ID: 914746702

View in Genome Browser
Species Human (GRCh38)
Location 1:150506466-150506488
Sequence TGCGCGCGCGTGTCTGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914746702_914746708 21 Left 914746702 1:150506466-150506488 CCCCCTTCAGACACGCGCGCGCA 0: 1
1: 0
2: 0
3: 13
4: 57
Right 914746708 1:150506510-150506532 ACACACAGTTTCTCTCTGTGGGG 0: 2
1: 0
2: 3
3: 20
4: 345
914746702_914746706 19 Left 914746702 1:150506466-150506488 CCCCCTTCAGACACGCGCGCGCA 0: 1
1: 0
2: 0
3: 13
4: 57
Right 914746706 1:150506508-150506530 ACACACACAGTTTCTCTCTGTGG 0: 2
1: 0
2: 10
3: 53
4: 401
914746702_914746707 20 Left 914746702 1:150506466-150506488 CCCCCTTCAGACACGCGCGCGCA 0: 1
1: 0
2: 0
3: 13
4: 57
Right 914746707 1:150506509-150506531 CACACACAGTTTCTCTCTGTGGG 0: 2
1: 0
2: 1
3: 37
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914746702 Original CRISPR TGCGCGCGCGTGTCTGAAGG GGG (reversed) Intronic