ID: 914735007

View in Genome Browser
Species Human (GRCh38)
Location 1:150407845-150407867
Sequence CATAGGATATTGAAGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914735003_914735007 22 Left 914735003 1:150407800-150407822 CCATTATTTGTACTGAGTGTCCT 0: 1
1: 0
2: 1
3: 12
4: 167
Right 914735007 1:150407845-150407867 CATAGGATATTGAAGCCAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 225
914735004_914735007 2 Left 914735004 1:150407820-150407842 CCTTACAGTTAAATATTTATTTA 0: 1
1: 1
2: 5
3: 129
4: 1131
Right 914735007 1:150407845-150407867 CATAGGATATTGAAGCCAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914735007 Original CRISPR CATAGGATATTGAAGCCAGA GGG Intronic
900696390 1:4013891-4013913 CATGGGATAATGCAGCAAGAAGG - Intergenic
902741163 1:18439403-18439425 GCCAGGATATTGAAGCCTGAGGG + Intergenic
904644550 1:31956025-31956047 CATTAGATATTGAAGGAAGAAGG - Intergenic
906043186 1:42805386-42805408 CACAGGATAATGTAGCAAGATGG + Intergenic
907589017 1:55647829-55647851 TATAGAATGTTTAAGCCAGAAGG + Intergenic
908889711 1:68830938-68830960 CAGAGAATTTGGAAGCCAGAAGG + Intergenic
909501866 1:76343730-76343752 CAAAGCATTTTGAAGCTAGAAGG - Intronic
912074679 1:105858427-105858449 CAATGGTTATTGAAGCTAGAAGG - Intergenic
914735007 1:150407845-150407867 CATAGGATATTGAAGCCAGAGGG + Intronic
914978340 1:152388249-152388271 AAAAGGACATTGAAGGCAGATGG - Intergenic
914978469 1:152389879-152389901 AAAAGGACATTGAAGGCAGATGG - Intergenic
916309453 1:163379000-163379022 TATAGAATTTTGAAGCCAGGTGG - Intergenic
916944246 1:169708978-169709000 CATCTTATATTCAAGCCAGAAGG - Intronic
917673167 1:177293315-177293337 CATAGGATAATGCAGCAAGAAGG - Intergenic
920748988 1:208656296-208656318 CATAAGAGATTAAAGGCAGAGGG - Intergenic
920834346 1:209494964-209494986 CTTAGGGTATATAAGCCAGAGGG + Intergenic
922142399 1:222901870-222901892 AAAAGGAAATTGAACCCAGATGG + Intronic
923079273 1:230638430-230638452 CAAAGGAAATTGAGGCAAGATGG + Intergenic
924184563 1:241474766-241474788 CACAGGGAAATGAAGCCAGAGGG - Intergenic
1063924582 10:10965198-10965220 CATAGGATATTCAAGAGAGAGGG - Intergenic
1066064846 10:31754653-31754675 CACAGAATATTGGAGCCAGAAGG + Intergenic
1068435603 10:56987720-56987742 CATAGAATATTATAGCCAGAAGG + Intergenic
1069393138 10:67958370-67958392 CATAGAGTTTTGAAGCCAAAGGG - Intronic
1069669511 10:70189873-70189895 CAAAGGAGACTGAAGCCACAGGG - Intergenic
1070949087 10:80416576-80416598 AATAGGATATTCCAGGCAGAGGG + Intronic
1072256696 10:93628278-93628300 CATAGCATTTTAAAGCCAGAAGG - Intronic
1072532784 10:96335338-96335360 GAAAGGATGTTAAAGCCAGAGGG + Intronic
1075439782 10:122470806-122470828 CCAAGAATAGTGAAGCCAGAAGG + Intronic
1076032195 10:127169037-127169059 CCTAGAATATTGATGCTAGATGG - Intronic
1076201776 10:128564691-128564713 CATAAGATATTGGAGCTAGAAGG - Intergenic
1078035191 11:7796594-7796616 CATAGGCCATGGCAGCCAGAAGG + Exonic
1078732133 11:13984444-13984466 CATGGGATAATGCAGCAAGAAGG - Intronic
1078905038 11:15676394-15676416 CAGAGGATAATGATACCAGAAGG + Intergenic
1079289157 11:19171241-19171263 CATAGGGGATGGAAGCCAGCAGG - Intronic
1079649381 11:22908008-22908030 CATGGGATAATGCAGCAAGAAGG + Intergenic
1082808678 11:57465480-57465502 CCTAGGCTTTTGAAGGCAGAGGG - Intronic
1082916156 11:58439797-58439819 CATAGGCCATTGATGCCAGGAGG + Exonic
1083903920 11:65657932-65657954 AAAAGGATCCTGAAGCCAGATGG + Intronic
1084915656 11:72427075-72427097 CAGAGGATAATGAATACAGATGG + Intronic
1085109647 11:73876478-73876500 CAGAGGAGACTGAAGCCAAAAGG - Intronic
1085679336 11:78556980-78557002 CATAGCATCTTGAACACAGATGG + Intronic
1086779754 11:90888250-90888272 CATAGAATAGTGATGCCACATGG + Intergenic
1087903632 11:103670600-103670622 CAGATTATATTGAAGCCAAATGG - Intergenic
1087944067 11:104136917-104136939 CATAGGATTTTAGAGCTAGAAGG + Intronic
1088839029 11:113607334-113607356 CATAGGATGTTAGGGCCAGAAGG - Intergenic
1089153220 11:116380696-116380718 CTTTGCATAATGAAGCCAGAGGG - Intergenic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1090569158 11:128028703-128028725 CATAGGATTTTGGAACTAGAAGG - Intergenic
1091094392 11:132805786-132805808 CAAAGGAAAATGATGCCAGATGG + Intronic
1093772475 12:23033593-23033615 CACAGGATTTTGAAGTCACAGGG + Intergenic
1095930544 12:47620785-47620807 AATAGGATCTAAAAGCCAGAGGG + Intergenic
1096936387 12:55284082-55284104 CATAGGACATGGCAGCCAGGAGG - Intergenic
1096937261 12:55294878-55294900 CATAGGACATGGCAGCCAGGAGG + Exonic
1096939062 12:55320932-55320954 CATAGGACATGGCAGCCAGAAGG - Exonic
1096942727 12:55365443-55365465 CATAGGACATGGCAGCCAGAAGG - Exonic
1096945083 12:55396668-55396690 CAAAGGACATAGCAGCCAGAAGG - Intergenic
1096947718 12:55426583-55426605 CATAGGACATAGAGGCCAGGAGG - Exonic
1096960756 12:55574747-55574769 CATAGGACATGGCAGCCAGAAGG - Exonic
1100107517 12:91194031-91194053 CATAGGATATAAATGCCAAATGG + Intergenic
1101848377 12:108382187-108382209 CATACAATATTGAAGCTGGAGGG - Intergenic
1106421028 13:29586468-29586490 CATGGGAAATTGCACCCAGATGG + Intronic
1108672972 13:52710528-52710550 CCTTGGATCTTGAAGCCAGCAGG - Intronic
1111074676 13:83218018-83218040 CATTGGATGTTGTAGCAAGATGG + Intergenic
1111167808 13:84485122-84485144 CATTGGATATTGTAGCAAGGAGG + Intergenic
1112643360 13:101302054-101302076 CAAAGGAAATTGAAGCAAAAGGG + Intronic
1112809378 13:103199834-103199856 CATAGGATATTACTGCCAGATGG + Intergenic
1113680104 13:112237912-112237934 CATAGAATTTTAAATCCAGAGGG - Intergenic
1114538664 14:23438822-23438844 CAAAAGATTTTGAAGCCAGCAGG - Intergenic
1116387692 14:44351959-44351981 GAGAGAAAATTGAAGCCAGAGGG - Intergenic
1116521138 14:45848513-45848535 CATAGAATAATGCAGCAAGAAGG + Intergenic
1116684055 14:48015559-48015581 CTTTGGATATTGAACCTAGATGG - Intergenic
1117110233 14:52445984-52446006 AATAGGAGAGTGAAGCAAGATGG + Intronic
1120878226 14:89394005-89394027 CATGGGATAATGGAGCAAGAAGG - Intronic
1124159193 15:27253588-27253610 CAGAGGATGCTTAAGCCAGAGGG - Intronic
1124389436 15:29240567-29240589 CATGGGATATTGCAGCAAAAAGG + Intronic
1126436056 15:48638967-48638989 CATAGGATGTTAGAGCCAGTGGG - Intronic
1127676773 15:61246839-61246861 CATAAAATAATAAAGCCAGAAGG + Intergenic
1129151406 15:73690537-73690559 AATAGGATAATGCAGCAAGAAGG - Intronic
1130974401 15:88762231-88762253 CATGGGATAGGGAAGCCAGATGG - Intergenic
1131996852 15:98141687-98141709 CATAGGGTTTTGAAGGCACATGG + Intergenic
1132289928 15:100692858-100692880 CATAAGAAATGGAAGCCAGAGGG - Intergenic
1134358083 16:13503064-13503086 GGAAGGATATTTAAGCCAGAAGG + Intergenic
1135476152 16:22777423-22777445 AAAAGGATATTGAACACAGAAGG + Intergenic
1135829876 16:25763628-25763650 CATGGAATATTGCAGGCAGAGGG + Intronic
1137400895 16:48153762-48153784 CATAGGAAATTGGTGCTAGAAGG + Intronic
1138063931 16:53920888-53920910 CTCAGGAGAGTGAAGCCAGAAGG - Intronic
1138208588 16:55143820-55143842 CATAGGATGATGCAGCAAGAAGG + Intergenic
1141334391 16:83141147-83141169 CAGAGAATATTAAAGCCGGAGGG + Intronic
1143746754 17:9000634-9000656 GAAAGGAAATTAAAGCCAGATGG + Intergenic
1144005508 17:11095839-11095861 CTTAACATATTGAAGCCAAATGG + Intergenic
1144240434 17:13305415-13305437 CAAAGCATTTTGAAGACAGAAGG + Intergenic
1144522322 17:15961705-15961727 CATGGGATGATGCAGCCAGAAGG - Intronic
1145940142 17:28739015-28739037 CAGGGGGTGTTGAAGCCAGATGG + Intronic
1151638476 17:75370403-75370425 AACAAGATATTGAAGTCAGAAGG - Intronic
1152996562 18:412277-412299 CAGAAAATATGGAAGCCAGAAGG + Intronic
1153181136 18:2435005-2435027 CATAGGATGATGCAGCAAGAAGG + Intergenic
1156377873 18:36531046-36531068 CACAGGATGTTAGAGCCAGAAGG + Intronic
1157189671 18:45570252-45570274 CATAGAATTTTGGAGCCAAAGGG - Intronic
1157778183 18:50413437-50413459 CATAGAATATTAAAACTAGAAGG - Intergenic
1158049871 18:53204033-53204055 CATATGATATTCATGCCAAATGG - Intronic
1158293193 18:55964970-55964992 CATAGTATACTGAGCCCAGAAGG + Intergenic
1160251024 18:77203530-77203552 CATGGGATAAAGAAGCCAGAAGG - Intergenic
1163345214 19:16736977-16736999 AGTAGAATGTTGAAGCCAGAAGG + Intronic
1164741705 19:30580662-30580684 CATAGGAGCCTGAACCCAGAGGG - Intronic
927881332 2:26692162-26692184 CACAGCATATTGCAGCCAGGAGG - Intergenic
928373234 2:30756299-30756321 CATAGGCTATTGCACCCAGCTGG - Intronic
928444831 2:31324335-31324357 AGAAGGAAATTGAAGCCAGAAGG + Intergenic
928950037 2:36806297-36806319 CATAGAATATTAAAGCTGGAAGG - Intronic
933286545 2:80390444-80390466 TGCAGGATATTGATGCCAGAAGG + Intronic
933598019 2:84302249-84302271 CATAGGATGATGCAGCAAGAAGG - Intergenic
934987624 2:98899352-98899374 CATAGGACCTTGTAGTCAGAGGG + Intronic
935111354 2:100097331-100097353 CATAGAATTTTGAAGCTGGAAGG + Intronic
935847961 2:107187401-107187423 CATAGGAGATTGTAGCCCTAGGG + Intergenic
936123614 2:109767833-109767855 CATAGAATTTTGAAGCTGGAAGG - Intergenic
936221072 2:110603633-110603655 CATAGAATTTTGAAGCTGGAAGG + Intergenic
937365079 2:121255693-121255715 CCTTGAATATTGGAGCCAGATGG - Intronic
937677860 2:124611340-124611362 CATAGGACTTTGTATCCAGATGG - Intronic
938128173 2:128689515-128689537 CATAAGAAATTAAAGCCTGAGGG - Intergenic
939645637 2:144695166-144695188 CATAGGGTACTGAGGCCAGATGG - Intergenic
943107450 2:183563456-183563478 CAGAGGATAATGATGCCAGATGG + Intergenic
944761663 2:202821888-202821910 CACAGGAAACTGAAGCCAGGAGG - Intronic
945030140 2:205655737-205655759 CATAGGGTATTGGAGCTAAAAGG + Intergenic
945902521 2:215555035-215555057 CAAAGGATAGAGAATCCAGAGGG + Intergenic
945989245 2:216379986-216380008 CATGGAATAGTGAAGCTAGAAGG - Intergenic
1169152045 20:3296993-3297015 AACAGGATATGGAAGCCACATGG + Intronic
1170671058 20:18434197-18434219 CATAGGAAATTGTAGCATGATGG + Intronic
1171503576 20:25614599-25614621 CAGAGGAAATTTAAGGCAGATGG + Exonic
1174770236 20:53292672-53292694 AAAAGGAAATTGTAGCCAGAAGG - Intronic
1174824459 20:53756845-53756867 CAAAGGATAGTGAAGCTGGAAGG - Intergenic
1177146109 21:17408926-17408948 CATATGATATGGAAGCTAAAGGG + Intergenic
1177281737 21:18989908-18989930 AGTAGTATATTGAAACCAGAGGG - Intergenic
1177350628 21:19936240-19936262 CTTAGGATGATGAAGCAAGAAGG + Intergenic
1178860092 21:36281751-36281773 CATAGGATGTTGCAGCAAGAAGG - Intronic
1181897240 22:26121333-26121355 AAAAGGACATTGAGGCCAGAGGG - Intergenic
1182319359 22:29468386-29468408 CATAAAATATTCAAGCCAGAAGG + Intergenic
1183122718 22:35742721-35742743 CATAGAAAATTACAGCCAGATGG + Intronic
1184741676 22:46432171-46432193 GATGGGATATTCAAGGCAGATGG + Intronic
951767561 3:26216400-26216422 CATAAGAAGTTGAAACCAGATGG + Intergenic
953010055 3:39016456-39016478 CATAGGAAAATGATGCCAGGTGG - Intergenic
953475416 3:43201891-43201913 CCTAGGAGATAGAAGACAGATGG - Intergenic
953919213 3:46940412-46940434 CAGAGGGAAATGAAGCCAGAGGG + Intronic
954934872 3:54317457-54317479 CATGGGATGATGAAGCAAGAAGG - Intronic
955557870 3:60157449-60157471 CATAGAATATTCAAACTAGAAGG - Intronic
956226759 3:66968887-66968909 AATAGGATCTTGGAGCAAGAAGG + Intergenic
956401916 3:68888686-68888708 CATGGGATAATGTAGCAAGAAGG - Intronic
959593468 3:108103882-108103904 CATAGAATATTAGAGCTAGAAGG - Intergenic
960142780 3:114166865-114166887 CATAGAATATTAAAGCTGGAAGG - Intronic
960484323 3:118233049-118233071 CAGAGGAATTTGAAGTCAGAGGG - Intergenic
960698789 3:120420749-120420771 CATAGGATCTTAAATCTAGAAGG - Intronic
961090991 3:124112641-124112663 TATAGGATATGGAAAACAGAAGG - Intronic
961320563 3:126070557-126070579 CATCAGAAATAGAAGCCAGAAGG + Intronic
962482816 3:135812229-135812251 CACAGGATATTGACTCCATATGG - Intergenic
962979049 3:140471249-140471271 CAAATGATATTAAAGCCAGGAGG - Intronic
964181594 3:153894191-153894213 CATGGGATGATGAAGCAAGAAGG + Intergenic
965817957 3:172656334-172656356 CATAGGATCTGGAAAGCAGATGG + Intronic
966215730 3:177500323-177500345 CACAGGGCATTGCAGCCAGAGGG + Intergenic
967444487 3:189549668-189549690 CATATGAGAATGAAGCAAGAAGG + Intergenic
967783420 3:193464696-193464718 CATAGGATATCAAAGCTGGAAGG + Intronic
970084478 4:12331225-12331247 CATAAAATAATGAAGCAAGAAGG + Intergenic
970152882 4:13108282-13108304 CATGGGATAATGCAGCAAGAAGG - Intergenic
970171809 4:13298263-13298285 CATAGAATGTTTGAGCCAGAAGG + Intergenic
971435392 4:26617159-26617181 CATGGGATAATGCAGCAAGAAGG - Intronic
972009394 4:34158048-34158070 GATAGAATATTAAAGCAAGATGG + Intergenic
973993148 4:56432030-56432052 CACTGGATATTTAACCCAGATGG - Intronic
976329702 4:83815249-83815271 ATCAGGATATTGAAGTCAGAAGG + Intergenic
977712494 4:100143886-100143908 CATGGGATAATGCAGCAAGAAGG + Intergenic
979467474 4:121057307-121057329 CATGGGATTTTGGAACCAGAAGG + Intronic
979791750 4:124792164-124792186 TGTAGGGTATTGAAACCAGAAGG - Intergenic
980994873 4:139770562-139770584 AATAGGATACTGATGTCAGAGGG + Intronic
982646260 4:158027723-158027745 CAGATGATATGGAACCCAGAGGG + Intergenic
982822153 4:159954609-159954631 CATAGTATACTGCAACCAGAAGG - Intergenic
983885044 4:172971161-172971183 CATAGGATGATGCAGCAAGAAGG + Intronic
984342792 4:178480263-178480285 CAAAGGCTATAGAAGCCAGCTGG - Intergenic
986212259 5:5685225-5685247 CATAGGATATCGAAACAAGATGG + Intergenic
987218975 5:15770070-15770092 CACAGACTATTAAAGCCAGATGG + Intronic
988606507 5:32683167-32683189 CATAGTATATAGTAGCAAGATGG - Intergenic
990565748 5:57026836-57026858 CACAAGATATTGGAGCTAGAAGG + Intergenic
992648638 5:78835759-78835781 CACAGAACACTGAAGCCAGAGGG + Intronic
993843282 5:92907638-92907660 CAAAGGATGTTGAATCCAGTAGG + Intergenic
994550190 5:101224206-101224228 CATAGAAAATTGTAGCCAAAAGG + Intergenic
995118974 5:108515788-108515810 AATAGGTTATTCAAGCCAGCTGG - Intergenic
995233017 5:109792410-109792432 CATAGGAAATTGAAGACAAAAGG - Intronic
996389895 5:122948536-122948558 CGTGGGAAATTGAGGCCAGAGGG - Intronic
999850267 5:155529973-155529995 CCTGGGATACTGAAGCCACAGGG - Intergenic
1000277478 5:159751159-159751181 TAGAGGATAATTAAGCCAGAAGG + Intergenic
1000286550 5:159831484-159831506 CACAGAATTTCGAAGCCAGACGG - Intergenic
1001306863 5:170581186-170581208 CACAAGTTATTGGAGCCAGATGG + Intronic
1003507375 6:6751109-6751131 CATAGGACATTAATCCCAGAGGG + Intergenic
1003940617 6:11021827-11021849 CAGAGGATTCTGAAGCCAAAAGG - Intronic
1004039878 6:11965092-11965114 CATAGGATGATGCAGCAAGAAGG - Intergenic
1004230188 6:13826078-13826100 CATGGGATGATGAAGCAAGAAGG - Intergenic
1007907482 6:45476944-45476966 CATAGGAACTTGAAGCCATTGGG + Intronic
1009623330 6:66103645-66103667 CATAGGAAATTGAAGGTAAAAGG - Intergenic
1010062846 6:71645334-71645356 CATGGGATAATGCAGCAAGAAGG - Intergenic
1010336104 6:74685103-74685125 CATAGGATACTTTAGCCATAAGG + Intergenic
1012055368 6:94400318-94400340 CATAGAATATTACAGACAGAAGG + Intergenic
1014781472 6:125569961-125569983 AATAGGATTTTTAAGGCAGATGG - Intergenic
1016812677 6:148276319-148276341 CATAGAACTCTGAAGCCAGAAGG + Intronic
1021809553 7:24390121-24390143 AAGAGGAAATTGAAGCCATAGGG - Intergenic
1024666266 7:51550205-51550227 GATGGGAGAGTGAAGCCAGAGGG + Intergenic
1025951200 7:66146879-66146901 CATATGATCTTTAACCCAGAGGG - Intronic
1026897457 7:74018516-74018538 CAGAGGAGATTGAAGCCTGCTGG - Intergenic
1028960248 7:96740493-96740515 CATGGCATATTGAAAACAGAAGG - Intergenic
1030357572 7:108559234-108559256 CATAGGGTATGGGAGCTAGACGG + Intronic
1031384796 7:121135747-121135769 CATAGGATATAAAAGCTATAAGG + Intronic
1037184742 8:16048906-16048928 CCTAGGATGTTGAAGACAAAAGG - Intergenic
1038217560 8:25576784-25576806 CATGGGTTAGTGAACCCAGAAGG - Intergenic
1041638511 8:60171395-60171417 CATAGGATAATGCAGCATGAAGG + Intergenic
1042241365 8:66667326-66667348 CCTAGGATCTTGAGTCCAGAAGG + Intergenic
1042381159 8:68115753-68115775 AATATGTTATTGAAGACAGAAGG - Exonic
1042949491 8:74186189-74186211 CCAAGGATTTTGAATCCAGACGG + Intergenic
1043227856 8:77755335-77755357 CATTTAATATTAAAGCCAGATGG - Intergenic
1045195902 8:99929459-99929481 AACAGGATATGGAAGCCAAATGG + Intergenic
1045415239 8:101959890-101959912 CCTAAGGTATTGAAGCCTGAGGG - Intronic
1046400106 8:113694088-113694110 CAGAGGTCATGGAAGCCAGAAGG - Intergenic
1047576991 8:126167148-126167170 CAAACCATATTGAAGACAGATGG - Intergenic
1048582322 8:135739917-135739939 CATAAGATTTGGAAGGCAGAGGG + Intergenic
1049246442 8:141565307-141565329 CAAAGGACTTTGAGGCCAGAGGG - Intergenic
1050225143 9:3445496-3445518 GATTGGATTATGAAGCCAGATGG - Intronic
1051107248 9:13594162-13594184 TTTAAGATATTGGAGCCAGAGGG + Intergenic
1051334746 9:16055569-16055591 CATAGTATATTGCAGGAAGAAGG + Intronic
1051876150 9:21795826-21795848 CAGAGGATGGTGGAGCCAGATGG + Intergenic
1052006314 9:23353719-23353741 TATAGGATAATGAGGCCAAAAGG - Intergenic
1052839877 9:33283705-33283727 TATGAGAGATTGAAGCCAGAGGG + Intergenic
1055692704 9:78850551-78850573 CAGAAGCTATGGAAGCCAGAAGG - Intergenic
1056853998 9:90109284-90109306 CATGGGATAATGCAGCAAGAAGG - Intergenic
1057975895 9:99605865-99605887 CATAGGATGAAGAACCCAGAAGG + Intergenic
1059751345 9:117250335-117250357 AATAAGATAATGAAGACAGAAGG + Intronic
1061661245 9:132131707-132131729 CTCAGGAACTTGAAGCCAGAAGG - Intergenic
1061758831 9:132835615-132835637 CAGAGGAGAATGAGGCCAGAGGG - Intronic
1062069747 9:134549304-134549326 CAGAAGGTACTGAAGCCAGAAGG - Intergenic
1062477861 9:136738199-136738221 CATAAGAGATTGCAGCCAGCAGG + Intronic
1203442748 Un_GL000219v1:26466-26488 CATAGGTTATCGATGGCAGAAGG + Intergenic
1203513556 Un_KI270741v1:145375-145397 CATAGGTTATCGATGGCAGAAGG + Intergenic
1192140132 X:68639788-68639810 CAAAGAATACTGAAGCTAGAAGG + Intergenic
1194902892 X:99536502-99536524 CAGAAAATATGGAAGCCAGAAGG + Intergenic
1196179459 X:112673837-112673859 CAAAAAATATTGAAGACAGAAGG + Intronic
1196365090 X:114914957-114914979 CATGGGATAATGTAGCAAGAAGG - Intergenic
1196501280 X:116385737-116385759 CATAGAATATTGGAGCTTGATGG - Intergenic
1196751342 X:119120314-119120336 TATGGGATTTTGAAGCAAGAGGG - Intronic
1196999401 X:121422028-121422050 CATAGGATACTGAAGTAGGAAGG - Intergenic
1197850156 X:130850042-130850064 CATAGGATATTAGATCTAGAGGG - Intronic
1198003079 X:132460381-132460403 AATAGGATTCTGGAGCCAGAAGG + Intronic
1198200962 X:134418248-134418270 AATAGGATATGGTAGACAGAAGG + Intronic
1198674139 X:139113874-139113896 CTGAGAATATTGGAGCCAGAAGG - Intronic