGAGGCTGG - Intergenic
1194867839 X:99090552-99090574 CTAAACAAAGAGAACAAAGCTGG + Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195641174 X:107176217-107176239 GTAAACAATTAAGAGGAGGCAGG + Intronic
1195693277 X:107646890-107646912 CTGAACTATGTGAGGGAGGCTGG + Intronic
1197679564 X:129367774-129367796 CTAACTAATGAGGAAGAGGCAGG + Intergenic
1197858323 X:130942695-130942717 TAAAACAATGCAAAGGAGGCAGG - Intergenic
1198221747 X:134608968-134608990 CTAAAAAAAGAAAAAGAGGCCGG - Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201484562 Y:14478689-14478711 ATAAAAAATGTGAATGAGGCCGG + Intergenic