ID: 914743905

View in Genome Browser
Species Human (GRCh38)
Location 1:150487186-150487208
Sequence GGTTTCAGCTGAAACGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914743895_914743905 23 Left 914743895 1:150487140-150487162 CCTGCCCTTGTCCTCAAAGCCAC 0: 1
1: 0
2: 2
3: 22
4: 256
Right 914743905 1:150487186-150487208 GGTTTCAGCTGAAACGCCACGGG 0: 1
1: 0
2: 1
3: 11
4: 82
914743903_914743905 -6 Left 914743903 1:150487169-150487191 CCTAATTGCTATTTTTGGGTTTC 0: 1
1: 0
2: 1
3: 17
4: 279
Right 914743905 1:150487186-150487208 GGTTTCAGCTGAAACGCCACGGG 0: 1
1: 0
2: 1
3: 11
4: 82
914743897_914743905 19 Left 914743897 1:150487144-150487166 CCCTTGTCCTCAAAGCCACAGGA 0: 1
1: 0
2: 2
3: 28
4: 298
Right 914743905 1:150487186-150487208 GGTTTCAGCTGAAACGCCACGGG 0: 1
1: 0
2: 1
3: 11
4: 82
914743898_914743905 18 Left 914743898 1:150487145-150487167 CCTTGTCCTCAAAGCCACAGGAC 0: 1
1: 0
2: 1
3: 20
4: 240
Right 914743905 1:150487186-150487208 GGTTTCAGCTGAAACGCCACGGG 0: 1
1: 0
2: 1
3: 11
4: 82
914743899_914743905 12 Left 914743899 1:150487151-150487173 CCTCAAAGCCACAGGACGCCTAA 0: 1
1: 0
2: 0
3: 6
4: 138
Right 914743905 1:150487186-150487208 GGTTTCAGCTGAAACGCCACGGG 0: 1
1: 0
2: 1
3: 11
4: 82
914743900_914743905 4 Left 914743900 1:150487159-150487181 CCACAGGACGCCTAATTGCTATT 0: 1
1: 0
2: 0
3: 2
4: 48
Right 914743905 1:150487186-150487208 GGTTTCAGCTGAAACGCCACGGG 0: 1
1: 0
2: 1
3: 11
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914743905 Original CRISPR GGTTTCAGCTGAAACGCCAC GGG Intergenic
900410279 1:2509581-2509603 GGTCTCAGCTGAGTGGCCACAGG + Intronic
904567464 1:31436151-31436173 GGTCTCAGCTGAAAGGCACCAGG - Intergenic
910525121 1:88168831-88168853 AGTTTCAGCTGAATAGCCACAGG + Intergenic
914743905 1:150487186-150487208 GGTTTCAGCTGAAACGCCACGGG + Intergenic
916091893 1:161314159-161314181 GATTTCGGCAGAAACGCCGCTGG - Intergenic
916625912 1:166554371-166554393 GGTTTCAGCATAAAAGCCATTGG + Intergenic
917448280 1:175125235-175125257 GCTCTCAGCTGAAATGCTACTGG + Intronic
917780657 1:178392718-178392740 AGTATCAGCTGAAAGGCCAGGGG - Intronic
920533777 1:206723918-206723940 GTGCTCAGCTGCAACGCCACAGG - Intronic
921180105 1:212625428-212625450 GTCTTCAGCTGGAATGCCACAGG - Exonic
922582869 1:226711732-226711754 GGGTTCAGCTCAAACTCCAGAGG - Intronic
923386248 1:233467548-233467570 GGTTTCAGCTTAGACCCCATTGG - Intergenic
1064525912 10:16256555-16256577 GATTTCAGTTGAAATGCCAAAGG - Intergenic
1068362038 10:55988230-55988252 TTTTTCATCTGAAACACCACAGG - Intergenic
1069335485 10:67344451-67344473 GGATTCAGCAGTAAAGCCACTGG + Intronic
1071353182 10:84767196-84767218 GTTTACAGCTGAAGCCCCACTGG + Intergenic
1075695688 10:124433535-124433557 ATTTTAAGCTGAAAGGCCACTGG + Intergenic
1075695975 10:124435667-124435689 GTTTTAAGCTGAAAGGCCACTGG + Intergenic
1079791787 11:24748126-24748148 GGTGTCAGGGGAAACACCACAGG - Intronic
1083273962 11:61586670-61586692 GGTTCCAGATGAAAAGCCCCTGG + Intergenic
1086455549 11:86955751-86955773 GGTTACAGCTGAAAGGAGACAGG - Intergenic
1091289554 11:134430152-134430174 GGGCTCACCTGAAAGGCCACTGG + Intergenic
1095085617 12:38055322-38055344 GGTTTCAGGTGAAACTTCAGAGG + Intergenic
1097507487 12:60494199-60494221 AGTTTCAGCTGCAACCCCACAGG - Intergenic
1099271188 12:80513035-80513057 GTTTACAGCTGAAACCCCAGTGG + Intronic
1109619234 13:64879932-64879954 GTTTACAGCTGAAACCCCAGTGG + Intergenic
1111165858 13:84456014-84456036 GGTGGCAGCAGAAAGGCCACGGG - Intergenic
1111292218 13:86185231-86185253 TGTTTCAGCTGAAGCCCCAGTGG - Intergenic
1116846714 14:49871114-49871136 GGTTTCAGCTGAACAGACACAGG - Intergenic
1122371118 14:101229541-101229563 GTTTACAGCTGAAACCCCAGTGG + Intergenic
1123087288 14:105722532-105722554 GGGTTCAGCTGACACTACACTGG - Intergenic
1124152698 15:27196154-27196176 GGATGGAGCTGAAATGCCACTGG - Intronic
1134892477 16:17853441-17853463 GTTTTCTGCTGAAACCCTACAGG - Intergenic
1155602833 18:27569100-27569122 GGATTCAGCTGAGAAGTCACAGG + Intergenic
1167215035 19:48158872-48158894 AATTTCAGCTCAAAAGCCACAGG + Intronic
925684466 2:6457216-6457238 GGTTTCAGTTGAAAAATCACAGG + Intergenic
927246201 2:20958825-20958847 GGTTTCAGCTTAAACGCCAGAGG + Intergenic
935543631 2:104378052-104378074 GTTTACAGCTGAAACCCCAGTGG + Intergenic
935645593 2:105330835-105330857 GGTCACAGCTGAAGCACCACTGG - Intergenic
938030274 2:127986236-127986258 GTTTACAGCTGAAACCCCAGTGG - Intronic
938163945 2:129009941-129009963 TGATTCAGCTGAAACTCCACTGG + Intergenic
938587040 2:132701248-132701270 GGTTTCCACTGAAATACCACAGG + Intronic
945818802 2:214637594-214637616 AGTTTCAGCAGAAACGGCAAAGG - Intergenic
1171937034 20:31285101-31285123 GTTTTCACCTGACAGGCCACAGG + Intergenic
1172972986 20:38887006-38887028 GGTCTCAGCTTAAACTCCCCAGG - Intronic
1173002588 20:39115229-39115251 GATTTCTGCAGAAACGCCTCTGG - Intergenic
1175076733 20:56381659-56381681 GGTTTCATGTGAAACACCACTGG - Intronic
1177875196 21:26624229-26624251 GGTTTCTGCTGAAAATCCCCTGG - Intergenic
1179132345 21:38649262-38649284 GCTCTCAGCTGCAGCGCCACAGG - Intronic
1179250023 21:39664579-39664601 GGTTCCACCAGAAACGCAACAGG - Exonic
1180926684 22:19560011-19560033 GGGTACAGCTGAACTGCCACAGG + Intergenic
950784305 3:15421123-15421145 GGTTTTAGATGAAAAACCACAGG + Intronic
951047083 3:18051956-18051978 GGTTCCAGCTCTAAGGCCACTGG + Intronic
951283576 3:20781507-20781529 CCTTTCAGCTGAAACCCTACAGG + Intergenic
953803700 3:46049647-46049669 GGATTGAGCTGAAACCCCAGAGG + Intergenic
957347758 3:78983804-78983826 GGTTTCAGCTGGAGGGCGACTGG + Intronic
960464333 3:117977779-117977801 TATTTCAGCTGCAACTCCACTGG - Intergenic
961435732 3:126915333-126915355 GGACTCAGCTGGAACGTCACAGG + Intronic
963788581 3:149559939-149559961 TCTTTCAGAAGAAACGCCACTGG + Intronic
967508762 3:190285780-190285802 GCTTTCAGCTGAAACCTTACAGG - Intergenic
969798448 4:9543971-9543993 GGTTTCATCTCAAGGGCCACTGG - Intergenic
975871258 4:78781163-78781185 GGTTTTATCTGAAATGCAACAGG + Intronic
978383942 4:108161282-108161304 GGTTACAGCTGAAAAGCTTCTGG + Intronic
983997600 4:174204542-174204564 GCTTTCAGATGAAAAGCAACTGG - Intergenic
986164519 5:5262300-5262322 TGTTTCTGCTGAAAATCCACTGG + Intronic
998820332 5:146052223-146052245 GGTATCAGCTGAAACTCTCCCGG + Intronic
999263136 5:150249898-150249920 GGTCTCAGCTTAAACGCCCCTGG + Intronic
999948014 5:156618548-156618570 GGTTTCATTTGAAATGCTACAGG + Intronic
1001323176 5:170699693-170699715 GGTTTCAGCTGGAATACCAGGGG - Intronic
1001941276 5:175741432-175741454 GATTTCAGCAGAAATGCCATAGG - Intergenic
1003607004 6:7571368-7571390 GTTTTCAGCTGAAAGGAGACAGG - Exonic
1004130114 6:12911688-12911710 GTTTTCAGCTGAGACGCCAGCGG - Intronic
1006198894 6:32268490-32268512 GGTTTCATCAGAATTGCCACTGG + Intergenic
1008689513 6:53962071-53962093 GTCTTCAGCTGAAAAACCACTGG + Intronic
1020094331 7:5360080-5360102 GCTTTAAGCTGAAACTTCACAGG + Intronic
1024149619 7:46557628-46557650 GGTTTCACCTGACACACCATTGG + Intergenic
1029560460 7:101299751-101299773 GGATTCAGCCGAGAAGCCACTGG + Intergenic
1029560990 7:101302913-101302935 GGATTCAGCCGAGAAGCCACTGG + Intergenic
1029561868 7:101308433-101308455 GGATTCAGCCGAGAAGCCACGGG + Intergenic
1036889885 8:12589570-12589592 GGTTTCATCTCAAAGGCCACTGG + Intergenic
1038415018 8:27388810-27388832 GGTGTGAGCTGGAAGGCCACAGG - Intronic
1038442922 8:27584360-27584382 GGTGTCATCTGAAACCCCACAGG + Intergenic
1043238424 8:77899471-77899493 GTTTACAGCTGAAGCCCCACGGG + Intergenic
1051152192 9:14094355-14094377 GCATTCAGCTGAAAAGCAACTGG - Intronic
1051943395 9:22536028-22536050 GGTTTCAGCTTAATTGCAACTGG + Intergenic
1052658797 9:31401643-31401665 GGTTTGGACTGAAACACCACTGG - Intergenic
1052997581 9:34559452-34559474 GGGTCCAGCTGAGACCCCACAGG + Intronic
1056810607 9:89760911-89760933 GGTCTCAGCTGAAACCAAACTGG - Intergenic
1057426680 9:94956326-94956348 GTTTTCAGTTTGAACGCCACAGG + Intronic
1058394030 9:104528985-104529007 TGTTTCTGCTGAAACTCCCCTGG - Intergenic
1059410806 9:114131062-114131084 GGTTTCAGCTCAAATGCCCCTGG + Intergenic
1190722400 X:53160836-53160858 GCTTTGAGCTGAAACCCCAGAGG + Intergenic
1197673518 X:129304644-129304666 GGTTTCAGCTGAAACTATATTGG + Intergenic
1201773980 Y:17644730-17644752 GGTTTCAGATGAAACTTCAGAGG - Intergenic
1201827577 Y:18261259-18261281 GGTTTCAGATGAAACTTCAGAGG + Intergenic