ID: 914746702 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:150506466-150506488 |
Sequence | TGCGCGCGCGTGTCTGAAGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 71 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 57} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
914746702_914746708 | 21 | Left | 914746702 | 1:150506466-150506488 | CCCCCTTCAGACACGCGCGCGCA | 0: 1 1: 0 2: 0 3: 13 4: 57 |
||
Right | 914746708 | 1:150506510-150506532 | ACACACAGTTTCTCTCTGTGGGG | 0: 2 1: 0 2: 3 3: 20 4: 345 |
||||
914746702_914746706 | 19 | Left | 914746702 | 1:150506466-150506488 | CCCCCTTCAGACACGCGCGCGCA | 0: 1 1: 0 2: 0 3: 13 4: 57 |
||
Right | 914746706 | 1:150506508-150506530 | ACACACACAGTTTCTCTCTGTGG | 0: 2 1: 0 2: 10 3: 53 4: 401 |
||||
914746702_914746707 | 20 | Left | 914746702 | 1:150506466-150506488 | CCCCCTTCAGACACGCGCGCGCA | 0: 1 1: 0 2: 0 3: 13 4: 57 |
||
Right | 914746707 | 1:150506509-150506531 | CACACACAGTTTCTCTCTGTGGG | 0: 2 1: 0 2: 1 3: 37 4: 480 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
914746702 | Original CRISPR | TGCGCGCGCGTGTCTGAAGG GGG (reversed) | Intronic | ||