ID: 914746702

View in Genome Browser
Species Human (GRCh38)
Location 1:150506466-150506488
Sequence TGCGCGCGCGTGTCTGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914746702_914746707 20 Left 914746702 1:150506466-150506488 CCCCCTTCAGACACGCGCGCGCA 0: 1
1: 0
2: 0
3: 13
4: 57
Right 914746707 1:150506509-150506531 CACACACAGTTTCTCTCTGTGGG 0: 2
1: 0
2: 1
3: 37
4: 480
914746702_914746706 19 Left 914746702 1:150506466-150506488 CCCCCTTCAGACACGCGCGCGCA 0: 1
1: 0
2: 0
3: 13
4: 57
Right 914746706 1:150506508-150506530 ACACACACAGTTTCTCTCTGTGG 0: 2
1: 0
2: 10
3: 53
4: 401
914746702_914746708 21 Left 914746702 1:150506466-150506488 CCCCCTTCAGACACGCGCGCGCA 0: 1
1: 0
2: 0
3: 13
4: 57
Right 914746708 1:150506510-150506532 ACACACAGTTTCTCTCTGTGGGG 0: 2
1: 0
2: 3
3: 20
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914746702 Original CRISPR TGCGCGCGCGTGTCTGAAGG GGG (reversed) Intronic
901059663 1:6466166-6466188 TGCGGGCGCGGGGCTGAAGGCGG - Exonic
903142316 1:21345933-21345955 CGCGCGCGCGTGTGTGTAAGAGG + Intergenic
904263191 1:29303128-29303150 TGGGCGTGCGTGTCCCAAGGCGG + Intronic
914746702 1:150506466-150506488 TGCGCGCGCGTGTCTGAAGGGGG - Intronic
916168471 1:161983592-161983614 TGCGCGCACGTGTGTGTAGGTGG - Exonic
922165152 1:223109148-223109170 TGCGCGCGTGTGTGTGTTGGAGG + Intergenic
924778253 1:247126277-247126299 CTCCCGCGCGTGTCTGAATGAGG - Intronic
924783405 1:247172143-247172165 CTCCCGCGCGTGTCTGAATGAGG + Intergenic
1066467849 10:35669181-35669203 TGTGCGTGCGTGTGTGTAGGGGG + Intergenic
1068130594 10:52890332-52890354 TGGGCACCCATGTCTGAAGGAGG - Intergenic
1073139822 10:101239682-101239704 TGCGCGCGCGCGTGTGTAGAAGG - Intergenic
1076117015 10:127907600-127907622 AGGGCGCGCGTGTCTGCGGGTGG + Intronic
1078465250 11:11545513-11545535 TGCACGCGCTTATCTGAATGTGG - Intronic
1090178770 11:124674684-124674706 TGCGTGCGTGTGTGTGAGGGAGG - Exonic
1093108365 12:15117659-15117681 TGTGTGCGCGTGTGTGATGGAGG - Intronic
1096749639 12:53750823-53750845 TGCGTGCTCGTGTCTGCAGGAGG + Intergenic
1098671976 12:73242187-73242209 TGCGCGCGCGTGTGTGGTGTTGG + Intergenic
1106758763 13:32847691-32847713 TGCGCACGCATGTGTGAAGAAGG + Intergenic
1108363708 13:49690488-49690510 TGCGTGCGCGTGTGTGGTGGGGG + Intronic
1118925495 14:70187642-70187664 CGCGCGCGCGTGTGTGTTGGGGG + Intronic
1122040526 14:98984671-98984693 TGCCCCCGCGTGTCTCAAAGGGG + Intergenic
1125270534 15:37934100-37934122 CGCGCGCGCGTGTGTGTAGGGGG - Intronic
1130369205 15:83269442-83269464 TGTGCGCGCGCATCTGGAGGAGG + Intronic
1134291087 16:12903066-12903088 CGAGCGCGCGTGTGTGAAGGAGG + Intronic
1137853288 16:51767783-51767805 CGCGCGCGCGTGTGGGAGGGAGG + Intergenic
1143038789 17:4017048-4017070 TGCGTGTGTGTGTGTGAAGGTGG + Intronic
1152268042 17:79307597-79307619 TGCGTGAGGGTGTCTGCAGGAGG - Intronic
1160357891 18:78244192-78244214 TGTGTGCGCGTGTGTGAAGTGGG - Intergenic
1160429131 18:78799602-78799624 TGCGCGCGCGCGTGTGCAGTGGG - Intergenic
1160890593 19:1376631-1376653 TGCATGAGCGTGTCTGAAGATGG + Exonic
1162486002 19:10960988-10961010 GGCGCGCGTGTGTGTGAAGGGGG + Exonic
1165531902 19:36409975-36409997 TGTGCGCGCGTGTGTGTTGGAGG - Intronic
927215309 2:20665326-20665348 TGCGGGCGCATGGCTGCAGGGGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934954746 2:98608348-98608370 CGCGTGCGCGGGCCTGAAGGAGG - Exonic
936247155 2:110838231-110838253 TGCGTGTGCATGTCTGAATGTGG + Intronic
937950853 2:127387380-127387402 TGTGCGCGCGTGTGTGTCGGGGG - Intronic
939012939 2:136868100-136868122 TGCGCGCGCGTGTGTGTGTGTGG - Intronic
942034726 2:171999832-171999854 TGCGCGCGCGGGGCTGACTGCGG - Exonic
942708050 2:178799507-178799529 TGCCCGCACGTGTCTGACCGGGG + Exonic
1172587327 20:36093716-36093738 TGCGCGCGCGTGTGTGGATGTGG + Intronic
1173167085 20:40692899-40692921 TGCGCGCGCGTGTGTGTTGGTGG + Intergenic
1175775339 20:61649636-61649658 GGAGCGCGCGTGGCTGAACGGGG + Intronic
1179337924 21:40475117-40475139 TGCGCACGACAGTCTGAAGGAGG - Intronic
1184198648 22:42949444-42949466 TGCGCGCGCGTGTGTGTATGAGG - Intronic
954000799 3:47555162-47555184 TGCGAGCACATGTGTGAAGGTGG - Intergenic
960465935 3:117996886-117996908 TGCGCGCGCGCGTGTGAACGGGG - Intergenic
968448431 4:663923-663945 TGCGCCCCCGTGTCTGCCGGGGG - Intronic
985611381 5:891539-891561 TGCGCCTGCGTGGCTGGAGGAGG - Intronic
985698661 5:1357625-1357647 TGGGGGCCAGTGTCTGAAGGAGG + Intergenic
989033990 5:37150506-37150528 TGTGCGCGCGTGTGTGTTGGGGG - Intronic
991005327 5:61822928-61822950 GGCGCGCGTGTGTTTGCAGGAGG - Intergenic
992247336 5:74839390-74839412 TGTGCGCACGTGTGTGAAGGAGG - Intronic
993503150 5:88684335-88684357 TGCACGCGGGTGTGTAAAGGAGG + Intergenic
1002559737 5:180072907-180072929 CGCGCGCGCGTTTCGGAAGGTGG - Intergenic
1004412302 6:15392071-15392093 TGTGTGTGCGTGTCTGGAGGTGG + Intronic
1007093787 6:39200914-39200936 TGCCTGCCCATGTCTGAAGGTGG - Intronic
1009609845 6:65927312-65927334 TGCGTGTGTGTGTGTGAAGGAGG + Intergenic
1015134242 6:129849890-129849912 TCCGTGCACGTGTGTGAAGGGGG + Intronic
1035230943 7:157465115-157465137 TGTGTGCGCGGGCCTGAAGGCGG + Intergenic
1035257898 7:157643694-157643716 TGGGTGCGGGTGTCTGCAGGGGG - Intronic
1037172832 8:15913889-15913911 TGTGCACGTGTGTCTAAAGGGGG + Intergenic
1044306594 8:90646369-90646391 TGCGCGCGCCTGTGGGAAGTCGG - Intronic
1050461986 9:5885021-5885043 TGCTCTCGGGTGTCTGAGGGAGG + Intronic
1057164044 9:92912717-92912739 TGCGCGCGCGTCTCACAAGTTGG - Intergenic
1057786060 9:98087993-98088015 GGCGTGCGCGCGTCTGCAGGGGG + Exonic
1061252891 9:129437051-129437073 CGCGCGCGCGTGCCTGACCGCGG + Intergenic
1062403395 9:136382224-136382246 TGCGCGTGGGTGTCTGCAGCAGG + Intronic
1187257919 X:17657995-17658017 GGCGCCAGCCTGTCTGAAGGGGG + Intronic
1195316846 X:103687504-103687526 CGCGCGCGCGTGCGTGATGGTGG + Intronic
1197782487 X:130171887-130171909 TGCGCGCGCGCGCGTGAAGGGGG - Exonic