ID: 914732830

View in Genome Browser
Species Human (GRCh38)
Location 1:150387366-150387388
Sequence GTGTGTTAGGGAAAGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 544}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914732822_914732830 29 Left 914732822 1:150387314-150387336 CCAATGAAAGAACCTTGGGAGCA 0: 1
1: 0
2: 2
3: 14
4: 158
Right 914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG 0: 1
1: 0
2: 5
3: 61
4: 544
914732825_914732830 6 Left 914732825 1:150387337-150387359 CCAGAGTTTCAAGGTTAGTGCAA 0: 1
1: 0
2: 0
3: 23
4: 291
Right 914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG 0: 1
1: 0
2: 5
3: 61
4: 544
914732823_914732830 17 Left 914732823 1:150387326-150387348 CCTTGGGAGCACCAGAGTTTCAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG 0: 1
1: 0
2: 5
3: 61
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914732830 Original CRISPR GTGTGTTAGGGAAAGGAGAG AGG Intronic
900315123 1:2052478-2052500 GTGTGGCAGGGAAGGGAGAGAGG - Intronic
902177627 1:14662727-14662749 GTGTGTTGGGGAAGGGAGGGAGG + Intronic
902300738 1:15500883-15500905 GGGTGTGGGGGAAAGGAAAGAGG + Intronic
902557509 1:17255626-17255648 GTGTGTTAGGAGAATGAGAGGGG - Intronic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
902860769 1:19243851-19243873 GTCTGGTAGGGAAAGGAGACTGG - Intronic
903313625 1:22481995-22482017 GTGTTTTATGGAAAGAGGAGGGG - Intronic
903458960 1:23507691-23507713 GTGTGAAAGGGACAGTAGAGGGG + Exonic
903569302 1:24292619-24292641 GTGATTTAAGGAAAAGAGAGGGG - Intergenic
904104720 1:28069592-28069614 GGGTGGGAGGGAAAGGAGAAAGG + Intronic
904163586 1:28538409-28538431 GACTGTTAGGGACAGGAAAGGGG - Intronic
904271426 1:29352900-29352922 TTGTGCTGGGGAAAGGAGAGGGG + Intergenic
904371694 1:30051805-30051827 GTGTGTTAGGGTAGACAGAGGGG + Intergenic
904806127 1:33133673-33133695 GGGTGTTAGGGCAAGGGCAGTGG + Intergenic
905005985 1:34710890-34710912 GTTGGTTAAGGGAAGGAGAGAGG - Intergenic
906037302 1:42759437-42759459 GTGGCTGAGGGCAAGGAGAGAGG - Intronic
906187528 1:43872297-43872319 GTGTGTTGGGGAGAGGTGAGAGG + Intronic
906457964 1:46013861-46013883 GTGTGTTGGGAACAGGAGACAGG + Intronic
906642912 1:47452261-47452283 GTGTGGTGGGGAAGGGGGAGTGG + Intergenic
907484545 1:54768161-54768183 GTGTGTTGGGGGGAAGAGAGGGG - Intergenic
907815052 1:57910565-57910587 AAGTGTTAGGGAAAGGTCAGGGG + Intronic
908953528 1:69592157-69592179 GTGTGTGAGGGAGGGGAAAGAGG - Intronic
909113416 1:71506640-71506662 GTTTCCTATGGAAAGGAGAGGGG + Intronic
909196727 1:72636176-72636198 GTAGGTTAGGGAAATGAGGGAGG - Intergenic
909335682 1:74470583-74470605 TTGTGTTTGGGGAATGAGAGAGG + Exonic
910069219 1:83191116-83191138 GTGTGTGAGGCAAGGGAGATGGG + Intergenic
910158061 1:84242772-84242794 GCGTGTTTGGGGAGGGAGAGTGG - Intergenic
910721444 1:90290943-90290965 TTGATTTAGGGAAAGGAGATAGG + Intergenic
911567919 1:99485999-99486021 GTGTTTTGGGGAAGAGAGAGTGG + Intergenic
911884927 1:103286417-103286439 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
912071457 1:105815818-105815840 GTGGGGTGGGGAGAGGAGAGAGG - Intergenic
912728838 1:112083360-112083382 GTGTGATAGGGGAGAGAGAGTGG - Intergenic
912801717 1:112723567-112723589 GAGTGTTAGGGTAATGAGTGTGG - Intronic
912989253 1:114467873-114467895 TTTTCTAAGGGAAAGGAGAGTGG - Intronic
913147607 1:116007578-116007600 GTCTGGTAGGTATAGGAGAGAGG + Intronic
913392199 1:118326664-118326686 TGGAGTTAGGGAAGGGAGAGAGG + Intergenic
913529763 1:119725388-119725410 GGATGTGAGGGAGAGGAGAGAGG + Intronic
913687142 1:121243109-121243131 GTGTGTTGGGGATGGGGGAGGGG + Intronic
913695290 1:121318848-121318870 GTCCCTTAGGGAAAGGACAGTGG + Intronic
914039000 1:144030747-144030769 GTGTGTTGGGGATGGGGGAGGGG + Intergenic
914142274 1:144961212-144961234 GTCCCTTAGGGAAAGGACAGTGG - Intronic
914150453 1:145037180-145037202 GTGTGTTGGGGATGGGGGAGGGG - Intronic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914732830 1:150387366-150387388 GTGTGTTAGGGAAAGGAGAGAGG + Intronic
914841104 1:151249390-151249412 GGGTCTTAGGGAAAGGAATGGGG + Intronic
915440957 1:155945168-155945190 GTGGGTTAGGGAGGGGACAGGGG + Intergenic
915737761 1:158095400-158095422 GAAGGTTAGGGAAAGCAGAGGGG + Exonic
915953336 1:160204822-160204844 GCATGTTTGGGAAAGGTGAGAGG + Intergenic
916001720 1:160623031-160623053 GTGTGTTGGGGAAGGTAGTGGGG + Intronic
916511386 1:165474982-165475004 GTGGGAGAGGGAAGGGAGAGAGG + Intergenic
916764894 1:167850703-167850725 GTGTGTTGGGAGTAGGAGAGTGG + Intronic
916801827 1:168223102-168223124 GTGTGTTAGGGGAAGGGAAAGGG + Intergenic
917525673 1:175786305-175786327 GTGTGTCATGGGAAGAAGAGAGG - Intergenic
917762612 1:178179495-178179517 GAGGGTAAGAGAAAGGAGAGAGG + Intronic
919468498 1:197950498-197950520 GTGTGGTGGGGACAGTAGAGTGG - Intergenic
919540236 1:198836491-198836513 TAGTGTGAGGGAAAGCAGAGCGG - Intergenic
919598063 1:199589295-199589317 GAGTGTTAAGGAAATGAGAAAGG - Intergenic
919645522 1:200090842-200090864 GTGTGTTAGGGAGGGGGCAGAGG - Intronic
919658987 1:200224649-200224671 GTGTGTTAGGAACAGAAGAATGG - Intergenic
920457034 1:206109346-206109368 GTGGGTTGGGGAAAGGAGGGAGG + Intergenic
920474470 1:206261630-206261652 GTGTGTTGGGGATGGGGGAGGGG + Intronic
920482621 1:206337227-206337249 GTCCCTTAGGGAAAGGACAGTGG + Intronic
921517030 1:216106588-216106610 GGGTGTTGGGGAATGGAGAGTGG - Intronic
921833459 1:219753444-219753466 GAGGATGAGGGAAAGGAGAGTGG + Intronic
922680850 1:227594041-227594063 GTTTTTGAGGGAAAGGAAAGTGG + Intronic
922690088 1:227682072-227682094 GTTTTTGAGGGAAAGGAAAGTGG - Intergenic
923871268 1:237996497-237996519 GTGTGTTTGGGGAATGGGAGGGG + Intergenic
923935738 1:238758118-238758140 GTGTGTTAGTTACAGGAGAAAGG - Intergenic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
924121139 1:240799464-240799486 GGGTGTTAGGGTGAGGAGGGAGG - Intronic
1063090073 10:2857074-2857096 GGGAGGGAGGGAAAGGAGAGAGG + Intergenic
1063791326 10:9451526-9451548 GCGTGCCAGGGAAAGGAGAGTGG - Intergenic
1063972922 10:11393952-11393974 GGGGGAGAGGGAAAGGAGAGAGG - Intergenic
1064000831 10:11662607-11662629 GTGTGTTGGGGGCAGGAGGGAGG - Intergenic
1064320440 10:14299585-14299607 GTGTGCTGGGGAATGGAGATTGG - Intronic
1064513245 10:16118180-16118202 CAGTGTGAGGGAAAGGTGAGAGG - Intergenic
1065160811 10:22919343-22919365 GTAGATTATGGAAAGGAGAGAGG - Intergenic
1065443990 10:25778794-25778816 GTGTTGTAGTGAAATGAGAGTGG + Intergenic
1065540852 10:26765643-26765665 GGGAGGAAGGGAAAGGAGAGAGG + Intronic
1065930932 10:30478538-30478560 GTTTTTGAGGGAAAGGAAAGTGG - Intergenic
1066378959 10:34885192-34885214 GTGTGGGAGGTGAAGGAGAGAGG + Intergenic
1067261419 10:44696202-44696224 GTGTGTGAGAGATTGGAGAGAGG + Intergenic
1067553105 10:47248771-47248793 GTGAGCCAGGGAGAGGAGAGAGG + Intergenic
1068382601 10:56276302-56276324 GTGGGGTAGGGAGAGGAGGGAGG + Intergenic
1068601867 10:58965216-58965238 GTGGTTTAGTGAAAGGAGGGTGG - Intergenic
1070056681 10:72941836-72941858 GTGTGTGTTGGAAAGTAGAGTGG + Intronic
1070864624 10:79700457-79700479 GTGAGCAAGGGAAAGGAGCGCGG + Intergenic
1070878414 10:79838587-79838609 GTGAGCAAGGGAAAGGAGCGCGG + Intergenic
1070965555 10:80528289-80528311 GTGTGTAGGAGAAAGAAGAGAGG + Exonic
1070985506 10:80686566-80686588 CTGTGTTAGGGAAAGCATATAGG + Intergenic
1071550606 10:86563666-86563688 GTTTTTTAGGGAATGGAAAGGGG + Intergenic
1071631527 10:87222686-87222708 GTGAGCAAGGGAAAGGAGTGCGG + Intergenic
1071644969 10:87354898-87354920 GTGAGCAAGGGAAAGGAGCGTGG + Intergenic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072474818 10:95750205-95750227 GTGTCTGTGGGAAAGGAGCGGGG + Intronic
1072813957 10:98486543-98486565 GTGAGTCAGGGAAAGGAGGCTGG + Intronic
1073376468 10:103039713-103039735 GTGTGTTAGGGCAGTGAGTGAGG + Intronic
1073488438 10:103836925-103836947 GTGTCTAAGGAAACGGAGAGGGG - Intronic
1073589250 10:104740732-104740754 GTGTGTCAAGGCAAGGAAAGTGG + Intronic
1073663955 10:105509132-105509154 GTGTGTTAGGGGAAAAAGAAGGG + Intergenic
1073853886 10:107653123-107653145 GTGTGTTTGTGCTAGGAGAGGGG + Intergenic
1074358086 10:112803493-112803515 GTGTGATAGTGAAACAAGAGTGG + Intronic
1075241524 10:120783363-120783385 GTGTGTTGGGGACAGTAAAGAGG + Intergenic
1075478797 10:122761233-122761255 ATGTGGTAGAGAAGGGAGAGTGG + Intergenic
1075875066 10:125799405-125799427 GTGTGTTGGGGAATGCAGGGTGG + Intronic
1075968619 10:126633741-126633763 GCGTGTTGGGGGAAGCAGAGAGG - Intronic
1076087855 10:127650905-127650927 GTATGTTTAGGAAAGGAGAGAGG + Intergenic
1077512746 11:2978540-2978562 TTATGTTTGGGAGAGGAGAGGGG - Intronic
1078403054 11:11044874-11044896 AGGTGTTGGGGACAGGAGAGTGG - Intergenic
1078406939 11:11078654-11078676 GTGTTTTAGGCAGAGTAGAGTGG - Intergenic
1078609605 11:12809010-12809032 TTGTGTTAAGGAAAGGAATGAGG + Intronic
1078702411 11:13699100-13699122 GTGTGTTAGGGACAAAAGTGAGG - Intronic
1079026508 11:16952269-16952291 GTGTGTTAAGGAAGTGAGAGGGG + Intronic
1079222241 11:18573381-18573403 GGGTATTAGGGAAAGGAGGAAGG - Intronic
1080850712 11:36067083-36067105 GTGTGTTAGTGAAAAAAAAGAGG - Intronic
1080943350 11:36944013-36944035 GTGTGTGAAAGGAAGGAGAGGGG + Intergenic
1081365648 11:42231864-42231886 TTATTTTAAGGAAAGGAGAGAGG + Intergenic
1081398435 11:42614504-42614526 GTGTGTTGGGGAAAACGGAGGGG - Intergenic
1081460554 11:43268924-43268946 GTGAATTAGGGAAAGGGGAAAGG + Intergenic
1081750382 11:45506324-45506346 CTGTGGTAGGGTCAGGAGAGAGG - Intergenic
1082202728 11:49392364-49392386 TTGTGTTAGGGAACTGACAGAGG - Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083454536 11:62769899-62769921 GTGCGTTAAGGGAAAGAGAGAGG - Intergenic
1083635600 11:64119207-64119229 GTGTGTTGGGGATGGGAGTGAGG + Intronic
1084142305 11:67240708-67240730 GGGGGTTTGGGATAGGAGAGCGG - Intronic
1084690608 11:70723587-70723609 GTGTCTTTGGGTTAGGAGAGAGG - Intronic
1085144233 11:74178488-74178510 TTCTGTTAGGGAAGAGAGAGTGG + Intronic
1085179373 11:74520663-74520685 GTGTGTCAGGGAGAGGGGAGAGG + Intronic
1085553245 11:77394975-77394997 GAGTGTAAGGGAAATTAGAGTGG - Intronic
1085786418 11:79455334-79455356 AGGTGTTAGGGAAAGAACAGAGG + Intergenic
1086383174 11:86280402-86280424 GTATTTCAGGGAAAGGAGAGAGG - Intergenic
1086452929 11:86934817-86934839 GAGGATTTGGGAAAGGAGAGAGG + Intronic
1086652307 11:89307712-89307734 TTGTGTTAGGGAACTGACAGAGG + Intergenic
1087651991 11:100878541-100878563 GTGGGTGAGGGAAAGGAAAGTGG + Intronic
1089061619 11:115630524-115630546 GTGTTTGATTGAAAGGAGAGGGG + Intergenic
1089118513 11:116114962-116114984 GTGTGTTGGGGGATGGGGAGGGG - Intergenic
1089221012 11:116871670-116871692 CTGAGTTAAGGAAAGGAAAGTGG + Intronic
1089760688 11:120720837-120720859 GTGTGTGATGGAAAGGTTAGAGG + Intronic
1090472569 11:126993298-126993320 CTGTGTTAGGGAAGTGGGAGAGG - Intronic
1091011399 11:132004138-132004160 GTGTGTCAGGGGAATGAGGGGGG + Intronic
1091027031 11:132150522-132150544 GTATATTGTGGAAAGGAGAGTGG + Intronic
1091774298 12:3174443-3174465 GTGTGTTAGAAAATGAAGAGAGG + Intronic
1093096049 12:14973485-14973507 GAGTGTGAGGAAAAGGAGAAGGG + Intronic
1093207975 12:16273394-16273416 GAGTGTGAGTGGAAGGAGAGGGG + Intronic
1093319204 12:17691841-17691863 GTGTGGTAGGGGGAGGAGGGAGG + Intergenic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1093833672 12:23799091-23799113 GTGTGTGGGGAAGAGGAGAGTGG - Intronic
1094311412 12:29087426-29087448 GTGTGTCAGGGCTAGGGGAGGGG - Intergenic
1095233007 12:39764284-39764306 ATGTGTCTGGGAAAGAAGAGAGG - Intronic
1095395762 12:41760777-41760799 GTGTTTAAGAGAAAGGAGACTGG - Intergenic
1096207645 12:49736868-49736890 GTTTTTGAGGGAAAGGAAAGTGG - Intronic
1096608619 12:52786296-52786318 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
1098819266 12:75208369-75208391 GTGTGTTTGGGGAGGCAGAGAGG - Intronic
1099566622 12:84256780-84256802 GTGTGTGAGGGTAGGGGGAGTGG + Intergenic
1100010870 12:89951716-89951738 GATGGATAGGGAAAGGAGAGAGG + Intergenic
1102212838 12:111139328-111139350 GTTTGGGAGAGAAAGGAGAGGGG + Intronic
1102394176 12:112573980-112574002 GTGTGGTGGGGCAGGGAGAGGGG + Intronic
1102766500 12:115438159-115438181 GTGTTTTAGGGACTGGAGATAGG + Intergenic
1103452179 12:121036933-121036955 GTGGGTTTGAGAAAGAAGAGTGG + Intronic
1103739520 12:123081851-123081873 GTGGGTCTGGGACAGGAGAGGGG - Intronic
1104190641 12:126479294-126479316 GTGTGTTAAGGAACAGAAAGGGG + Intergenic
1104627119 12:130366541-130366563 GTGTGGTAGGCCAAGGAGTGTGG + Intronic
1105252431 13:18711597-18711619 TTGATTTAGGGAAAGGAGATAGG - Intergenic
1105699529 13:22926180-22926202 ATGTCTTAGGGACGGGAGAGGGG + Intergenic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1107556143 13:41518089-41518111 GTGTGTAGGGGGCAGGAGAGAGG + Intergenic
1107733909 13:43375878-43375900 CTGTGTTAGGAAGAGGAGAAAGG - Intronic
1107767847 13:43756497-43756519 GGGAGAGAGGGAAAGGAGAGGGG + Intronic
1108229870 13:48325539-48325561 GTGGCTTAGGGAAAGGAATGAGG - Intronic
1109776859 13:67052303-67052325 AGGGGTTAGGGAAAGGAAAGGGG + Intronic
1110622509 13:77613552-77613574 GGGTGTTGGGGAAAGGAGTGTGG + Intronic
1110627380 13:77666478-77666500 GTAGGATAGGGATAGGAGAGTGG - Intergenic
1111652964 13:91115858-91115880 AAGTGTTAGGGAAACAAGAGTGG + Intergenic
1111912561 13:94328714-94328736 GTATTTCAGGGAAAGGAAAGGGG + Intronic
1112787256 13:102964862-102964884 ATGTGTGAGGGAGAGGGGAGGGG - Intergenic
1113394922 13:109938413-109938435 GTGTGTGAGTTACAGGAGAGAGG - Intergenic
1114840106 14:26253163-26253185 GTGTGTTTGAGAAAGGGGAGGGG - Intergenic
1114927233 14:27419319-27419341 GTGTGTTGGGGAATGGTGACAGG + Intergenic
1115776873 14:36724816-36724838 GTGTAGTGGGGAAAGGAGTGAGG + Intronic
1115804756 14:37038393-37038415 CTGAGTTTGGGAAAGGGGAGAGG - Intronic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1117155990 14:52942187-52942209 TTGTGTTATGCAAATGAGAGTGG - Intronic
1118073407 14:62271158-62271180 GGGAGTAAGGAAAAGGAGAGAGG - Intergenic
1118081479 14:62366700-62366722 TTTTGTTAGGGTCAGGAGAGTGG + Intergenic
1118390678 14:65292956-65292978 GTGGGTTAGGGAACTGAGAAGGG - Intergenic
1118474235 14:66102022-66102044 ATGTGATAGGGACAGGAGACAGG + Intergenic
1118992987 14:70812364-70812386 GTGTGTTCAGGAAAGGAGGGTGG + Intergenic
1119044953 14:71310271-71310293 GTGTGTTAGGGACAGAAGAGGGG + Intergenic
1119208642 14:72812975-72812997 GTGTGTCTGGGAAACCAGAGGGG - Intronic
1119474298 14:74918313-74918335 GCGTGTTAGGGATGGGGGAGAGG + Intronic
1119487930 14:75003873-75003895 GTCTGTAAGGAAAAGTAGAGAGG - Intronic
1119586727 14:75842711-75842733 GGGGGTTGGGGAAAGGAGGGAGG + Intronic
1119685533 14:76628033-76628055 GGGGGTTAGGAGAAGGAGAGAGG - Intergenic
1119710297 14:76817296-76817318 GTCAGTGAAGGAAAGGAGAGGGG - Intronic
1119716894 14:76866128-76866150 GTGTGTCAGAGAGAGGGGAGAGG + Intronic
1119744335 14:77033508-77033530 GGGTGGAAGGAAAAGGAGAGCGG + Intergenic
1119854733 14:77891049-77891071 GTGTGTGGGGCAGAGGAGAGGGG + Intronic
1121343396 14:93117946-93117968 GTGTGTTTGCCAAAGGAGTGAGG - Intergenic
1121496186 14:94392675-94392697 GTGTGTTGGGGAGGGGAGGGGGG + Intergenic
1121775920 14:96590784-96590806 GGGTGTGGGGGAAAGGAGAAGGG + Intergenic
1122561991 14:102622373-102622395 GTGGGTGAGGGTAGGGAGAGTGG - Intronic
1124134052 15:27018564-27018586 GGGTGTTTGGGAAAGGAGTGAGG + Intronic
1125124758 15:36207241-36207263 GTGTTTTAGGGAAAGAAGTCTGG - Intergenic
1126123328 15:45272798-45272820 GTGTGTGAGAGAAAGGAATGGGG - Intronic
1127008272 15:54594782-54594804 GTGTGTTCGGGAAAGGATGTTGG + Intronic
1127225217 15:56919823-56919845 GTGTGTGAGGGAACAGAGAGAGG - Intronic
1128385664 15:67146550-67146572 GTGTGTTCGGGGATGGGGAGCGG + Intronic
1128540706 15:68528775-68528797 GTGTTTTGGGGATAGGAAAGGGG + Intergenic
1128703152 15:69819012-69819034 CTTTGATAGGGAAAGTAGAGAGG - Intergenic
1128748467 15:70131693-70131715 GTGTCTCAGGGCCAGGAGAGGGG + Intergenic
1130010582 15:80150690-80150712 GTATTTTAGGGAAAGGACATGGG - Intergenic
1130674382 15:85939187-85939209 GGGTGTTAGGGAAAGCAGCTTGG + Intergenic
1130927532 15:88396652-88396674 TTGTGTTAGGTTAAGGAGGGAGG + Intergenic
1131223920 15:90608144-90608166 GTGAGTAAGGGGATGGAGAGAGG + Intronic
1132646245 16:1000580-1000602 GTGTGGGAGGGCAAGCAGAGCGG + Intergenic
1133085920 16:3363442-3363464 GAGTGTGAGAGAAAGAAGAGTGG - Intergenic
1133744436 16:8675765-8675787 GTGTGTTGGGGCAGGGAGCGGGG - Intronic
1134389835 16:13809102-13809124 GTGTGTTGGGGAAGGGAGTCTGG + Intergenic
1135197133 16:20403820-20403842 GTGTGCTTGGGAAAGGGAAGAGG - Intronic
1135844650 16:25908040-25908062 GTGTGTTTGTGATAGAAGAGGGG + Intronic
1135976534 16:27112051-27112073 ATGTTTTAGGGAAGAGAGAGGGG + Intergenic
1137812356 16:51364944-51364966 GTGTGTTAGGGATGGGAGAGAGG + Intergenic
1138083343 16:54112639-54112661 TTGTCTTAGAGAAAGGAAAGAGG - Exonic
1138521601 16:57574513-57574535 GTGAGATGTGGAAAGGAGAGAGG + Intronic
1138566854 16:57839924-57839946 GTCTGTTAGGCAGCGGAGAGTGG - Intronic
1139286880 16:65823184-65823206 ACGTGTTAGAGAAAAGAGAGAGG + Intergenic
1139925400 16:70483104-70483126 ATGTGGTGGGGAGAGGAGAGAGG - Intronic
1140601886 16:76486198-76486220 GAGTGGTAGGGTAAGGAGACAGG - Intronic
1140802927 16:78505696-78505718 CTGTGCTAGGGAGAGCAGAGAGG - Intronic
1141169855 16:81684441-81684463 GTGAGTCAGGGAAAGCAGCGAGG + Intronic
1141282515 16:82641646-82641668 ATGTTTTAGGGACAGGAGATGGG + Intronic
1141483105 16:84319737-84319759 GTGTGACAGGGAAAGGGTAGGGG - Intronic
1142467108 17:142322-142344 GGATGTTAGGGAAAAGAGGGCGG + Intergenic
1142643054 17:1295712-1295734 GTGGGTTGGGGGAAGGAGAAGGG + Intronic
1142698664 17:1646883-1646905 GTATGTTGGGGAAAGGGGAAAGG - Intronic
1143832705 17:9665081-9665103 GTGTGGTAGGGAATGGGCAGGGG + Intronic
1145905463 17:28513892-28513914 GGGTGCTGGGCAAAGGAGAGTGG + Intronic
1145979785 17:29004859-29004881 GAGTGTTGGGGAGAGGATAGGGG - Intronic
1146380182 17:32322306-32322328 GTGTGGAAGGGACAGGAGATGGG - Exonic
1146665277 17:34698116-34698138 GTGTGTTGGGGAAAGGGGTTTGG - Intergenic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147210592 17:38870548-38870570 GTGTGTTGGGGGAAGGTTAGGGG + Intronic
1148489030 17:48011669-48011691 GTGTGTTAGGGACGGGAGAAGGG - Intergenic
1148553884 17:48566364-48566386 GCGTGTTGGGGAAAGGGAAGGGG + Intronic
1148616351 17:49003687-49003709 GAGTGTTAGGGAGAGAAAAGGGG + Intronic
1149350611 17:55783290-55783312 GTAACTTAGGGAAGGGAGAGAGG + Intronic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1150446689 17:65231969-65231991 CTGTGTCAGAGAAGGGAGAGGGG + Intergenic
1150829357 17:68505341-68505363 GGGCCTTAGGGGAAGGAGAGAGG + Intergenic
1151458686 17:74241897-74241919 GTGTGGAAGGGAAAGGAACGAGG + Intronic
1151651840 17:75475086-75475108 GTGCCTCAGGGACAGGAGAGAGG + Intronic
1151744751 17:76005851-76005873 GGGAGTGAGGGAGAGGAGAGAGG + Exonic
1151898603 17:76996982-76997004 GTGTGTCAGGGCAAGGAGATGGG - Intergenic
1151933116 17:77245229-77245251 GGGAGTTGGGGAAAGGAGAGGGG + Intergenic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1153754438 18:8265685-8265707 CTGTGTTATAGAAAGGACAGTGG + Intronic
1154014214 18:10602051-10602073 GTTTTTGAGGGAAAGGAAAGTGG + Intergenic
1154159254 18:11968442-11968464 GTGTGTAGAGGACAGGAGAGAGG + Intergenic
1156519782 18:37712576-37712598 GTGTGTGAGGGAGGGGAGGGGGG - Intergenic
1157168167 18:45377556-45377578 GTGTGATTAGAAAAGGAGAGGGG - Intronic
1157269674 18:46262746-46262768 GTGTGGTGGGGTAGGGAGAGAGG + Intronic
1157637325 18:49171362-49171384 GTGTGTTAGAGGAAGGACTGAGG - Intronic
1157847566 18:51017823-51017845 GTCGGCTAGGGAAAGGAAAGGGG + Intronic
1158193709 18:54860461-54860483 GTTTGATAGGGAAAGGAGAGAGG - Intronic
1158677580 18:59535399-59535421 GGGTGTTAGTGAACGTAGAGAGG + Intronic
1158806932 18:60985192-60985214 GTGTGTCAGGGTAAGTAGACTGG - Intergenic
1159264163 18:66057653-66057675 TTGTGTTTGGGAGAAGAGAGAGG + Intergenic
1160002048 18:75033870-75033892 GAGGGTCAGGGAAAGGAGAAGGG - Intronic
1160078658 18:75702769-75702791 GTGTCTTAGCCAGAGGAGAGAGG + Intergenic
1160224048 18:76998565-76998587 GGCTGTTGGGGAAAGGAGGGTGG - Intronic
1160632333 18:80255177-80255199 GTGGGTTAGGGATAGCAGAGTGG + Intergenic
1160747920 19:720343-720365 GTGTCCTGGGGAAAGGCGAGGGG + Intronic
1160747973 19:720462-720484 GTGTCCTGGGGAAAGGCGAGGGG + Intronic
1161777447 19:6271343-6271365 ATGACTTAGGGAAAGGAGAGGGG - Intronic
1162466973 19:10848304-10848326 GTGTGTTTGGGGAAGGGGTGGGG + Intronic
1163784528 19:19267926-19267948 GTGGGTCAGGGAAGGGAGACTGG + Intronic
1164601541 19:29566539-29566561 GTGTGATAGGCATAGGGGAGGGG + Intergenic
1164601714 19:29567196-29567218 GTGTGATAGGTACAGGGGAGGGG + Intergenic
1164742986 19:30590386-30590408 GTGTCTTGGGCAAAGGAGAGTGG + Intronic
1164879301 19:31717622-31717644 GTGTGTTTGGTAAAGGTGAAAGG - Intergenic
1164897240 19:31887683-31887705 GGGTGTGAGGAAACGGAGAGAGG + Intergenic
1165538750 19:36472743-36472765 GTGTGTTAGGTAAAGGGGAAAGG + Intronic
1165802636 19:38562371-38562393 GAGTGTGAGGGAATGGGGAGGGG - Intronic
1166076410 19:40416135-40416157 GAGTGTGAGGGAAAGGTAAGAGG + Intergenic
1166881949 19:45935126-45935148 GTGGGGTAGGGAAAGGGGTGGGG + Exonic
1168316914 19:55488544-55488566 GGGTGAAAGGGGAAGGAGAGCGG - Intronic
925626947 2:5850894-5850916 CTGTGTTAGGCAGAGGGGAGAGG - Intergenic
927274601 2:21251857-21251879 GTGTCATAGGGAAATGAAAGAGG + Intergenic
927503067 2:23595214-23595236 GTGGGGTGTGGAAAGGAGAGGGG + Intronic
927847656 2:26479730-26479752 TTGGGTTTGGGAAAGGGGAGAGG + Intronic
928268755 2:29835553-29835575 CTGGGTTGGGGAAGGGAGAGTGG - Intronic
928389201 2:30896167-30896189 GTTAGGTAGGGAAGGGAGAGGGG - Intergenic
928466812 2:31529817-31529839 GTGTGTCCAGGAAAGGAGCGGGG - Intronic
928499573 2:31876156-31876178 GTGTGTAAGAGTAAGAAGAGTGG - Intronic
929556797 2:42930596-42930618 GTGAGAGTGGGAAAGGAGAGGGG - Intergenic
929579691 2:43074067-43074089 GAGGGATGGGGAAAGGAGAGGGG - Intergenic
929896921 2:45968779-45968801 GTGGGTAAGAGAAAGGACAGTGG + Intronic
931079929 2:58757478-58757500 GTCTGTTAGGGAAATGGAAGTGG + Intergenic
932134106 2:69213679-69213701 GTGTGTTAGAGACAGGAGTCTGG - Intronic
932940673 2:76161119-76161141 ATGTGGAAGGGATAGGAGAGAGG + Intergenic
933877139 2:86630795-86630817 TTCTGTTGGGGCAAGGAGAGTGG + Intronic
934169610 2:89329668-89329690 GGATGATAGGGAAAGGAGAATGG - Intergenic
934197682 2:89852917-89852939 GGATGATAGGGAAAGGAGAATGG + Intergenic
934646151 2:96060401-96060423 GTGTGTTTGGGAGAAGGGAGGGG - Intergenic
934839554 2:97616484-97616506 GTGTGTTTGGGAGAAGGGAGGGG - Intergenic
935930081 2:108114253-108114275 AAGTGTTCAGGAAAGGAGAGTGG - Intergenic
936087406 2:109478680-109478702 GTGTGGTGGGGAAGGGAGAGAGG + Intronic
936088572 2:109486716-109486738 ATGTGTTAGAGGAAGGGGAGGGG + Intronic
936751101 2:115642638-115642660 GAGAGATAGGGAAAGGAGAGAGG - Intronic
937363897 2:121247092-121247114 GAGTGTCAGGGAAAGCAGGGAGG - Intronic
937500970 2:122478690-122478712 GTGAATTAGGGAAAAGAGAAAGG + Intergenic
937597897 2:123691912-123691934 GGGTGTTACGGAAAGGAGGGAGG - Intergenic
938181672 2:129190179-129190201 GTGTTATAGGGAAGGGAGTGTGG + Intergenic
938667982 2:133558917-133558939 CTGTCTTAGGGCAATGAGAGAGG - Intronic
939592349 2:144081580-144081602 GTTTATTAGGGGGAGGAGAGAGG - Intronic
940203964 2:151182016-151182038 GAAGGTTAGGGAAAAGAGAGAGG + Intergenic
940612138 2:156005984-156006006 GTGGGTGAAGGGAAGGAGAGAGG - Intergenic
940903462 2:159147502-159147524 GGGCGTTTGGGAAAGGAGGGCGG - Intronic
942466446 2:176212452-176212474 GTGTGCAGGGGAAGGGAGAGAGG - Intergenic
943508085 2:188786934-188786956 ATGTGTTAGGAAACAGAGAGTGG - Intronic
943605998 2:189977296-189977318 CTCTATTAGGGCAAGGAGAGTGG - Intronic
943777471 2:191782033-191782055 GTGTGTTGGGGACAAGAGGGTGG + Intergenic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945472167 2:210239697-210239719 ATGTGTTAGGGAAAAATGAGAGG - Intergenic
945968334 2:216211785-216211807 GTAAGTTTGGAAAAGGAGAGAGG + Intergenic
946139785 2:217680483-217680505 GTGTGTCAGGGGGAGGTGAGAGG + Intronic
946249788 2:218405197-218405219 GATTTTTAGGGGAAGGAGAGAGG + Exonic
946412041 2:219520296-219520318 GTGGGGCAGGGAGAGGAGAGAGG - Intronic
946758535 2:222971138-222971160 GTGTGTTTGGGATTGAAGAGGGG - Intergenic
946807207 2:223482816-223482838 GTGGGGTAGGGGAAGGAGGGAGG + Intergenic
946847639 2:223873885-223873907 GTGTGTCAGGGATGGGAGAGTGG - Intronic
948887398 2:240891121-240891143 GTCTGTGAGAGGAAGGAGAGGGG - Intronic
1168935130 20:1658404-1658426 GTGGGTTATGGAAAGGGGATAGG + Intergenic
1169212333 20:3773915-3773937 GTCGGTTAGAGAGAGGAGAGGGG + Intergenic
1169212608 20:3775888-3775910 ATGTGTCAAGGAAATGAGAGTGG + Intergenic
1169533873 20:6515543-6515565 GTGTTTAAGGGAAAAGAAAGAGG - Intergenic
1169774805 20:9240801-9240823 GGATGAGAGGGAAAGGAGAGAGG + Intronic
1170428460 20:16257939-16257961 GTGTGTTTGGGATGGGAAAGGGG - Intergenic
1170633333 20:18083606-18083628 GTGTGGAAGGGAAAGGAAGGTGG + Intergenic
1171433857 20:25104306-25104328 GTGTGTGGTGGAAAGGACAGAGG - Intergenic
1171504304 20:25621255-25621277 GTGTGATAGAAAAAGCAGAGAGG - Intronic
1172041889 20:32051976-32051998 AGGTGTTAGGGAAAGTGGAGCGG + Intergenic
1173556512 20:43969924-43969946 GTGTGTTAGGGGCAGGCAAGGGG - Intronic
1173622802 20:44449491-44449513 GTGTTTTGGGGAGAGGAGTGAGG - Intergenic
1174394665 20:50239570-50239592 GTGTGATAGAGAAAGGCGTGGGG + Intergenic
1175320480 20:58084159-58084181 ATTTGTTAGAGAAAGGACAGTGG + Intergenic
1176214544 20:63941923-63941945 GTGTGGCAGGGGAAGGAAAGAGG + Intronic
1177225321 21:18245460-18245482 GTGTGTTAGAGAAGAGAGGGAGG - Intronic
1177243729 21:18494933-18494955 GTGTGTTACGCATAGGACAGGGG + Intergenic
1177499870 21:21940090-21940112 GAGTGATAGGGAAAGGGGTGGGG + Intergenic
1177748530 21:25251405-25251427 ATGTTGTAGGGAAAGGAGAGAGG + Intergenic
1178162579 21:29937069-29937091 GTGTGTAAGGAAAAAGAAAGGGG - Intronic
1178710918 21:34916030-34916052 GTGTGTGTGGGGAAGGGGAGAGG + Intronic
1179311175 21:40197493-40197515 TTGCATTAGGGATAGGAGAGAGG - Intronic
1179451721 21:41472807-41472829 GTGTTTAAGGAAAAGGGGAGGGG + Intronic
1179774703 21:43653736-43653758 GTGTCTGAGGGACTGGAGAGTGG + Intronic
1181774046 22:25147036-25147058 ATGATTTAGGGAAATGAGAGAGG + Intronic
1181863874 22:25840241-25840263 GTGTGATGGTGACAGGAGAGAGG - Intronic
1181938569 22:26457126-26457148 GTGTGTGATGGAGATGAGAGAGG + Intronic
1182106172 22:27691379-27691401 ATGTGTTCGGGACAGAAGAGGGG - Intergenic
1182949209 22:34355856-34355878 ATGTGTTAGAGAGAGGAGACGGG - Intergenic
1184256932 22:43292540-43292562 GTGTGTTAGGGACCGGGGATTGG - Intronic
1184710306 22:46245713-46245735 GTGTGTAAGAGAGAGGAGAGCGG - Intronic
949134054 3:541264-541286 GTGGGAAAGGGAGAGGAGAGTGG - Intergenic
949809717 3:7993184-7993206 ATGTGTTAGGAAAAGGATGGGGG - Intergenic
949821131 3:8116435-8116457 GTGTGGAAGGGAGAAGAGAGGGG + Intergenic
951465612 3:22997556-22997578 GTGGGGGAGGGAAAGGGGAGGGG + Intergenic
951671439 3:25187534-25187556 ATGTGTTAGAGACAGGAGAAAGG + Intronic
952645364 3:35650998-35651020 GTGTGTTTGAGAAAGGAAACAGG + Intronic
952809923 3:37392590-37392612 GTATGTCAGGGAGAGGAAAGGGG + Intronic
952999354 3:38917959-38917981 GAGTGGTGGGGAAAGTAGAGAGG - Intronic
953186603 3:40643446-40643468 GTGTGTGATGGAAAGGAAACAGG - Intergenic
953607021 3:44418929-44418951 GTGTGGTAGGGAAAGGGTAGGGG - Intergenic
953709709 3:45259830-45259852 GTGTGTTAGGGAAAAGCTAAAGG - Intergenic
953752994 3:45623707-45623729 GTGTGTGAGGGAGAGGGCAGAGG + Intronic
954228674 3:49199600-49199622 GTGGGTTGGGGAAAGGCGGGGGG + Intronic
954371224 3:50170495-50170517 GCCTTTCAGGGAAAGGAGAGTGG - Intronic
954664938 3:52246563-52246585 GTGTGTTAGGGACAGCACTGGGG + Intronic
955114881 3:55988076-55988098 GTGACTTAGGGGAAAGAGAGAGG - Intronic
955157957 3:56435864-56435886 GTGTGAAAGGGAAAAGAGACAGG - Intronic
955207673 3:56911209-56911231 CTGTGAGAGGTAAAGGAGAGAGG + Intronic
955688147 3:61564545-61564567 GTGGGAAAGGGAAAGGACAGTGG + Intronic
955861758 3:63338098-63338120 GTGTGTTTGGGATGGGAGTGGGG + Intronic
957248381 3:77740856-77740878 GTGTGTGAGGAAGTGGAGAGAGG - Intergenic
959114681 3:102162664-102162686 GAGGGGTAGGGAGAGGAGAGGGG + Intronic
959265767 3:104136288-104136310 GTATGTTAGAGAAAAGAGAAGGG + Intergenic
959540080 3:107526183-107526205 GGGTGGTAGAGAAAGGGGAGGGG + Intronic
960732872 3:120745363-120745385 GTGTTTTAGGCAAAGGAAACAGG + Intronic
960956117 3:123032395-123032417 GTGTGTGAGGAATAGCAGAGAGG - Intergenic
960980147 3:123216296-123216318 CTGTGTTAGGGAAGTGAGAAAGG + Intronic
961364456 3:126390471-126390493 TTGTGTTAGGGAAAGGGATGGGG - Intergenic
961643286 3:128378687-128378709 GGGTGTCAGGCACAGGAGAGAGG - Intronic
963063151 3:141241317-141241339 GTGTGTAGGGGAAGGGAGGGAGG - Intronic
963129913 3:141848492-141848514 GTGCGTTAGGGCAAGGATACTGG + Intergenic
963747120 3:149135652-149135674 GTGTGTAAAGCAAAGAAGAGGGG + Intronic
963787399 3:149548762-149548784 GTTTGTTGTCGAAAGGAGAGAGG - Intronic
963861576 3:150315952-150315974 GTGTGCTAGAAAGAGGAGAGGGG - Intergenic
965196305 3:165600418-165600440 GTGAGATAGGGAAAGCAGAGAGG + Intergenic
965206644 3:165727337-165727359 GTGTATTAGTGAATGGATAGAGG + Intergenic
966230762 3:177648980-177649002 CTGGATTAGGAAAAGGAGAGGGG + Intergenic
967245425 3:187481948-187481970 GTGTGTTGTGGAAGTGAGAGGGG + Intergenic
967349583 3:188497943-188497965 GGGTGTTAAGGGGAGGAGAGAGG - Intronic
967355723 3:188568739-188568761 GTGGCTTGGGGAAAGTAGAGAGG + Intronic
967457825 3:189710130-189710152 ATATGTTAGGGAAAGGCGTGGGG + Intronic
968688502 4:1977211-1977233 CTGTTTGAGGGAAAGTAGAGTGG + Intronic
969560208 4:7941974-7941996 GTGTGTGTGGGAAGGGAGATGGG - Intergenic
969705059 4:8787193-8787215 GGGAGTTAAGGGAAGGAGAGAGG + Intergenic
970599268 4:17627983-17628005 CTATGTTAGAGAAAGGGGAGAGG - Exonic
971077486 4:23166786-23166808 ATGTGTTAGGGAGAGAAGGGGGG - Intergenic
971651289 4:29278827-29278849 GTGTAATAAGGAAAGGAAAGAGG - Intergenic
972269180 4:37493495-37493517 GAGTGGCAGGGAAAGGGGAGAGG - Intronic
972415712 4:38838591-38838613 GTGAGTGAGGGAATGAAGAGAGG + Intronic
972721465 4:41703270-41703292 ATGTGTTAGGGAGAGGTCAGTGG - Intergenic
973817355 4:54631402-54631424 ATGTGGTAGAGAAGGGAGAGGGG - Intergenic
974119064 4:57616273-57616295 GTGTGTTGAGGAAAGGAAAATGG + Intergenic
974413747 4:61577206-61577228 GTGTGTTAGGGAAATGGGGGGGG + Intronic
975647079 4:76555809-76555831 GTGGGGTAGGGTAGGGAGAGAGG - Intronic
976988673 4:91335407-91335429 GGCTGTGAAGGAAAGGAGAGAGG + Intronic
980076742 4:128301987-128302009 GTGTGGAAGAGAGAGGAGAGAGG + Intergenic
981022566 4:140044242-140044264 TTTGGTTAAGGAAAGGAGAGAGG + Intronic
981028431 4:140099744-140099766 GTGTGTTGGGGAAGGGAGGTTGG - Intronic
981143621 4:141300182-141300204 CTGAGTTAGGAAAAGGAAAGAGG + Intergenic
981216779 4:142178998-142179020 GTGCATTGGGGAAAGCAGAGAGG - Intronic
981302404 4:143203174-143203196 GTGTGTAAGGATGAGGAGAGGGG + Intronic
981706032 4:147659905-147659927 GTGTGTTAGTGAATGGCGTGAGG - Intronic
985865892 5:2514088-2514110 GTGTGTTTGGGAAAGAAGAAAGG - Intergenic
986571379 5:9169653-9169675 GTGTTGAAGGGAGAGGAGAGTGG - Intronic
987935639 5:24460940-24460962 ATGTGTAAGGAAAATGAGAGAGG + Intergenic
989949118 5:50275789-50275811 GTTTGTTAGAGAAGGGAGAAGGG + Intergenic
990731235 5:58811642-58811664 GTATCTTGGGGAAAGGGGAGGGG - Intronic
991982578 5:72248590-72248612 GAGTCATAGGGGAAGGAGAGAGG + Intronic
992160570 5:73996811-73996833 GTGAGAGAGGGAAAGGAGAATGG - Intergenic
992267413 5:75032760-75032782 GTGTGTCAGGCAAGGGAGTGGGG - Intergenic
992343307 5:75848704-75848726 GTGTGTATGGGAAGGGACAGAGG + Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
993095352 5:83473258-83473280 GGGTGTTAGGCAGAGGAGAGCGG + Intronic
993711095 5:91226135-91226157 GTGTGTTGGGGTAGGGGGAGGGG + Intergenic
993802787 5:92364710-92364732 TTAGGTTAGGGAAAGGAGACAGG - Intergenic
994557469 5:101321907-101321929 ATGTGTTGGGGAGAGGTGAGAGG - Intergenic
994946955 5:106406863-106406885 GTGTGTTAGGGGTTGGGGAGTGG + Intergenic
995229569 5:109743852-109743874 ATGTGTCAGGCAAAGGATAGTGG - Intronic
995654415 5:114409017-114409039 GTGTGGTGGGGAAGGGACAGAGG + Intronic
996990377 5:129623357-129623379 GTGTGTTAGGAAGAGGCGAGAGG - Intronic
997152795 5:131517110-131517132 GTCTATTAGGGCAGGGAGAGAGG + Intronic
997639741 5:135441438-135441460 GTGTGTTGGGGAATGGAGAGGGG + Intergenic
997760812 5:136445961-136445983 GTGTGTTCGGGAGAGGAGGAAGG - Intergenic
998298256 5:140992748-140992770 CTGTGTTGGGGATAGGAGGGTGG + Intronic
998385916 5:141757036-141757058 GAGGGTTAGGGATGGGAGAGGGG - Intergenic
998449926 5:142226314-142226336 GGGTGCCAGAGAAAGGAGAGAGG - Intergenic
998799413 5:145854063-145854085 GAGAGTTGGGGAAAGGAGGGAGG - Intergenic
998961424 5:147490966-147490988 TTCTGTCAGGGAGAGGAGAGAGG + Intronic
1000020973 5:157319188-157319210 GTGAGTTAGGGTAAGGAGAAGGG + Intronic
1000151794 5:158509634-158509656 GTGTGTTGGGGGACGGAGAGAGG + Intergenic
1000827229 5:166059962-166059984 ATGACTTAGGGAAAGGACAGAGG - Intergenic
1001948777 5:175801438-175801460 TTGTATCTGGGAAAGGAGAGTGG + Intronic
1002591644 5:180294740-180294762 TGGTCTTAGGGAAAGGTGAGGGG + Intergenic
1002791689 6:441825-441847 GTGTGTTAGGCTCAGAAGAGCGG + Intergenic
1002865045 6:1114523-1114545 GAGAGTTTGGGAAAGGAGAAAGG - Intergenic
1003059673 6:2853443-2853465 GAGGGTCAGGGAAAGGCGAGGGG - Intergenic
1003059682 6:2853475-2853497 GAGGGTCAGGGAAAGGGGAGGGG - Intergenic
1003059719 6:2853566-2853588 GAGGGTCAGGGAAAGGGGAGGGG - Intergenic
1003059733 6:2853598-2853620 GAGGGTCAGGGAAAGGGGAGGGG - Intergenic
1003335851 6:5171502-5171524 GTGTGTTAGGGGAAGTGGTGGGG + Intronic
1004237387 6:13886343-13886365 TTGTGTTAGAGAAAGGACTGTGG - Intergenic
1004258132 6:14083872-14083894 GTGTGTCAGTGGAAGCAGAGTGG - Intergenic
1004502633 6:16222726-16222748 GGGTGTCAGGAACAGGAGAGAGG + Intergenic
1004576100 6:16896737-16896759 ATGTTTGATGGAAAGGAGAGGGG + Intergenic
1004690812 6:17990580-17990602 CTTTATTAGAGAAAGGAGAGGGG + Intergenic
1005041894 6:21607613-21607635 GTGTGTTGGGGAAAGGATGCAGG - Intergenic
1005526243 6:26652878-26652900 ATGTGTCAGGGTAAAGAGAGTGG + Intronic
1006102979 6:31697709-31697731 CTGTGTAAGTGAAAAGAGAGAGG - Intronic
1006184788 6:32175686-32175708 GGTTGCTGGGGAAAGGAGAGGGG - Intronic
1006185480 6:32179293-32179315 GTTTGTTGGGGAGAGGAGAAAGG + Intronic
1006325022 6:33347112-33347134 GTGTTTTAAGGAATGGAAAGGGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006513994 6:34536033-34536055 GGGTGTCAGGGAAGGGACAGGGG - Intergenic
1006817612 6:36863386-36863408 GTGTCTTAGGGAAGGGAGGTGGG - Intronic
1007075494 6:39063634-39063656 GTTTGTTTGGGAAAGGAGCTGGG + Intronic
1007358066 6:41335270-41335292 GTGGGTGCGGGAAAGGAGAGGGG - Intergenic
1007929691 6:45679136-45679158 GTGTGTTTTGGAGAGGAGAGTGG - Intergenic
1009314689 6:62203547-62203569 GTGGGTGGGGGAAAGGAGGGAGG + Intronic
1009876222 6:69508633-69508655 GTGCCTTAGGGAAAGGAGGCTGG + Intergenic
1009931632 6:70183004-70183026 GTTTGTTAGTGAAAGAAGAATGG + Intronic
1010064368 6:71663904-71663926 GTGTGTAAGGGTATGGAGAAGGG - Intergenic
1011113360 6:83862762-83862784 GTGGATTATGGAATGGAGAGAGG + Intronic
1011459226 6:87586202-87586224 GTGGAATAGAGAAAGGAGAGGGG + Intronic
1011857529 6:91713248-91713270 ATGAGGTAGGAAAAGGAGAGGGG - Intergenic
1012125660 6:95425210-95425232 TTTTGTTGGGGAAAGGAGAATGG - Intergenic
1012425960 6:99114727-99114749 GTGTGTTGGGCAAAGGGAAGAGG - Intergenic
1012426208 6:99117408-99117430 GTGAGTTAGGAAAATGACAGTGG - Intergenic
1012736461 6:102951694-102951716 GTGTGTTAGGGTATGAAGACAGG - Intergenic
1012773125 6:103466378-103466400 GTGTGTTTGGGGAAGCAGAGGGG + Intergenic
1012852971 6:104468925-104468947 GTGTGTTGGTGAAAGGAGAGAGG - Intergenic
1012914480 6:105154767-105154789 GTGAGTCCGGGAAAAGAGAGTGG - Intergenic
1014152956 6:118079855-118079877 GTGTACTAGACAAAGGAGAGAGG - Intronic
1014273908 6:119365379-119365401 GTGTGCTTGGGAAGGGAGAGAGG + Intergenic
1014488295 6:122028959-122028981 GTGTGCCATGGGAAGGAGAGAGG + Intergenic
1014578850 6:123109188-123109210 GTGTGTAGGGGTAGGGAGAGAGG + Intergenic
1015171859 6:130263296-130263318 GTTTTTGAGGGAAAGGAAAGTGG - Intronic
1015319245 6:131853668-131853690 GTGTGTGAGGGTAAGGTGGGAGG + Intronic
1015592368 6:134834073-134834095 GTGGGTTAGGGGAGGGAGGGAGG + Intergenic
1017032719 6:150238359-150238381 GAGTGATGGGGGAAGGAGAGAGG + Intronic
1018493415 6:164321366-164321388 GTGTGTTAAAGAAACTAGAGTGG + Intergenic
1019360665 7:602697-602719 GTGTGTTGGGGACATGAGACGGG + Intronic
1020711945 7:11617836-11617858 GTGGGGTAGGGAGAGGAGGGAGG + Intronic
1020734919 7:11936255-11936277 GTGTGTGGGTGAAAGGGGAGGGG - Intergenic
1022115058 7:27253634-27253656 CTGTGTAAGAGAAAGGAGATGGG + Intergenic
1022124692 7:27344114-27344136 GTTTGGTATGGTAAGGAGAGAGG + Intergenic
1022322543 7:29300379-29300401 GTGAGCTAGGGAGAGGAGGGTGG + Intronic
1023116876 7:36871479-36871501 GAGGGTTAGGGATTGGAGAGGGG - Intronic
1023168159 7:37363516-37363538 GTGGGATGGGGATAGGAGAGAGG - Intronic
1023301927 7:38782356-38782378 CTGTGTGAGAGAAAGCAGAGGGG - Intronic
1024661734 7:51501850-51501872 GTGTACTAGGCAGAGGAGAGAGG + Intergenic
1024973226 7:55089750-55089772 GCAGGTTAGGGAAAGGTGAGAGG - Intronic
1026971782 7:74472944-74472966 GTTGGGTAGGGAAGGGAGAGTGG + Intronic
1027790073 7:82628372-82628394 GTGTCTTGGGGAAAGGATAGTGG + Intergenic
1027999371 7:85471791-85471813 ATGTGTGATGGAAAAGAGAGGGG + Intergenic
1030376882 7:108762645-108762667 GTACGCTAGGGAAAGGAGATGGG - Intergenic
1030721438 7:112875607-112875629 GTGTGATAGGGAAAGGTTAAGGG - Intronic
1031331981 7:120476632-120476654 GTGTGTGGGGGAAGGGAGAGGGG + Intronic
1031462834 7:122072810-122072832 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
1031541283 7:122997529-122997551 GGGTGTGAGCTAAAGGAGAGTGG - Intergenic
1032006744 7:128308362-128308384 GTGTACTAGGGAAAAAAGAGTGG + Exonic
1032827583 7:135587160-135587182 GTGTGTTTGGGAAATGAGTGGGG + Intronic
1032854919 7:135825971-135825993 GTGTGTTGGGGGAGGGGGAGAGG + Intergenic
1033011226 7:137624912-137624934 GTGTGTTAGGAAATCAAGAGAGG - Intronic
1033041574 7:137924007-137924029 GTCTGTGAGGTAAAGGTGAGCGG - Intronic
1034384785 7:150731971-150731993 GTGTGGAAGGGAAAGGAAAAAGG - Intronic
1034402982 7:150878101-150878123 GTGTGGAAGGGACAGAAGAGAGG - Intergenic
1035644754 8:1210456-1210478 GTGTGTGGGGGGAAGGAGAGGGG + Intergenic
1036134517 8:6148015-6148037 GTGTCCTTGGGAAAGGAGAGGGG + Intergenic
1037523994 8:19707014-19707036 GTGAGATGGGGGAAGGAGAGAGG + Intronic
1038023589 8:23570366-23570388 GTGTTTTGGGGACAGGAAAGAGG + Intronic
1038074496 8:24056734-24056756 GTGTGTGAGGGAATAAAGAGTGG - Intergenic
1038198521 8:25390176-25390198 GCTCGTTAAGGAAAGGAGAGGGG - Intronic
1038533877 8:28339952-28339974 GAGAGCTGGGGAAAGGAGAGGGG - Intronic
1038625470 8:29189009-29189031 GTCACTGAGGGAAAGGAGAGGGG - Intronic
1039065907 8:33607177-33607199 GTAAGTTATGGAAAGGTGAGGGG + Intergenic
1039396669 8:37231668-37231690 GAGGGTGAGAGAAAGGAGAGAGG + Intergenic
1040466903 8:47703869-47703891 GTGTGTCAGGGAGAGGAGACGGG + Intronic
1040627011 8:49160754-49160776 GGGTGGTAGAGAAAGGAGAGTGG - Intergenic
1041360136 8:57044426-57044448 GTGTATTTGTGAAAAGAGAGTGG + Intergenic
1041494000 8:58465903-58465925 GAGAGTTAGGGAAGGGAGATAGG - Intergenic
1041858090 8:62480840-62480862 GTGTCTTAGGGAACAGAAAGTGG + Intronic
1042835048 8:73072108-73072130 CTGTGTGAGAGGAAGGAGAGGGG + Intronic
1042911280 8:73829333-73829355 GTAGGTTAAGAAAAGGAGAGAGG + Intronic
1043750966 8:83933685-83933707 GTGTTTTAGGAAAATTAGAGGGG + Intergenic
1046211552 8:111082618-111082640 GTGTGGAAGGTAAAGAAGAGAGG - Intergenic
1046890355 8:119415847-119415869 GTGTGTTGGGGGGAGGGGAGTGG - Intergenic
1047030646 8:120875836-120875858 GTTTTATGGGGAAAGGAGAGAGG - Intergenic
1047071146 8:121344842-121344864 GTGTGTTGGGGTGAGGGGAGTGG - Intergenic
1047199415 8:122752348-122752370 GTGTGGTTGGGAATGGAGTGGGG - Intergenic
1047247496 8:123158103-123158125 GAGTGAAAGGGAAAGGAGAGCGG - Intergenic
1047806953 8:128370940-128370962 GAGTGAGAGGGAAAGAAGAGAGG - Intergenic
1047960182 8:130005865-130005887 GTGTGAGATGGAAAGGACAGTGG - Intronic
1048590297 8:135815137-135815159 GTGGTTTAGGGAAATGAGAAGGG + Intergenic
1050823425 9:9913516-9913538 GTGTCGAAGGGAAAGGGGAGTGG + Intronic
1052295031 9:26888403-26888425 GTGTGATAGATAAAGGAGGGAGG - Intronic
1052576947 9:30303062-30303084 GTCTGTTGGAGAATGGAGAGTGG + Intergenic
1053169539 9:35868908-35868930 GTGTGCTGGGGATAGGGGAGGGG + Intergenic
1053264077 9:36697807-36697829 GTATGTTAGGTAGAGGAGAGAGG + Intergenic
1055378282 9:75675360-75675382 GTGTTTTAAGTAAAAGAGAGAGG - Intergenic
1055872650 9:80902085-80902107 GTGGGTCAGGGGAAGGAGGGAGG + Intergenic
1056300360 9:85233742-85233764 GGGGGTGAGGGAAAGGAGATGGG - Intergenic
1056655276 9:88503707-88503729 GTGGGTTAGGGAAGGGGCAGAGG + Intergenic
1056764300 9:89435500-89435522 GTGAGTTGGGGAAAGGAGGAGGG - Intronic
1056931278 9:90880186-90880208 GCCTCTTAGGGAAAGGTGAGTGG - Intronic
1056932195 9:90888540-90888562 CTATGTTAGAGAAAGGAGAGCGG + Exonic
1057140794 9:92725761-92725783 GTCTGGTGGGGACAGGAGAGAGG - Intronic
1057495278 9:95555515-95555537 GTGTCTGAGGGACAGGAGGGAGG - Intergenic
1057651614 9:96924856-96924878 GTGAGCAAGGGAAAGGAGCGCGG + Intronic
1059631093 9:116123316-116123338 ATGTAATAAGGAAAGGAGAGAGG - Intergenic
1059989004 9:119846980-119847002 TTGTGTTATTGAAAGAAGAGAGG + Intergenic
1060069548 9:120534206-120534228 CTGTGTTCTGGAAAGGAGTGGGG - Intronic
1060105891 9:120873306-120873328 GTGTGTATGGGAAGGGAGAATGG + Intronic
1060170865 9:121459858-121459880 TTGTGTTAGGGAGAGGAGACAGG - Intergenic
1061229867 9:129309163-129309185 GTGTGTTAAGGATGGCAGAGCGG - Intergenic
1061419614 9:130466249-130466271 GTGTGGAAGGGAAAGAAGTGGGG - Intronic
1062444130 9:136586291-136586313 GTGGGCTAGGAAAAGGACAGGGG + Intergenic
1185930215 X:4194466-4194488 ATTTGCTAGAGAAAGGAGAGTGG - Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186259488 X:7761546-7761568 GTTTCTGAGGGAATGGAGAGGGG + Intergenic
1186533355 X:10320158-10320180 GAGGGATGGGGAAAGGAGAGAGG - Intergenic
1186715291 X:12244886-12244908 GTGAGTTGGGGAGAGGAGAGGGG + Intronic
1187233740 X:17446582-17446604 GAGAGTTAGCGAAAGGAGATAGG - Intronic
1188687130 X:33082898-33082920 CTGTGTTATGTAATGGAGAGAGG - Intronic
1190593740 X:52032340-52032362 GGGTGTCAGGTAAAGGAGAATGG - Intergenic
1190679221 X:52810886-52810908 GAGTGTGAGGGAAAGCAGAAAGG + Intergenic
1192207225 X:69104678-69104700 GTGTGTTAGGAAGATCAGAGAGG + Intergenic
1192233423 X:69281251-69281273 GTGTGTAAGGGGTGGGAGAGAGG + Intergenic
1193217932 X:78886499-78886521 GTGGGTGAGGGAAAACAGAGGGG + Intergenic
1194994048 X:100573982-100574004 GTGGGTTAGGGAAGGCACAGGGG - Intergenic
1195108461 X:101623032-101623054 GTGGGGGAGGGAAAGGAGGGGGG + Exonic
1195133705 X:101881322-101881344 GTGTATTGGTGAAAGGAGAGGGG - Intergenic
1195655477 X:107327833-107327855 GTGTGTTAGGGATGGGAGGATGG + Intergenic
1196103444 X:111871385-111871407 GTGTGGTAGGGTTAGGAGATTGG + Intronic
1196417847 X:115491764-115491786 GAGAGGGAGGGAAAGGAGAGAGG - Intergenic
1196803052 X:119560823-119560845 ATGTGCTAAGAAAAGGAGAGAGG + Intronic
1196863106 X:120046007-120046029 GTGGGTTGGGGATGGGAGAGAGG - Intergenic
1196879996 X:120190337-120190359 GTGGGTTGGGGATGGGAGAGAGG + Intergenic
1197686822 X:129448855-129448877 GGGAGCTAGGGAGAGGAGAGAGG + Intronic
1197757038 X:130002700-130002722 GTGTGTGAGAGAGAGGAGAAAGG + Intronic
1197833460 X:130670213-130670235 GGGTGAAAGGGAGAGGAGAGAGG + Intronic
1198421428 X:136473309-136473331 GTCTGCTTGGGACAGGAGAGTGG - Intergenic
1198562696 X:137867938-137867960 GACTGACAGGGAAAGGAGAGGGG + Intergenic
1198655305 X:138907340-138907362 ATCTGTTAGGGAGAGGGGAGGGG - Intronic
1199058019 X:143319985-143320007 ATGGGTTTAGGAAAGGAGAGAGG + Intergenic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1200371892 X:155736107-155736129 ATGTTTAAGGGATAGGAGAGAGG - Intergenic
1201061508 Y:10050744-10050766 GTTTGTTAAGGAATGGAAAGGGG + Intergenic
1202031200 Y:20576003-20576025 CTGTGTTCGGGAAAGGAGCTGGG + Intronic