ID: 914745268

View in Genome Browser
Species Human (GRCh38)
Location 1:150496919-150496941
Sequence GGTCTTCTTTCCTCTAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914745268_914745278 29 Left 914745268 1:150496919-150496941 CCAGGTCTAGAGGAAAGAAGACC 0: 1
1: 1
2: 2
3: 14
4: 180
Right 914745278 1:150496971-150496993 AAGGTGTTTGTGTTAAAAGATGG 0: 1
1: 0
2: 2
3: 38
4: 411
914745268_914745277 10 Left 914745268 1:150496919-150496941 CCAGGTCTAGAGGAAAGAAGACC 0: 1
1: 1
2: 2
3: 14
4: 180
Right 914745277 1:150496952-150496974 TGAGGGACTAGAAGAAGCTAAGG 0: 1
1: 0
2: 3
3: 16
4: 267
914745268_914745279 30 Left 914745268 1:150496919-150496941 CCAGGTCTAGAGGAAAGAAGACC 0: 1
1: 1
2: 2
3: 14
4: 180
Right 914745279 1:150496972-150496994 AGGTGTTTGTGTTAAAAGATGGG 0: 1
1: 0
2: 0
3: 26
4: 356
914745268_914745275 -7 Left 914745268 1:150496919-150496941 CCAGGTCTAGAGGAAAGAAGACC 0: 1
1: 1
2: 2
3: 14
4: 180
Right 914745275 1:150496935-150496957 GAAGACCAGGGAGGGGCTGAGGG 0: 1
1: 0
2: 6
3: 89
4: 709
914745268_914745274 -8 Left 914745268 1:150496919-150496941 CCAGGTCTAGAGGAAAGAAGACC 0: 1
1: 1
2: 2
3: 14
4: 180
Right 914745274 1:150496934-150496956 AGAAGACCAGGGAGGGGCTGAGG 0: 1
1: 0
2: 8
3: 112
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914745268 Original CRISPR GGTCTTCTTTCCTCTAGACC TGG (reversed) Intronic
900669644 1:3843142-3843164 TCCCTTCTTTCCTTTAGACCAGG + Intronic
901681247 1:10914180-10914202 GGGCTTCTTTCCTCTATCTCTGG - Intergenic
901692731 1:10984143-10984165 GGACTTCTGGCCTCTAAACCTGG - Intergenic
905526374 1:38643095-38643117 GGACTTCTGACCTCTAGAACAGG + Intergenic
905721042 1:40201975-40201997 GGTGCTCTTTCCTCTAAACCAGG - Intronic
910168848 1:84356767-84356789 GGTCTTCTGACCCCTAGTCCAGG - Intronic
911445933 1:97991815-97991837 GGTCTTATTTCCCCTAGAAGAGG - Intergenic
911827713 1:102508507-102508529 GGTTTTCTAGCCTCTAGAACTGG - Intergenic
912697339 1:111851253-111851275 GTCCGTCTTTCCTCTAGATCAGG + Intronic
912933711 1:113985140-113985162 GGCATGCTTTCCTCTAAACCAGG - Intergenic
914745268 1:150496919-150496941 GGTCTTCTTTCCTCTAGACCTGG - Intronic
916589404 1:166175908-166175930 GGACTTCTAGCCTCTAGAACTGG + Intergenic
917754185 1:178082979-178083001 TGTCTTCCCTCCTCAAGACCTGG - Intergenic
918730719 1:187992515-187992537 TCTCTCCTTTTCTCTAGACCAGG + Intergenic
921271645 1:213475446-213475468 GCTCTTCTCTTCTCTGGACCTGG + Intergenic
924769363 1:247065368-247065390 GGTTTTCTTTCCTCATCACCAGG - Intronic
1062802623 10:391344-391366 GGTCTTCCTTCCTCTGGCCGAGG - Intronic
1063162605 10:3430503-3430525 GGTCTTCTTGTCTCTAGCCTTGG + Intergenic
1065857231 10:29840333-29840355 AGCCTTCCTTCCTCTAGCCCTGG - Intergenic
1067332400 10:45334227-45334249 GGTCTTCCTTCTACCAGACCTGG - Intergenic
1071273839 10:84034712-84034734 GGTCTTCTTTCCAGGGGACCTGG - Intergenic
1072799969 10:98385887-98385909 GGCCTTCTTTCCTCTATACCTGG + Intronic
1072924328 10:99603160-99603182 AATCTTCTTTCATCTAGATCAGG - Intergenic
1075549771 10:123383551-123383573 GGACTTCTGGCCTCTAGACGGGG + Intergenic
1078530253 11:12131413-12131435 GGTCTCCTCTCCTCTGCACCTGG + Intronic
1080689967 11:34548424-34548446 GGTCCTCATGCCTCTTGACCTGG + Intergenic
1083407216 11:62465903-62465925 GGGCTTCTGTCCTCCAGAACTGG + Intronic
1085911464 11:80831930-80831952 GGACTTCTTTCCTATAGAGTTGG + Intergenic
1089328755 11:117675581-117675603 GGCTTCCTTTCCTCCAGACCTGG + Intronic
1089667411 11:120029300-120029322 GCTCTTCTGTCCTCCAGCCCTGG - Intergenic
1089790693 11:120941397-120941419 GATCTCCTTTTCTCTAGAGCTGG - Intronic
1090625304 11:128603256-128603278 GCTCTCCTTTCTTCTAGACAAGG + Intergenic
1094424442 12:30303966-30303988 GGCCTTCATGCCTCTAAACCTGG - Intergenic
1095691061 12:45089118-45089140 GGCATTCTTTCCTCTAGCCTGGG + Intergenic
1098404794 12:70112872-70112894 GGTCTTCTTTCCTCTTTTCTTGG - Intergenic
1101597373 12:106178872-106178894 GGACTTCTAACCTCTAGGCCCGG - Intergenic
1102539552 12:113608816-113608838 GGCCTTCTTTCCTCCATACTGGG - Intergenic
1102657139 12:114491532-114491554 GGTCTTCTTCCCTCAAGACCTGG + Intergenic
1103973914 12:124689650-124689672 GTGCTGCTTTCCTCTAGACTGGG + Intergenic
1104341606 12:127955129-127955151 GGTTTTCTGTCTTCAAGACCAGG + Intergenic
1107627558 13:42305417-42305439 AGCCTTCTTTCTCCTAGACCAGG + Intronic
1107804699 13:44142724-44142746 GGTCTTCTGACCTCTAGTCTGGG + Intergenic
1108887395 13:55204035-55204057 TGTCTTCTTTCTTATAAACCAGG - Intergenic
1114623940 14:24116197-24116219 GGCATTCTTTCCTCAAGAACAGG - Intronic
1115741197 14:36390734-36390756 GGCCTTCTTCCCTGGAGACCAGG - Intergenic
1117485654 14:56194392-56194414 GGTTTTCTTTCCTTAATACCAGG + Intronic
1120005312 14:79349926-79349948 GGACTTCTGGCCTCTAGAACTGG + Intronic
1124027452 15:25979614-25979636 TATCTTCTTTTCTCCAGACCTGG - Intergenic
1128815955 15:70608437-70608459 GGTTTTCTTTCCTGTGGACTTGG - Intergenic
1129312787 15:74724359-74724381 GGTCTACTGACCTCTAGTCCAGG - Intronic
1130625987 15:85515606-85515628 AGTCTTCTTTACTCTGGAACAGG + Intronic
1130878227 15:88032541-88032563 GCTGTTCTTCTCTCTAGACCTGG - Intronic
1130949116 15:88571660-88571682 GCACTTTTATCCTCTAGACCGGG + Intergenic
1131100297 15:89683423-89683445 GGTCTTGTGTCCTCTATAGCAGG - Exonic
1131359783 15:91780390-91780412 GGAATTCTTTCCTTTTGACCTGG + Intergenic
1132616705 16:844616-844638 GGTCTACTGTGCTCTGGACCTGG - Intergenic
1134564620 16:15240493-15240515 AGTCTTCTGACCTCCAGACCTGG - Intergenic
1134737875 16:16516206-16516228 AGTCTTCTGACCTCCAGACCTGG + Intergenic
1134929626 16:18195954-18195976 AGTCTTCTGACCTCCAGACCTGG - Intergenic
1135563063 16:23491636-23491658 TGTCTTATTTCCTCTTGACTAGG - Intronic
1136131984 16:28228583-28228605 GGTCTGCTATCCTCTAGCCAAGG + Intergenic
1137776365 16:51057642-51057664 GGACTTCTTCCATCCAGACCGGG + Intergenic
1138536383 16:57662576-57662598 GAGCTTCCTTCCCCTAGACCAGG - Intronic
1138678344 16:58667659-58667681 GGTCTTCTTACCTATGGACTAGG - Intronic
1143377672 17:6476997-6477019 GGTCTTCTTGCTTCTGGACAGGG + Intronic
1146177073 17:30672364-30672386 GATCTTCATTTCTCTAGAACAGG + Intergenic
1146222724 17:31038879-31038901 GATCTTCATTTCTCTAGAACAGG + Intergenic
1146342271 17:32031131-32031153 GATCTTCATTTCTCTAGAACAGG - Intronic
1146350537 17:32088465-32088487 GATCTTCATTTCTCTAGAACAGG + Intergenic
1147470188 17:40651250-40651272 GTTCTTCTTTCCCCAAGACAGGG + Intergenic
1149753869 17:59172209-59172231 GGTCCTCTTTCCTATGGACTTGG - Intronic
1153262037 18:3233716-3233738 GTTCTTCTTTCCTCTGGAGAAGG - Intergenic
1158275067 18:55758183-55758205 GGTCTTCTCACCTGTAAACCAGG + Intergenic
1159770235 18:72540285-72540307 GGTGTTCTTTCATCTACAGCAGG - Intronic
1160132971 18:76246079-76246101 GGTCCTCTTTCCTCTCTACATGG + Intergenic
1160848108 19:1175530-1175552 GGTTCTCTCTCCCCTAGACCAGG - Intergenic
1161045474 19:2132127-2132149 GGTCCTCTTTCCTCCATCCCTGG - Intronic
1162824766 19:13244674-13244696 TGTCTTCCCTCCTCTAGCCCCGG - Intronic
1163686856 19:18716672-18716694 TGTCGTCTTTCCTGTAGAGCTGG + Intronic
1168104125 19:54156218-54156240 AGTCTTCTTTCCTCTAGAAAGGG - Intronic
1168463174 19:56578980-56579002 GTTCATCTTTCCTCTCTACCAGG - Exonic
925284683 2:2708215-2708237 GGCCTTCTTTCCACTCGGCCCGG + Intergenic
925471414 2:4165252-4165274 GGACTTCTATCCTCCAGAACTGG + Intergenic
925879764 2:8342659-8342681 GTTCTTCCTGCCTCAAGACCTGG + Intergenic
927194677 2:20539359-20539381 GATCTTCTTTCCTCTGCACTAGG + Intergenic
927846454 2:26474889-26474911 GGTCCTCCTACCTCTAGTCCAGG + Intronic
928340680 2:30440626-30440648 GGACTTTTGACCTCTAGACCTGG + Intergenic
934736368 2:96691763-96691785 GCTCCTGTTTCCTCTAGCCCAGG - Intergenic
935459066 2:103307280-103307302 GGTCTTCTGACCTCTAGAACTGG - Intergenic
936488106 2:112944418-112944440 GGTTTCCTTTCCTCCACACCTGG + Intergenic
936508379 2:113126297-113126319 GGTCTTCTGACCTCCAGCCCCGG - Intronic
937114096 2:119391892-119391914 GGCCTTCCTTCCTCCAGACCTGG - Intergenic
937771284 2:125723340-125723362 GGTCTTCTTCCCTCAAAACCAGG + Intergenic
941924772 2:170884092-170884114 GGTCTCCTTGCCTCTCGACTTGG - Intergenic
944683965 2:202101489-202101511 GGACTCCTTTCCTCTGGGCCTGG - Intronic
945427318 2:209722882-209722904 GGTTTTCTTTCCTCTAAAAATGG + Intronic
1169451692 20:5717470-5717492 GGTCTTCTTTCCTCTAGACTGGG - Intergenic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1171202940 20:23256368-23256390 GGACTTCTGGCCTCCAGACCTGG - Intergenic
1172432710 20:34905902-34905924 AGGCCTCTTTCCTCTACACCAGG - Intronic
1172509525 20:35490753-35490775 GTTCTTCTTCCCTCTGGGCCTGG - Exonic
1172917015 20:38450763-38450785 GGTTTTCTTCCATCTAGGCCAGG + Intergenic
1174604112 20:51748087-51748109 GGTCTGTTTCTCTCTAGACCAGG + Intronic
1175334278 20:58185016-58185038 GGCCTTCTGGCCTCTAGAACGGG + Intergenic
1176587719 21:8605043-8605065 TTTCTTCTTTCCTCTAGCCAGGG + Intergenic
1180270549 22:10582042-10582064 TTTCTTCTTTCCTCTAGCCAGGG + Intergenic
1181011302 22:20042407-20042429 AGTTTTCTTTCCTCAAGACCAGG + Intronic
1181438603 22:22924312-22924334 GGACTTCTGACCTCCAGACCTGG - Intergenic
1182009546 22:26989133-26989155 GGTCTTCTTACTCCTAGAGCTGG + Intergenic
1184862332 22:47179853-47179875 GGTTTTCTTTCCCCTAGAAGCGG + Intergenic
951043955 3:18017784-18017806 GGATTTCCTTCCTCTAGACATGG + Intronic
951961483 3:28328475-28328497 GCTCTTCTTTTCTCTAAAACAGG - Intronic
952930728 3:38358999-38359021 TGTCTTCATTCCTCTAGTGCTGG - Intronic
953191590 3:40692438-40692460 GGACTTCTTTGCCCTATACCAGG - Intergenic
954229045 3:49201911-49201933 GGTTTTCTTTCCTTTTGAGCTGG - Intronic
959437147 3:106329974-106329996 GGTGTTCTTTCCACTAGGACAGG - Intergenic
962201280 3:133403110-133403132 GGTGGCCTTTCCTCTAGGCCTGG - Intronic
963546998 3:146672067-146672089 GGCCCTCTTTCCTCCACACCAGG - Intergenic
964394759 3:156233864-156233886 AGTCTTCTTTCCTCAAGAAAAGG - Intronic
964977417 3:162637380-162637402 AGTCTTCTGTCCACTAGACATGG + Intergenic
969716068 4:8868753-8868775 GGACATCTTTCCTCTTGTCCCGG - Intronic
971530729 4:27685271-27685293 GGCTTTCTTTCCACTATACCAGG - Intergenic
973035505 4:45401149-45401171 TGTCTTCTAACCTCTAGAGCTGG - Intergenic
974387750 4:61225039-61225061 GGTCTTCTCACTTCTAAACCAGG + Intronic
976077864 4:81320067-81320089 GGGCAGCTTTCCTCTAGACCCGG + Intergenic
976770536 4:88647412-88647434 GCTTTTCTGTTCTCTAGACCTGG - Intronic
981103889 4:140858832-140858854 CATCATCTTTCCACTAGACCAGG - Intergenic
981121544 4:141056875-141056897 TTTCTTCTTTCCTCAAGCCCTGG - Intronic
982661932 4:158217865-158217887 CATATTCTTTCCTCTAGAGCAGG + Intronic
984253780 4:177365953-177365975 GGTTGTCTTTCCTCTAAAACTGG - Intergenic
986843175 5:11721809-11721831 GGTCTACTTCCCTGTAGCCCTGG + Intronic
989384498 5:40841359-40841381 GTTCCTGTTTCCTCTAAACCAGG - Exonic
992696796 5:79297296-79297318 GGGCTTCTTTCTTCTTGCCCAGG + Intronic
993453393 5:88099539-88099561 GGCCTTCTTGCATTTAGACCAGG - Intergenic
994736611 5:103563490-103563512 GGTCTTCTAACTTCCAGACCAGG + Intergenic
995434463 5:112120066-112120088 TATCTACTTTCCTCTAGACCAGG + Intergenic
995921147 5:117314578-117314600 GGTATGCTTTCCTCTAGAGAAGG + Intergenic
996792393 5:127306729-127306751 GGACTTCTTTCCTCTAACCATGG - Intronic
998761249 5:145434577-145434599 TCTCCTCTTTTCTCTAGACCTGG - Intergenic
999201682 5:149821059-149821081 AGTCTTCTTGCCTCCAGAGCCGG + Intronic
1000181145 5:158812576-158812598 GGACTTCCTGCCTTTAGACCCGG + Intronic
1000382987 5:160645555-160645577 TTTCTTCTTTCTTCTAGTCCAGG + Intronic
1002347307 5:178557041-178557063 GGACTTCTTGCCCCTAGAACTGG - Intronic
1003078397 6:3001800-3001822 GCTCTTTTTTCCTGTAGGCCTGG + Intronic
1005054765 6:21719230-21719252 GGACTTCTTCCCTCCAGAACTGG - Intergenic
1005198658 6:23318314-23318336 GATCTTCTTACCTCAAGACAGGG - Intergenic
1005375736 6:25180480-25180502 GATTTTCTTTCCTCTAGAGCTGG - Intergenic
1007169452 6:39852421-39852443 GCTCTGCCTTCCTCTAGGCCAGG - Intronic
1007617509 6:43189072-43189094 GGTCTTTTTGGCTCTAGAACTGG + Intronic
1012464769 6:99504919-99504941 AGTCTTGTTTCGTCTAGGCCAGG - Intronic
1012655182 6:101808114-101808136 TGTTTTCTTCCCTCTAGAGCTGG - Intronic
1014052667 6:116974065-116974087 GGTCTCCTTTCCTATAGTCATGG + Intergenic
1014138089 6:117910495-117910517 TGTCTTCTTTCCTCTACCCTTGG + Intronic
1015883837 6:137896084-137896106 GGCCTACTTTCCTCTAATCCTGG + Intergenic
1016367898 6:143338607-143338629 GTTCTGCTTTCCACTAGTCCAGG + Intronic
1016656495 6:146524253-146524275 TGTCTTTTATCCACTAGACCAGG + Intergenic
1016887190 6:148969660-148969682 GGCCATTTTTCCTCCAGACCTGG + Intronic
1017057662 6:150452710-150452732 AGTGTTCCTTCCTCTAGGCCAGG + Intergenic
1018565054 6:165143044-165143066 GTTCTTCCTTCCTCTAGCCTTGG - Intergenic
1019958173 7:4433667-4433689 GATCCTCTCTCCTCTAGAGCAGG + Intergenic
1022289063 7:28983905-28983927 GTTCTTCTTTCCTCTTTCCCTGG - Intergenic
1022612796 7:31894251-31894273 AGTCTTCTTTTCTCCATACCAGG + Intronic
1029841408 7:103367604-103367626 GGTTTTCTTACCTCTAGATCGGG - Exonic
1029927734 7:104335305-104335327 GGTATCCTTTCCTCTACACATGG - Intronic
1031384492 7:121131296-121131318 GGTTTTATTTCCTCAATACCTGG + Intronic
1033771913 7:144561898-144561920 GTGCTTTTTTCCTCTAGACATGG + Intronic
1034575352 7:151992376-151992398 GGACTTCTGGCCTCTAGAACTGG - Intronic
1035320972 7:158029071-158029093 GTTCTTCTTTGCTCCAGAGCAGG - Intronic
1037612725 8:20489989-20490011 TGTCTTCTTTCAGCTAGAGCTGG - Intergenic
1039261112 8:35772968-35772990 TGTTTGCTTTCCTCTAGACAAGG + Intronic
1039649037 8:39320708-39320730 TGTGTTTTTTCCTCTAGATCAGG + Intergenic
1041214529 8:55586528-55586550 GTTCTTCTTGCCTTTGGACCCGG - Intergenic
1041900788 8:62979734-62979756 AGTCTTCTTTCCTCTGCACTTGG + Exonic
1048469090 8:134691293-134691315 GGTCTTCTCTCCTGCAGGCCTGG + Intronic
1049328426 8:142036920-142036942 GGTCTTCTTTTCTCTAGCTATGG - Intergenic
1049342000 8:142118150-142118172 GGGCTTCTGACCTCTAGAGCCGG + Intergenic
1051686911 9:19667553-19667575 GGTCTTCTAGCCTCTAGTCTTGG + Intronic
1055279913 9:74662457-74662479 TGTCTTCTCTCCTCAAGTCCAGG + Exonic
1056013568 9:82357994-82358016 CCTCATCTTTCCTCTAGAACAGG - Intergenic
1057914995 9:99048452-99048474 TGGCTTTTTTCTTCTAGACCAGG - Intronic
1058148190 9:101434732-101434754 GGTGCTCTTTCCTCTAAACTTGG + Intronic
1058755835 9:108082486-108082508 GGACTTCTGGCCTCTAGAACTGG - Intergenic
1059611125 9:115896951-115896973 GGTCTTTTTTTCTCTAGAACTGG - Intergenic
1059799550 9:117736444-117736466 GCTCTACTTTCTTCTAGAGCAGG + Intergenic
1060468020 9:123924868-123924890 GGTTTTCTTGCCTCAAGGCCTGG + Intronic
1061213412 9:129206435-129206457 GGGTTTCTGTCCTCCAGACCTGG + Intergenic
1203617682 Un_KI270749v1:83224-83246 TTTCTTCTTTCCTCTAGCCAGGG + Intergenic
1186091280 X:6051650-6051672 GGTCTTCTGGCCTCCAGAACCGG + Intronic
1186681322 X:11877051-11877073 TGTCTCCTTTTCTCTAGACCAGG - Intergenic
1189186030 X:39056062-39056084 GGTGGTCTTTCCTCTTGACAGGG + Intergenic
1189395019 X:40613512-40613534 AGTCTCCTTTAATCTAGACCAGG - Intergenic
1190733560 X:53240415-53240437 GGTCTTCTCTCCTTTAGAGCAGG - Intronic
1197192801 X:123666914-123666936 TGTCTTCTAACGTCTAGACCAGG - Intronic
1197567643 X:128107488-128107510 GGTAAACTTTCCTCTGGACCAGG + Intergenic
1198141734 X:133810889-133810911 GGTCTTCTATCTTCTAGGCCAGG - Intronic
1199026426 X:142943903-142943925 GGTAGTCTTTACTCTAGAGCAGG - Intergenic
1201696070 Y:16827801-16827823 TGTCTTCTCTCCTATAGACAGGG + Intergenic
1202151824 Y:21850610-21850632 GGGCTTCTTTCCTCAACATCTGG - Intergenic