ID: 914735460

View in Genome Browser
Species Human (GRCh38)
Location 1:150412084-150412106
Sequence CTATCGCCCAGGCCAGAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12028
Summary {0: 2, 1: 16, 2: 331, 3: 4395, 4: 7284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914735460_914735462 10 Left 914735460 1:150412084-150412106 CCGCACTCTGGCCTGGGCGATAG 0: 2
1: 16
2: 331
3: 4395
4: 7284
Right 914735462 1:150412117-150412139 AGTCTCCAAAAAAAAGAATAAGG 0: 1
1: 0
2: 14
3: 302
4: 2541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914735460 Original CRISPR CTATCGCCCAGGCCAGAGTG CGG (reversed) Intronic
Too many off-targets to display for this crispr