ID: 914739488

View in Genome Browser
Species Human (GRCh38)
Location 1:150451838-150451860
Sequence CCATATAAGAAGAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 508}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914739484_914739488 -7 Left 914739484 1:150451822-150451844 CCGATATAACTGGTGTCCATATA 0: 4
1: 20
2: 341
3: 1146
4: 2100
Right 914739488 1:150451838-150451860 CCATATAAGAAGAGGGAAACTGG 0: 1
1: 0
2: 6
3: 57
4: 508
914739482_914739488 3 Left 914739482 1:150451812-150451834 CCTTAATCATCCGATATAACTGG 0: 1
1: 0
2: 0
3: 5
4: 50
Right 914739488 1:150451838-150451860 CCATATAAGAAGAGGGAAACTGG 0: 1
1: 0
2: 6
3: 57
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914739488 Original CRISPR CCATATAAGAAGAGGGAAAC TGG Intronic
900351736 1:2238284-2238306 CCATAAAAAAAGAGGGCCACGGG - Intronic
900847331 1:5114433-5114455 GCTTATAAGATGAGGGAAGCAGG + Intergenic
900848025 1:5119182-5119204 GCTTATAAGATGAGGGAAGCAGG + Intergenic
901128652 1:6948252-6948274 CCATATATGAAGATGGCAGCTGG - Intronic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
901436308 1:9249224-9249246 CCACATACCAAGAAGGAAACAGG - Intronic
901692787 1:10984459-10984481 CTTTATAAGAAGAGGAAAATTGG - Intergenic
902328802 1:15720331-15720353 CCCTAGAAGAAGAGAGAACCAGG + Intronic
902647197 1:17808035-17808057 CCATAAAATGAGATGGAAACTGG + Intronic
904166737 1:28561455-28561477 CCATATAGGAGGAGGGGAGCCGG + Intronic
905136795 1:35806754-35806776 CCTTATAAGAAGAGGAAATTTGG + Intergenic
905277850 1:36830504-36830526 CCGTATAAGAAGAGGAAAAGAGG + Intronic
906052350 1:42886294-42886316 TCATATAAGAAGAGGGAAAGAGG - Intergenic
906142963 1:43544652-43544674 CCATAAGAGGACAGGGAAACAGG - Intronic
907034888 1:51207404-51207426 CCATTTAAAAAGACAGAAACTGG + Intergenic
907567778 1:55452332-55452354 GCTTATAAGAAGAGAGACACCGG - Intergenic
907957527 1:59244395-59244417 CCTTTTAAGAAAAGGGAAATTGG - Intergenic
910057893 1:83053470-83053492 TCATGTAAGAAGTGGGAGACTGG - Intergenic
910112904 1:83701297-83701319 CCTTGTAAGAAGAGGAAATCTGG + Intergenic
911506373 1:98757466-98757488 CCTTATAAGAAGAGGAAATCTGG - Intronic
911657737 1:100463934-100463956 GCATAAAATGAGAGGGAAACCGG - Intronic
914315636 1:146508910-146508932 CCTTATAAGAAGAGGAAATTTGG - Intergenic
914433897 1:147643040-147643062 CCTTATAAGAAGAGGAAATGAGG - Exonic
914498719 1:148224451-148224473 CCTTATAAGAAGAGGAAATTTGG + Intergenic
914739488 1:150451838-150451860 CCATATAAGAAGAGGGAAACTGG + Intronic
915661402 1:157408675-157408697 CCTTATAAAAAGAGGGAATCTGG - Intergenic
915921779 1:159981193-159981215 CCTTATAAGAAAAGGAAACCAGG + Intergenic
916002635 1:160631618-160631640 CCTTATAAGAAGAGGAAATCTGG + Intronic
916197313 1:162236646-162236668 CCAAAGAAAAAGAGGGAAAGGGG - Intronic
916216171 1:162397042-162397064 CCAAGAAAGAAGAGTGAAACTGG + Exonic
916324247 1:163539444-163539466 CCATCTATAGAGAGGGAAACAGG - Intergenic
916456115 1:164972512-164972534 CCATATAATAAAAGGCAGACGGG - Intergenic
916655323 1:166870279-166870301 CCTTATAAGAAGAGGCAATTAGG + Intronic
916885102 1:169059825-169059847 CCTTATAAGAAGAGGAAATTTGG + Intergenic
917056098 1:170983465-170983487 CTACATCAGAAGAAGGAAACTGG - Exonic
917625937 1:176846378-176846400 CCCTAACAGAAGAGGGAAGCTGG + Intergenic
918471934 1:184884174-184884196 CCAGGGAAGAAGAGGGAAACAGG - Intronic
919519789 1:198573382-198573404 CCATATAAAAATGGGAAAACGGG + Intergenic
919760215 1:201093272-201093294 CCTTATAAGAAGAGGAACTCTGG + Intronic
920446926 1:206024710-206024732 CCTTATAAGAAGAGGAAATGTGG - Intergenic
921125098 1:212170512-212170534 CTTTATAAGAAGAGGAAAAGGGG + Intergenic
922141334 1:222890896-222890918 CCTTATAAAAAGAGGAAATCTGG - Intronic
923617358 1:235548890-235548912 CCATCTAAGAAGAGGGAACTAGG + Exonic
923880365 1:238097695-238097717 CCATTTAAGAACCAGGAAACAGG - Intergenic
924513680 1:244749105-244749127 CCTTATAAGAAGAGGGGATTAGG + Intergenic
924580182 1:245316729-245316751 CCAAATCAGTATAGGGAAACTGG - Intronic
1064118620 10:12600227-12600249 CCATGTAAGAAGCGGGGAACTGG - Intronic
1064356729 10:14625520-14625542 GCTCATAAGAACAGGGAAACAGG + Intronic
1064911142 10:20403144-20403166 ACATTTAATAAGAGGCAAACTGG + Intergenic
1065751144 10:28888629-28888651 CCATATATAAAGAGAGAGACAGG + Intergenic
1066120631 10:32282966-32282988 CTATAAAAGTAGAGAGAAACTGG + Intronic
1066800467 10:39183179-39183201 CAATAGAAAAAGAGGGAATCCGG + Intergenic
1067783016 10:49222835-49222857 CCATACCAAAAGAGAGAAACTGG + Intergenic
1068066697 10:52140837-52140859 CTATATAAGAAGAAGAATACAGG - Intronic
1068522697 10:58094772-58094794 CCAAATAAGAGGAGAAAAACAGG + Intergenic
1068731683 10:60365059-60365081 CCATACAAGATGAGGGAAAATGG - Intronic
1068986995 10:63116841-63116863 GCATATATAAAAAGGGAAACAGG + Intergenic
1069025678 10:63538431-63538453 TTATATAAGACGAGGAAAACGGG + Intronic
1069798888 10:71070208-71070230 CCCTAAGAGAATAGGGAAACTGG + Intergenic
1069963369 10:72092556-72092578 CTTTATAAGAAGAGGGAATTTGG - Intergenic
1072918263 10:99553826-99553848 CCTCATAAGAAGAGGGGATCGGG - Intergenic
1073545993 10:104349456-104349478 CCTTACAAGAAGAGGAAAATTGG - Intergenic
1074578786 10:114696432-114696454 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1074657349 10:115607865-115607887 CCATATACGAAGAAGGAATAGGG - Intronic
1076183119 10:128426111-128426133 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1076303044 10:129442243-129442265 CCTTATAAAAAGAGGGAGACTGG + Intergenic
1076781179 10:132725462-132725484 CCACATAAGAACTGGGAAGCGGG + Intronic
1077475127 11:2784005-2784027 CCATATAAGAAAAGACAAATTGG - Intronic
1077527232 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG + Intergenic
1078361386 11:10670746-10670768 CCTTATAAGAAGAGGAAATTTGG + Intronic
1079072248 11:17357338-17357360 CCTTATAAGAAGAGGAAATTAGG - Intronic
1079590299 11:22175359-22175381 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1079713530 11:23716796-23716818 CCATATAGGAAGAGGAAATATGG + Intergenic
1080038033 11:27729680-27729702 TTTTATAAGAAGAGAGAAACTGG + Intergenic
1081205494 11:40270398-40270420 CCTTTTAAGAAGAGGAAATCTGG - Intronic
1082781057 11:57287681-57287703 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1082852255 11:57775854-57775876 CCATATAAGAACAAGGAAACAGG - Intronic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1084122249 11:67076502-67076524 CCAAATAAGAGGAGGGAAGTCGG + Intergenic
1084547888 11:69823468-69823490 CCTTATAAGAAGAGGTAATGAGG - Intergenic
1084893437 11:72248758-72248780 CCATCAAAGAAGAAGGAGACAGG + Intergenic
1086184036 11:83991942-83991964 CCTTATAAGAAGAGGAAATTTGG + Intronic
1086932074 11:92704576-92704598 CCTTATAAGAAGAGGAAATTTGG + Intronic
1087696571 11:101384163-101384185 TCTTATCAGAAGAGGAAAACAGG - Intergenic
1088230951 11:107672700-107672722 CCTTATAAGAAGAGTCAAAGAGG - Intergenic
1088755559 11:112882411-112882433 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1088924731 11:114289945-114289967 CTATCTACGAAGAAGGAAACAGG - Intronic
1089189968 11:116646555-116646577 CCAGATAATAAGTGGGAGACAGG - Intergenic
1090036187 11:123251753-123251775 CCTTATAAGGAGGGGGAAATTGG + Intergenic
1090523209 11:127501024-127501046 CCAGAGGAGAAGAGGGAGACGGG - Intergenic
1090644443 11:128756368-128756390 TCTTATAAGAAGAGGGAATTTGG - Intronic
1091807943 12:3369290-3369312 CCATCTATGAATAGGGAAATGGG + Intergenic
1093257037 12:16881379-16881401 CCATACAAGAAGAAGAAAAACGG + Intergenic
1093475504 12:19549878-19549900 CCTTATAAGAAAAGAAAAACAGG - Intronic
1093529879 12:20148063-20148085 CTATATAAAAAGAGGGAGCCAGG - Intergenic
1094080841 12:26533642-26533664 CCCTATAAGAAGAGGAAATTTGG + Intronic
1094310127 12:29071157-29071179 CCTTATAAGAACAGTGAAACTGG - Intergenic
1095581883 12:43809399-43809421 ACATATAACAAGAGAGAAAATGG - Intergenic
1096719475 12:53510337-53510359 CCTTTTAAGAAGTGGTAAACTGG - Intronic
1096828477 12:54297053-54297075 CCATATCAGTATAGGGAAGCAGG + Intronic
1097412994 12:59279059-59279081 CCATGTAAGAACATGGATACAGG + Intergenic
1097467850 12:59950253-59950275 CAATAGAAAAAGAGGGAATCCGG + Intergenic
1098160565 12:67645169-67645191 CCATTTATGAACAAGGAAACAGG - Intergenic
1098938077 12:76503357-76503379 CCTTATAAGAAGAGGAAATTTGG - Intronic
1099230552 12:80019021-80019043 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1099362589 12:81724016-81724038 AAATATAAGAAAAGTGAAACAGG + Intronic
1100216549 12:92455965-92455987 CCTTATAAGAAAAGGGAATTTGG - Intergenic
1100365088 12:93912936-93912958 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1100442741 12:94631430-94631452 CCTTATAAGAAGAGAAAATCTGG + Intronic
1100615662 12:96229828-96229850 CCTCATAAGAAGAGGAAAATCGG - Intronic
1100659959 12:96686241-96686263 CCATATAAGAAGAGGAGATTAGG - Intronic
1101274020 12:103179467-103179489 CCATGTAAGAAAAGGCAAAGAGG + Intergenic
1101282519 12:103273247-103273269 CCATAAAAGAAGAAGGAATGTGG + Intronic
1102663042 12:114546273-114546295 CCTTACAAGAAGAGGAAATCTGG + Intergenic
1102665010 12:114564357-114564379 CCTTACAAGAAGAGGAAATCTGG - Intergenic
1102749322 12:115278448-115278470 CCTTATAAGAAGAGGCAACTAGG - Intergenic
1103015750 12:117493403-117493425 TCATATGAGAAGAGGGAAAATGG - Intronic
1103592591 12:122002869-122002891 CAATAAAAGGAGAGGGAAAAGGG - Intronic
1104004588 12:124883040-124883062 CCTTATAAGAAGAGGGACATCGG + Intergenic
1105750625 13:23419583-23419605 CAATATAAGAAAAGAGAAAAAGG - Intronic
1106219649 13:27735030-27735052 CCTTATAAGAAGAGGAAATGGGG + Intergenic
1106625781 13:31419459-31419481 CCTTATAAGAAGAGAGAATTTGG + Intergenic
1107418858 13:40226745-40226767 CCATATAAGAATACAGGAACAGG + Intergenic
1108064343 13:46562475-46562497 CCTTATAAGAAGAGGAAATTTGG - Intronic
1108203362 13:48063447-48063469 CCTTATAAGAAGAGAAAATCTGG + Intronic
1108267177 13:48723488-48723510 CCTCATAGGATGAGGGAAACTGG - Intergenic
1108714027 13:53061205-53061227 CCAAACAACAAGAGGGTAACAGG + Intergenic
1109012978 13:56974346-56974368 CCATTTAGAAAGAGGGAAGCAGG - Intergenic
1109376026 13:61494309-61494331 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1109894365 13:68664794-68664816 CCTTATAAGAAGAGGAGAATAGG - Intergenic
1110605528 13:77427569-77427591 CCTTATAAGAAGAGGAGAATAGG - Intergenic
1111090076 13:83434407-83434429 CCATCTATGAATTGGGAAACAGG + Intergenic
1111825915 13:93267445-93267467 CAATATATAAAGAGGAAAACTGG - Intronic
1112073733 13:95884450-95884472 TCATATAAAGAGAGAGAAACAGG - Intronic
1112128797 13:96498785-96498807 CCAAATAAGAACGGGGACACTGG - Intronic
1114221223 14:20699235-20699257 GCATATAAGAAGGAGGAAAGAGG + Intronic
1114478817 14:23018087-23018109 CCTTATAAGAAGAGGGAATTTGG + Intronic
1114768657 14:25404021-25404043 CCATCTATGAAGCAGGAAACAGG - Intergenic
1114965186 14:27950247-27950269 CCATGTAAGAAGAGGAAATTAGG + Intergenic
1115268749 14:31527982-31528004 TCTTATAAGAAGAGGAAATCTGG - Intronic
1116421314 14:44736083-44736105 CCTTAAAAGAAGAGGAAATCAGG - Intergenic
1116870530 14:50065624-50065646 CCTTATAGGAAGAGGAAAATGGG - Intergenic
1116982106 14:51182687-51182709 CCATAAAAAAGGAGGGAAAGAGG + Intergenic
1118387492 14:65268383-65268405 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1118949490 14:70421257-70421279 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1119684799 14:76623058-76623080 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
1119966062 14:78916948-78916970 CCTTATAAGAAGAGGAAACTTGG - Intronic
1120222702 14:81752668-81752690 TAAAATAAGAAGAGAGAAACAGG - Intergenic
1120624747 14:86811012-86811034 CCATATCAGAAAACTGAAACTGG - Intergenic
1120639562 14:86993973-86993995 CCATATCAGAAGATTGAAGCTGG + Intergenic
1122954883 14:105065985-105066007 CCATGTAGGAAGAGGGAGGCGGG - Intergenic
1124201988 15:27686614-27686636 CCCTATAAGAAAAGGTAAATAGG + Intergenic
1124449489 15:29773066-29773088 ACATATATTAAGAGGGAAACTGG - Intronic
1125033597 15:35097637-35097659 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1125283104 15:38064171-38064193 CCTTATAAGAAGAGGAAATCTGG + Intergenic
1125517440 15:40330265-40330287 GCTTATAAGAAAAGGGAAAAAGG + Intergenic
1126176650 15:45742187-45742209 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1127263457 15:57343097-57343119 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1127344738 15:58083149-58083171 CCTTATAAGAAGAAGAAATCTGG - Intronic
1127646746 15:60966167-60966189 CCTTATAAGAAGAGGAAATGTGG - Intronic
1128458738 15:67850017-67850039 CCTTATTAGAAGAGGAAATCTGG + Intergenic
1128616128 15:69111424-69111446 CCATATAAGAAAAGGAGATCAGG + Intergenic
1130182031 15:81639539-81639561 CCATTTAAAAAGAGAAAAACAGG + Intergenic
1130222294 15:82029902-82029924 CCTTATAAGAAGTGGAAATCTGG + Intergenic
1130243672 15:82222249-82222271 ACATATAAGAAAAGGGAGACTGG + Intronic
1130251076 15:82300708-82300730 CCCTATTAGGAGAGGAAAACGGG - Intergenic
1130841498 15:87705154-87705176 TCAGAGAAGAAGGGGGAAACGGG - Intergenic
1131102833 15:89706923-89706945 CCATAAAAGAAAAGATAAACTGG + Intronic
1131327261 15:91459883-91459905 CCTTATAAGAGGAGGGGATCAGG - Intergenic
1132179792 15:99743656-99743678 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1133231450 16:4368961-4368983 CCTTATGAGAGGTGGGAAACAGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133600154 16:7332228-7332250 CCATATAACAAATGGGAAACAGG - Intronic
1133651009 16:7814647-7814669 ACATATAAGAAGAGGGCACCAGG + Intergenic
1133849512 16:9488883-9488905 CCTTATGAGAAGAGGAAATCTGG + Intergenic
1133856545 16:9554839-9554861 ACCTATAAGAAGAGGAAATCAGG - Intergenic
1133977180 16:10607551-10607573 CCTTATGAGAAGAGGAAATCTGG + Intergenic
1134527583 16:14956308-14956330 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1135060932 16:19270814-19270836 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1136252036 16:29011669-29011691 CCATAAATGAAGTGGGACACAGG + Intergenic
1137293968 16:47072376-47072398 TCATACAAGAAGGAGGAAACAGG + Intergenic
1137502779 16:49024275-49024297 CCATGTAAGAAGAGGAAACTGGG - Intergenic
1137539205 16:49350381-49350403 CCTTATGAGAAGAGGAAAAGGGG + Intergenic
1137573777 16:49584726-49584748 CCTCATAAGAAGAGGAAAATTGG - Intronic
1138502286 16:57454661-57454683 CCATATATGAGGTGGGTAACAGG + Intronic
1138520297 16:57567271-57567293 TCATAGAAGAAGAGGGAGATGGG + Intronic
1138691827 16:58775843-58775865 ACATATAAAAATTGGGAAACAGG + Intergenic
1138953345 16:61941257-61941279 CAATAAAAGAAGAGGAAAAAAGG - Intronic
1139280294 16:65764774-65764796 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1139451714 16:67032840-67032862 CCAAATAAGAAGAGGACAACTGG - Intronic
1139749403 16:69100066-69100088 CCATCAAAGGAGAGGGAGACTGG + Intergenic
1140192150 16:72827248-72827270 ATATATAAGATGAGGAAAACTGG - Intronic
1140663268 16:77207889-77207911 CCAGATGAGAAGAAGGAAGCAGG - Intronic
1140837822 16:78811670-78811692 CCTTATAAGAAGAGGACAAGGGG - Intronic
1140858145 16:78996027-78996049 CACTGAAAGAAGAGGGAAACTGG + Intronic
1141276580 16:82593848-82593870 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1141650725 16:85391599-85391621 CCTTATAAAAAGAGGGGAATTGG - Intergenic
1141778243 16:86138728-86138750 CCTTATAAGAAGAGGACAAGAGG - Intergenic
1141821196 16:86447216-86447238 CCTTATAAAAAGAGGAAAATTGG - Intergenic
1143310594 17:5985381-5985403 CCTTATAAGAAGAGGAAATTTGG + Intronic
1143771955 17:9174625-9174647 CCTTATTAGAAGAGGGCATCGGG - Intronic
1143896911 17:10143628-10143650 CCTTATAAGAAGAGGAAATTAGG + Intronic
1144169038 17:12640920-12640942 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1144214599 17:13044062-13044084 CCATTCAAGAAGAGTGAAATTGG - Intergenic
1146556928 17:33833369-33833391 CCAAAGAAGAAGAGGAAAAGGGG + Intronic
1147943777 17:44068586-44068608 CCATATAAAAAGTGGAAAACTGG - Intergenic
1148208832 17:45796020-45796042 CCAGAAAGGAAGAGTGAAACTGG - Intronic
1148462476 17:47846633-47846655 CCATGAAGGAAGAGGGAAAGAGG - Exonic
1148824056 17:50379116-50379138 TCCTCCAAGAAGAGGGAAACAGG + Exonic
1148837072 17:50470921-50470943 TCATAAAAGAAAAGGGAAAGTGG - Intronic
1148994946 17:51701285-51701307 CCTTATGAGAAGAGGGAAATTGG - Intronic
1150167428 17:62957334-62957356 CAATAGAGGAAAAGGGAAACGGG - Intergenic
1153037044 18:773423-773445 CCATATAAGAAATAGGAAAGGGG - Intronic
1153237150 18:2999293-2999315 CCTTATAAAAAGAGGAAATCTGG + Intronic
1153969781 18:10215690-10215712 CCAGACGAGAAGAAGGAAACAGG - Intergenic
1153990216 18:10390483-10390505 CCAGATAAGAATAGACAAACAGG - Intergenic
1155318410 18:24594831-24594853 TCCTATAAGAAGAGGGAATTTGG + Intergenic
1155326529 18:24670500-24670522 CCTTATAAGAAGAGGAAACTTGG + Intergenic
1155462373 18:26097371-26097393 CCATAAAACAACAGGAAAACGGG + Intergenic
1155752588 18:29445905-29445927 CCTTATAAGAAAAGAGAGACTGG - Intergenic
1156616875 18:38797297-38797319 ACATATAACAAGAGGAAAATGGG - Intergenic
1157113977 18:44845910-44845932 GTAAATAAGAAGAGGGCAACTGG + Intronic
1157788581 18:50509099-50509121 ACACATAAGAAAAAGGAAACAGG - Intergenic
1157822123 18:50779711-50779733 CCATCTAGAAAGAGGGAAGCAGG - Intergenic
1157932137 18:51834761-51834783 CCCTATATGAAGAGGGCAAAAGG - Intergenic
1158623795 18:59054786-59054808 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1158696521 18:59708845-59708867 CCCTATAAGAAGAAGGAAGGTGG - Intergenic
1158739775 18:60126941-60126963 CCATATAATAAAAAGAAAACGGG - Intergenic
1158747486 18:60218193-60218215 CCTTTTAAGAAGAGGAAATCTGG + Intergenic
1159000013 18:62965285-62965307 CCTTAAAAGAAGGGGAAAACTGG + Intronic
1159242934 18:65766677-65766699 CCATATAAAAACAAGAAAACAGG - Intronic
1159299062 18:66538864-66538886 CCTTATAAGAAGACAGACACTGG - Intronic
1159490036 18:69120604-69120626 CCTTAAAACATGAGGGAAACTGG - Intergenic
1159595479 18:70378771-70378793 TCATAGAAGCAGAGGGAAAGGGG - Intergenic
1162616920 19:11809302-11809324 CATTATGAGAAGAGGGGAACTGG + Intronic
1162868093 19:13564172-13564194 CCATATAGAAAGGGGAAAACTGG - Intronic
1163066228 19:14798098-14798120 CCATATAAGAAGGGGAAATTTGG + Intronic
1163715659 19:18870674-18870696 CCAGAGAAGAAGCGGGAAAGAGG - Intronic
1164890729 19:31821095-31821117 CCTTCTAAGAAGAGGAAAGCTGG - Intergenic
1165640451 19:37380826-37380848 CGCTCTAGGAAGAGGGAAACTGG - Intronic
1165781661 19:38438159-38438181 CCAAATAACAAGAAGGAATCAGG - Intronic
1166581516 19:43904024-43904046 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1167230788 19:48281823-48281845 CCTTATAAGAAGAGGAAATCTGG - Intronic
1168325041 19:55534248-55534270 CCTTATAAGAAGAGGAGATCAGG + Intronic
925062067 2:899794-899816 CCTTATAAGAAGAGGAAATGAGG - Intergenic
925588494 2:5487119-5487141 CCATAGAAGAATAGGGCACCAGG + Intergenic
925916297 2:8609019-8609041 CCTTATAAAAAGAGGGAGAGAGG - Intergenic
926160027 2:10481357-10481379 CCAAATAGGAAGAGGGACAAGGG + Intergenic
926218219 2:10918601-10918623 CCCCATAAAACGAGGGAAACTGG + Intergenic
926689602 2:15724381-15724403 CCTTATAAGAAGAGGAAATTTGG - Intronic
926926948 2:17996511-17996533 CCATCTAGAAAGAGGGGAACAGG - Intronic
927014979 2:18950285-18950307 ACAGAAGAGAAGAGGGAAACGGG + Intergenic
927050987 2:19328986-19329008 AAATATAAGAAGAGGGGAATGGG + Intergenic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
927197491 2:20558533-20558555 CCGTTTCTGAAGAGGGAAACTGG - Intergenic
928892067 2:36215892-36215914 CCTTATGAGAAGAGGAAATCGGG + Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929470078 2:42182918-42182940 CCTTATAAGAAGAGGAAATCTGG - Intronic
930149474 2:48044034-48044056 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
932689579 2:73900917-73900939 CTTTATAAGAAGAGGGAATTAGG - Intronic
932808256 2:74801339-74801361 CCTTATAAGAAGAGGAAATTTGG + Intergenic
933652458 2:84860357-84860379 CCATATAAGAAGAGGAGACTAGG + Intronic
933853557 2:86392102-86392124 CCATATGAGAAAACTGAAACTGG - Intergenic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
935500743 2:103835616-103835638 GCATATAAGAAGAGGAAAAGAGG + Intergenic
937014058 2:118587462-118587484 CCTCATAAGAAGAGGAAATCTGG + Intergenic
937033663 2:118762984-118763006 CCATAAAAGAGGAGAGAAAGTGG + Intergenic
938676394 2:133639625-133639647 TCATAAAAGGAGAGAGAAACAGG + Intergenic
938978637 2:136504544-136504566 CCTTATAAGAAGAGAAAATCTGG - Intergenic
939667908 2:144973191-144973213 TCATGTAAGCAGAGGGAAATAGG + Intergenic
939843408 2:147215695-147215717 CCTTATAAAAAGAGGGAATTTGG + Intergenic
940983628 2:160030198-160030220 CCATTTAAGAAAAGAGAAAAAGG + Intronic
941007321 2:160261423-160261445 CCTTATAAGAAGAGGAAATTTGG - Intronic
941238468 2:163006587-163006609 CCTTATAAGAAGAGGAAATATGG - Intergenic
941254504 2:163211669-163211691 CCATATAAGAAGAGGAAATCTGG - Intergenic
941956390 2:171209711-171209733 CCTTATAAGAAGAGGAAATTTGG + Intronic
942068030 2:172290250-172290272 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942270063 2:174265595-174265617 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG + Intronic
942934708 2:181541185-181541207 CCTTATAAGAAGAGGAAATTTGG + Intronic
943396343 2:187339635-187339657 CCATATAAGTGGAGTGAACCAGG + Intergenic
943742922 2:191430409-191430431 ACTTAAAGGAAGAGGGAAACAGG - Intergenic
944311946 2:198243429-198243451 CCTTATAAGAAGAGGAAATTAGG - Intronic
944761016 2:202813774-202813796 TAATATAATAAAAGGGAAACGGG + Intronic
945013778 2:205492668-205492690 CTTTATAAGAAATGGGAAACGGG + Intronic
945950325 2:216033508-216033530 CAAAATAAGCAGAGAGAAACAGG + Intronic
946136080 2:217648288-217648310 CCTTATAAGAAGAGGAAATTTGG - Intronic
946540109 2:220675230-220675252 CCATGTTAGACCAGGGAAACGGG - Intergenic
946585334 2:221180074-221180096 CCTTATGAGAAGAGGGAATCTGG + Intergenic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
947955307 2:234184724-234184746 CCTTACAAGAAGAAGGAAATTGG + Intergenic
948482652 2:238259899-238259921 CCACATGAGAAGAGGGAACCTGG - Intronic
1169324989 20:4668407-4668429 CCTTGTAAGAAGAGGAAGACAGG - Intergenic
1170252613 20:14301774-14301796 CTATTTCAAAAGAGGGAAACAGG - Intronic
1170275545 20:14582848-14582870 TCATATAATAAGAGGCACACAGG + Intronic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1170753174 20:19170805-19170827 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1172576879 20:36016403-36016425 CAATGTAAGATGTGGGAAACTGG + Intronic
1172909835 20:38399798-38399820 CCTTATAAGAACAGGAAATCTGG + Intergenic
1172946594 20:38693961-38693983 GCATAGAAGAGGAGGGGAACGGG - Intergenic
1173019467 20:39255109-39255131 TCTTATAAGAAGAGGAAAATAGG - Intergenic
1173042286 20:39475662-39475684 CCTTATAAGAAGAGGAAAAGTGG - Intergenic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1174703590 20:52634166-52634188 CCTTATAAGAAGAGAGACCCAGG + Intergenic
1174921969 20:54713028-54713050 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175287732 20:57848977-57848999 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175659260 20:60798100-60798122 TCAGATAGGAAGAGAGAAACTGG + Intergenic
1175666074 20:60861136-60861158 GCTTATAAAAAGAGGGAATCGGG + Intergenic
1177696004 21:24571932-24571954 CCTTATAAGAAGAGAAAAATAGG + Intergenic
1178637340 21:34315805-34315827 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1178846101 21:36175410-36175432 CCTTGTAAGAAGAGGAAATCTGG - Intronic
1179019881 21:37629538-37629560 CCTTATAAGAAGAGGAAATTAGG + Intronic
1179186597 21:39089706-39089728 CCTTATAAGAAGAGGGGATTAGG + Intergenic
1179363132 21:40731635-40731657 CCTTATAAGAAGAGGAAATTAGG - Intronic
1179593669 21:42428044-42428066 CCTTATAAGAAGAGGGGATGAGG + Intronic
1183128678 22:35811386-35811408 CCTTATAAGAAAAGGGAATGTGG + Intronic
1183771936 22:39934152-39934174 ACATATAAGAAAAGGGCCACAGG + Intronic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
1185208828 22:49555329-49555351 CCTTATAAAAAGAAGGAAACTGG + Intronic
949306415 3:2646818-2646840 CCTTATAAGAAGAGGAAATTTGG - Intronic
949373359 3:3359889-3359911 CCTTAGAAGAAGAGAAAAACTGG - Intergenic
949599219 3:5580351-5580373 CCAAATCAGAAGTGGGAAAGTGG - Intergenic
949840483 3:8314658-8314680 CCTTACAAGAAGAGGGAATTTGG + Intergenic
950703735 3:14767363-14767385 CCATATTAGAGAAGGGAAAGTGG + Intronic
950749373 3:15116808-15116830 CCTTATAGGAAGAGGGAATTAGG - Intergenic
951057781 3:18168016-18168038 CCAGAAAAGAAGAGAGAAATAGG + Intronic
951531027 3:23698227-23698249 CCTTATAAGAAGAGGAAATTTGG + Intergenic
951654729 3:24992723-24992745 CCATATAAAAAGAGGAAATTAGG - Intergenic
952552919 3:34499289-34499311 CCATAAAAGAAAAGAGAAAATGG + Intergenic
952780447 3:37092177-37092199 CCTTATAAGAAAAGTGAAACAGG + Intronic
952928139 3:38336857-38336879 CCTTATAAGAAGAGGAAAATTGG - Intergenic
953955076 3:47225687-47225709 CCATATAGGAAGCTGGAAATGGG - Intergenic
954933023 3:54300570-54300592 CCATATTAACAGAAGGAAACAGG - Intronic
955167802 3:56531635-56531657 CCTTATAAGAAGAGGAAATTTGG - Intergenic
956174539 3:66460522-66460544 CTTTATAAGAAGAGGAAATCTGG + Intronic
956568734 3:70670247-70670269 CCTTATAAGAAGAGGAAATATGG - Intergenic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
957286073 3:78219096-78219118 CCTTGTAAAAAGAGGGAAAAGGG - Intergenic
957670507 3:83294855-83294877 CCATAGGAGAAGAGTGACACTGG - Intergenic
958114008 3:89190840-89190862 CCTTATAAGAAGAGGAAATTTGG - Intronic
958567243 3:95830074-95830096 CCTTATAAGAAGAGGAAATGTGG + Intergenic
958744270 3:98113839-98113861 CCAGAACAGAAGAGGGAAAGAGG + Intergenic
958790678 3:98647480-98647502 CCTTATAAGAAGAGGAAATCTGG - Intergenic
959208088 3:103339188-103339210 CCATATAAAAATAGGTTAACAGG + Intergenic
959431611 3:106260895-106260917 CCATCTAGAAAGAGGGAAACAGG - Intergenic
959577228 3:107947508-107947530 CCAGACAAGAAGATGGAAAAAGG + Intergenic
960012222 3:112846780-112846802 CCTTATAAAAAGAGGAAAACTGG + Intronic
960425459 3:117501464-117501486 TCATATAACAAGAAGGAAATAGG - Intergenic
960490112 3:118307315-118307337 TCATATAGTAAGAGTGAAACTGG - Intergenic
960725189 3:120662943-120662965 CCTTATAAGAAGAGGAAATTTGG + Intronic
961015577 3:123465682-123465704 CCTTATAAGAAGAGGAAATTTGG + Intergenic
961262091 3:125610139-125610161 CCACATAAGAAAAGGAAAATAGG - Intergenic
963412101 3:144941875-144941897 CCATATATGAACCAGGAAACAGG - Intergenic
963560503 3:146858522-146858544 CCATATTAAAAAAGGGAATCAGG - Intergenic
963728957 3:148952356-148952378 CCTTATAAGAAGAGGCAATTAGG - Intergenic
963853167 3:150227624-150227646 CTAGGTAAGAAGAGGGAAAGTGG + Intergenic
964364400 3:155933784-155933806 CCAGAAAACAAGAGGGAATCAGG - Intronic
965273038 3:166643294-166643316 CCATATATGAATGAGGAAACTGG + Intergenic
966004574 3:174993969-174993991 CCCTATAAGAAGAGAGAAATTGG - Intronic
966152768 3:176882800-176882822 CTATAGAAGAAGATTGAAACTGG + Intergenic
966523698 3:180899219-180899241 CCATCTAGAAAGAGGGAAGCAGG - Intronic
967964305 3:194949022-194949044 CCTTATAAGAAGAGGAAATTTGG + Intergenic
967964437 3:194949932-194949954 CCTTATAAGAAGAGGAAATTTGG - Intergenic
968745802 4:2359504-2359526 CCTTATAAGAAGAGGAAATATGG + Intronic
969033527 4:4231957-4231979 CTTTATAAGAAGAGGAAAAGAGG - Intergenic
969482878 4:7456114-7456136 CCTTATAAGAAGAGGAGATCAGG - Intronic
969515600 4:7646466-7646488 CCTTATAAGAAGAGGAGATCAGG + Intronic
970471355 4:16382271-16382293 GCATCTAAGAACAAGGAAACGGG + Intergenic
971536731 4:27761694-27761716 CCATATAAGGAGAGGAGAATAGG - Intergenic
972184330 4:36510536-36510558 CCTTATAAGAAGAGGAAATGTGG + Intergenic
972272917 4:37529700-37529722 CCATAGAAGATGGGGGAAGCTGG + Intronic
972380072 4:38511313-38511335 CCTTATAAGAAGAGGAAATTTGG - Intergenic
972831861 4:42823238-42823260 CCATATCAGAAAACTGAAACTGG - Intergenic
972872615 4:43318880-43318902 GCATATAAAATGAGAGAAACTGG - Intergenic
973242920 4:47977247-47977269 CCTTATAAGAAGAGGAAACGTGG + Intronic
974057374 4:56997609-56997631 TTATATAAGCAGAGAGAAACTGG + Intronic
974596123 4:64016244-64016266 CCATGTGAAAACAGGGAAACAGG - Intergenic
976574007 4:86647749-86647771 CCTTATAAGAAGAGGAAATTAGG + Intronic
977049943 4:92117156-92117178 CCATATGAGAAAATTGAAACTGG - Intergenic
977399832 4:96518946-96518968 CCTTATAAAAAGAGGAAATCTGG - Intergenic
977715270 4:100175101-100175123 CCAGACATGAAGAGGGAACCTGG - Intergenic
978211117 4:106136398-106136420 CCAGAAAAGAAGTGGAAAACTGG + Intronic
979625451 4:122840026-122840048 CTTTATAAGAAGAGGAAACCTGG - Intronic
979663773 4:123288447-123288469 ACATACAAGTAGAGGGAAAGGGG + Intronic
979997947 4:127455272-127455294 CCACATAAGAAGAGATAAAGAGG + Intergenic
980812546 4:137901407-137901429 CCTTATAAGAAGAGGAGACCCGG - Intergenic
980961586 4:139481279-139481301 CCCTATGAGAAGAGGAAATCTGG - Intergenic
981009064 4:139905788-139905810 CTATATAAGAAGAGGAAATTTGG - Intronic
981842974 4:149133845-149133867 CCTTATAAGAAGAGGAAATGTGG + Intergenic
981917595 4:150051716-150051738 CCATCTATGAACCGGGAAACAGG + Intergenic
982100033 4:151958671-151958693 CCTTACAAGAAGAGGGAATTTGG - Intergenic
983436464 4:167721819-167721841 CCATCAATGAAGAGGAAAACGGG - Intergenic
983956335 4:173702886-173702908 CCAAAAAAGAAGAGGGAGATGGG + Intergenic
984024667 4:174528882-174528904 CCTTATAAGAAGAGGAAATTTGG - Intergenic
984065201 4:175038805-175038827 CCATATAAGAAGAGTCCAACTGG + Intergenic
984152932 4:176156938-176156960 ACTTATAAGAAGAGGAAATCTGG - Intronic
984745453 4:183211553-183211575 CCCTAAAAGAAAAGGGAAACTGG - Intronic
984933278 4:184867255-184867277 CCTTATGAGAGGAGGGCAACAGG + Intergenic
985771537 5:1814940-1814962 CCTTATAAGAAGAGGGGATGAGG - Intronic
985816837 5:2133698-2133720 CCTTATAAGAAGAGGAGAAGAGG - Intergenic
986776947 5:11024555-11024577 CCTTATAAGAAAAAGGAAAAAGG - Intronic
986977710 5:13411830-13411852 CCTTATAAGAAGAGGAAATTAGG + Intergenic
987244379 5:16033704-16033726 CCTTATAAGAAGAGGAAATTAGG + Intergenic
987362886 5:17122527-17122549 CCCTATAAGAAGAGGAAATGTGG + Intronic
988101318 5:26682722-26682744 CGATATAAGATAAGGGAGACTGG + Intergenic
988925693 5:35989587-35989609 CCATGTAAGAACAGGGACTCAGG + Intronic
989299118 5:39867965-39867987 GCATATGAGAACAGGGTAACAGG + Intergenic
989364516 5:40640616-40640638 CCTTATAAGATGAGGAAATCTGG + Intergenic
990912860 5:60870727-60870749 CCAAAAAAGAAGAAGGAAAAAGG + Intergenic
991660327 5:68944739-68944761 CCATCTATGAACAGGGAAACGGG - Intergenic
991937516 5:71816568-71816590 TCTTATAAGAAGAGGAAACCTGG - Intergenic
991998200 5:72409332-72409354 CCTTATAAGAAGAGAGAAATAGG - Intergenic
992202438 5:74397663-74397685 CCTTATAAGAAGAGGGAATTTGG - Intergenic
992778612 5:80108853-80108875 CTCTATAAGAAGAGGAAAATTGG + Intergenic
992821924 5:80506092-80506114 CCATACAAGCATATGGAAACTGG + Intronic
994184440 5:96802819-96802841 CCTTATAAGAAGATGGAGACTGG + Intronic
994282501 5:97922279-97922301 CCTTATAAGAAGAGGAAATTTGG - Intergenic
994555329 5:101292395-101292417 ACATATAGGAAGAATGAAACTGG + Intergenic
995424162 5:112001384-112001406 CCTTATAAGAAGAGGAAATTTGG - Intergenic
995533218 5:113111210-113111232 ACATAGACGAGGAGGGAAACAGG + Intronic
995829999 5:116344773-116344795 CCATTTAGAAAGAGGGAAGCAGG + Intronic
995837060 5:116409574-116409596 CCTTATAAGAAGAGGGGATTAGG + Intronic
996534971 5:124568273-124568295 CCTTATAAGAAAAGGAAATCTGG + Intergenic
996567416 5:124894097-124894119 CCTTATAAGAAGAGGAAATTTGG - Intergenic
996771598 5:127092368-127092390 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1000017332 5:157289612-157289634 CCTTATAAAAAGAGGAAATCTGG - Intronic
1000153090 5:158522693-158522715 CCACAGAAAAAGTGGGAAACTGG - Intergenic
1000794815 5:165651798-165651820 CCATATAATAAGAAGAACACAGG + Intergenic
1000921156 5:167138921-167138943 CCATATAAGATTAGTAAAACAGG - Intergenic
1000973362 5:167738811-167738833 CCTTATAAGAAGAGGAAATTTGG - Intronic
1002886914 6:1305531-1305553 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1002906426 6:1452868-1452890 CCTTATAAAAAGAGGAAATCAGG - Intergenic
1003466226 6:6382684-6382706 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1005146376 6:22695212-22695234 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1007066286 6:38993547-38993569 CCATAAAAGAAGAGGGAAATGGG - Intronic
1008327943 6:50208040-50208062 TCATTTAAGAAGAAGGATACGGG + Intergenic
1009263505 6:61525596-61525618 TCTTATAAGAAGAGGAAATCTGG - Intergenic
1010885264 6:81229747-81229769 CCATTTAAAAAGAGGAAAAAAGG - Intergenic
1011191087 6:84729121-84729143 CCATATCAGAAGAGACAAAGAGG - Intronic
1011876625 6:91970629-91970651 CCATATATAGAGAGGGAAAAGGG + Intergenic
1012381640 6:98626636-98626658 CCCTTTAAGAAGAGGCAGACAGG + Intergenic
1012482337 6:99680921-99680943 CCTTATAAGAAGAGGAAAATTGG + Intergenic
1012810025 6:103945071-103945093 CCTTAGAAAAAGAGGCAAACTGG - Intergenic
1013277972 6:108604903-108604925 CCCTATAAGAAGAGAGAAAAAGG + Intronic
1013346235 6:109263330-109263352 CCTTATAAGAAGAGGAAATTCGG + Intergenic
1014961683 6:127694664-127694686 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015136013 6:129871652-129871674 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015451406 6:133371356-133371378 TCAGAAAAGAAGTGGGAAACTGG - Intronic
1016240882 6:141929127-141929149 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1016863397 6:148744067-148744089 GGATATAAGATGAGAGAAACAGG + Intergenic
1017757195 6:157539555-157539577 CTATTTAAGAAGAGGGAAAGAGG + Intronic
1019554904 7:1624393-1624415 CCTTCTAAGAAGAGGAAATCAGG - Intergenic
1019791260 7:3015446-3015468 CCTTATAAGAAGAGGAAATGAGG - Intronic
1021065805 7:16170964-16170986 CCCCACAAGAAGAGGGAAGCCGG + Intronic
1021602073 7:22374108-22374130 CTATATAAGAAGAGGAAATCTGG - Intergenic
1021819833 7:24485808-24485830 GCATCAAAGAAGAGGGTAACAGG + Intergenic
1023378768 7:39585362-39585384 CCTTATAAGAAGAGGAAATTTGG + Intronic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1023817627 7:43962513-43962535 CCCTATCAGAACAGGGAAGCTGG - Intergenic
1025110590 7:56212932-56212954 CCATTTATGCATAGGGAAACTGG - Intergenic
1025610336 7:63071841-63071863 CCATGGAAGGAGAGGGAAATTGG - Intergenic
1027946873 7:84758471-84758493 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1028990332 7:97042493-97042515 CAATAAATAAAGAGGGAAACTGG - Intergenic
1029256304 7:99271996-99272018 CCATATAAAAAGAGGGAAGATGG - Intergenic
1029742251 7:102497387-102497409 CCCTATCAGAACAGGGAAGCTGG - Intronic
1029760241 7:102596552-102596574 CCCTATCAGAACAGGGAAGCTGG - Intronic
1030303840 7:108001089-108001111 CCAAATGAGGAGAGGAAAACGGG + Intronic
1031886149 7:127248180-127248202 TCAGATAAGAAGAGAGAAAGTGG + Intronic
1032123398 7:129173116-129173138 CCTTATGAGAAGAGGAAAATTGG - Intergenic
1032172757 7:129599577-129599599 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1032508639 7:132454703-132454725 CCTTATAAGAAGAGGAAATTTGG + Intronic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1032549841 7:132774400-132774422 CCATGGAAAAAGAGGAAAACTGG - Intergenic
1032982929 7:137305908-137305930 CACTATAATAAGAAGGAAACTGG + Intronic
1033119741 7:138657113-138657135 ACAAATAAGAAAAGGGAATCAGG - Intronic
1033495961 7:141896524-141896546 CCATATAAGTAAAAGGAAAAGGG - Intergenic
1034760897 7:153670882-153670904 CCTTATAAGAAGAGGAGATCAGG - Intergenic
1035683000 8:1502451-1502473 CAATATAAGATGATGGAAATGGG + Intronic
1036823640 8:11959112-11959134 CCACAAAAGAAGTGGGGAACAGG + Intergenic
1037111491 8:15168638-15168660 CCATCTAGAAAGAGGGGAACAGG - Intronic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037983698 8:23273205-23273227 CCATATAAGAAGAGGAAATTTGG + Intronic
1038210035 8:25509056-25509078 CTATGTAAGAAGGGGGAAATGGG - Intergenic
1039370895 8:36982896-36982918 CCTTACAAGAAGAGGGAATTAGG + Intergenic
1039440033 8:37588669-37588691 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1039642042 8:39234225-39234247 CCAAATAGTAAGAGGGAAATGGG + Intronic
1039741848 8:40390014-40390036 CTAAATAAGAAGAGGGAAGCAGG - Intergenic
1039946332 8:42132081-42132103 TAATATAAAAAGAGGCAAACTGG - Intergenic
1040618192 8:49061275-49061297 CCTCATAAGAAGAGGGAATTTGG + Intronic
1041644249 8:60235303-60235325 CCTTATAAGAAGAGGAAATTTGG - Intronic
1042000056 8:64112054-64112076 CCTTATAAGAAGAGGGGATTAGG - Intergenic
1042271135 8:66956901-66956923 CCATTTAAGAAGAGGAGAATCGG + Intronic
1042755290 8:72203769-72203791 CCACATCAGAACAGGGAAAATGG - Intergenic
1042929029 8:73995402-73995424 CCTTATAAGAAGAGGAAATTTGG - Intronic
1044124232 8:88437811-88437833 CCATAGTAGAATAGGGCAACAGG + Intergenic
1044175363 8:89114031-89114053 CCATAGCAGAAGAAGGAAACTGG + Intergenic
1044323742 8:90836352-90836374 AAATATAAGAAGAAGAAAACTGG + Intronic
1044464681 8:92489339-92489361 ACATAGAAGAAGAGAGACACAGG - Intergenic
1044478555 8:92657157-92657179 CCATCTATAAATAGGGAAACAGG + Intergenic
1044846338 8:96385535-96385557 CCTTATAAGAAGAGGAAAATAGG + Intergenic
1045003683 8:97899596-97899618 CCTTATAAGAAGAGGAAGTCTGG - Intronic
1045669277 8:104529180-104529202 CCTTATAAGAAGAGGAGATCAGG + Intronic
1045704704 8:104908277-104908299 CCTTATAAGAAGAGGAAATTAGG + Intronic
1046959700 8:120097552-120097574 CCATATGCGAAGATTGAAACTGG - Intronic
1047167782 8:122459534-122459556 CAATATAACAAGAGAGAAAAGGG + Intergenic
1048197902 8:132347675-132347697 CCAGGTAAAAAGAGGAAAACCGG + Intronic
1048270113 8:133021711-133021733 CCTTATAAGAAGAGGGGGTCAGG - Intronic
1048485386 8:134843202-134843224 CCATGTAAGAATCAGGAAACAGG + Intergenic
1048544365 8:135372632-135372654 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1048633537 8:136270733-136270755 CCACAAAAGAAGAGGATAACAGG - Intergenic
1049938702 9:524139-524161 CCAAAGCAGAAGAGGGAATCAGG - Intronic
1050056935 9:1665645-1665667 CCATATAAGAAGCTGGTGACTGG - Intergenic
1050508677 9:6372048-6372070 CCATCTAGAAAGAGGGAAGCAGG + Intergenic
1050535129 9:6624355-6624377 CCTTATAAGAAGAGCAAAATTGG + Intronic
1051202429 9:14642597-14642619 CCTTATAAGAAGAGGAAATTTGG + Intronic
1051384087 9:16488102-16488124 CCATATAAGGCGAGGGGAAACGG - Intronic
1052107490 9:24537273-24537295 CCAAATAAAAAGAGTTAAACTGG + Intergenic
1056048248 9:82741407-82741429 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1056268885 9:84926531-84926553 CCATAAAAAAAGAAAGAAACTGG - Intronic
1056445688 9:86664670-86664692 CCATTCAACATGAGGGAAACGGG + Intergenic
1057008068 9:91578135-91578157 CCTTATAAGAAGAGGAAATTAGG + Intronic
1057306146 9:93913097-93913119 CCTTATAAAAAGGGGGAAATTGG + Intergenic
1057614742 9:96579285-96579307 CCTTATAAGATGAGAGATACAGG + Intronic
1057987141 9:99728806-99728828 CCAAACAAGAAGAGCGAAAAGGG - Intergenic
1058590144 9:106556823-106556845 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1058706235 9:107640044-107640066 CCCCATAAGAAGTGGAAAACAGG - Intergenic
1058923278 9:109638694-109638716 CCATGTAAGAAGGGGAAAATTGG - Intergenic
1059135797 9:111805033-111805055 CAATATGAGAAGGGGCAAACAGG - Intergenic
1059409990 9:114125754-114125776 GGATATAAGAAGAGTGACACTGG + Intergenic
1059698808 9:116755415-116755437 CCTTTTAAGAAGAGGAAAACTGG + Intronic
1060689989 9:125649237-125649259 CCAGGTTAGAAGAGGGAATCTGG - Intronic
1061277090 9:129575376-129575398 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1061357016 9:130113529-130113551 TCTTATAAGAACTGGGAAACTGG - Intronic
1062356080 9:136163527-136163549 CCAGAAAAAAAGAGGGAAAAGGG - Intergenic
1185943338 X:4346090-4346112 CCTTATAAGAAGAGGAGAAGAGG + Intergenic
1186103474 X:6181438-6181460 TCTTATAAGCAGCGGGAAACAGG - Intronic
1186586104 X:10874777-10874799 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1187949306 X:24456229-24456251 CATTATAATAAGAGGGAAAAAGG - Intergenic
1188539809 X:31237346-31237368 GCATAACAGAAGAGGGGAACAGG + Intronic
1189109975 X:38279260-38279282 CCATCTAAGAAGATGTAAACAGG + Intronic
1189211818 X:39290277-39290299 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1189249243 X:39587318-39587340 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1190224369 X:48534029-48534051 CCTTATAAGAAGAGGGACACTGG - Intergenic
1190395206 X:49975440-49975462 CCTTATAGGAAGAGGGTAAATGG - Intronic
1190444492 X:50509892-50509914 CCTTATAAGAAGAGGGGATTTGG + Intergenic
1190636203 X:52436467-52436489 CCTTATAAGAAGAGGAAATGAGG - Intergenic
1191662610 X:63666612-63666634 CCACATGAGTAGAAGGAAACGGG + Intronic
1192096205 X:68213654-68213676 CCATAGAAAAAGAGAGAAAAGGG + Intronic
1193777250 X:85657934-85657956 CCATTTCAAAAGAGAGAAACTGG - Intergenic
1194238896 X:91420035-91420057 CTATATAAAAACAGGGAAATAGG - Intergenic
1194458318 X:94132492-94132514 CCTTATAAGAAGAGGCAATTAGG + Intergenic
1194498245 X:94645889-94645911 CTATTTAAGTAGAAGGAAACTGG - Intergenic
1194559175 X:95399258-95399280 AAATATAAGAAAAGGCAAACAGG + Intergenic
1194794542 X:98194958-98194980 CCTTATAAAAAGAGGAAAATTGG - Intergenic
1194812038 X:98398919-98398941 CCCTATAAGAAGAGGAAGAGAGG + Intergenic
1195174100 X:102297994-102298016 CTTTATAAGAAGAGGAAAATTGG + Intergenic
1195184765 X:102389099-102389121 CTTTATAAGAAGAGGAAAATTGG - Intronic
1196283412 X:113851113-113851135 CTTTATAAGAAGAGGAAGACAGG + Intergenic
1196717019 X:118822013-118822035 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1198252678 X:134896092-134896114 CCATAGAAAACCAGGGAAACTGG - Intronic
1198281769 X:135149681-135149703 CATTATAAGAAGAGGGATATTGG - Intergenic
1198286499 X:135196511-135196533 CCTTATATGAAGAGGGATATTGG - Intergenic
1198289190 X:135222841-135222863 CATTATAAGAAGAGGGATATTGG + Intergenic
1198512821 X:137371390-137371412 CCTTATAAGAAGAGGAAATGTGG - Intergenic
1199034964 X:143039466-143039488 CCATATAAGAAGAAAGAGAAAGG - Intergenic
1199356975 X:146874332-146874354 CCATGTAAGCAGAGGGAATATGG - Intergenic
1199412137 X:147536372-147536394 CCTTATAAAAAGAGGGAATTTGG + Intergenic
1199573804 X:149293373-149293395 TCTTATAAGAAGGTGGAAACTGG - Intergenic
1199845758 X:151692173-151692195 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1200298712 X:154950064-154950086 CCTTATAAGAAGAGGAAATGTGG - Intronic
1201282746 Y:12355413-12355435 CCATTTAAGAGGAGTAAAACTGG - Intergenic
1201554789 Y:15256675-15256697 CCCCAAAAGAAGAGGGAAAAGGG + Intergenic