ID: 914746708

View in Genome Browser
Species Human (GRCh38)
Location 1:150506510-150506532
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 2, 1: 0, 2: 3, 3: 20, 4: 345}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914746704_914746708 19 Left 914746704 1:150506468-150506490 CCCTTCAGACACGCGCGCGCACA 0: 1
1: 0
2: 3
3: 11
4: 124
Right 914746708 1:150506510-150506532 ACACACAGTTTCTCTCTGTGGGG 0: 2
1: 0
2: 3
3: 20
4: 345
914746702_914746708 21 Left 914746702 1:150506466-150506488 CCCCCTTCAGACACGCGCGCGCA 0: 1
1: 0
2: 0
3: 13
4: 57
Right 914746708 1:150506510-150506532 ACACACAGTTTCTCTCTGTGGGG 0: 2
1: 0
2: 3
3: 20
4: 345
914746705_914746708 18 Left 914746705 1:150506469-150506491 CCTTCAGACACGCGCGCGCACAC 0: 1
1: 0
2: 8
3: 48
4: 256
Right 914746708 1:150506510-150506532 ACACACAGTTTCTCTCTGTGGGG 0: 2
1: 0
2: 3
3: 20
4: 345
914746703_914746708 20 Left 914746703 1:150506467-150506489 CCCCTTCAGACACGCGCGCGCAC 0: 1
1: 0
2: 1
3: 13
4: 73
Right 914746708 1:150506510-150506532 ACACACAGTTTCTCTCTGTGGGG 0: 2
1: 0
2: 3
3: 20
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type