ID: 914746708 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:150506510-150506532 |
Sequence | ACACACAGTTTCTCTCTGTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 370 | |||
Summary | {0: 2, 1: 0, 2: 3, 3: 20, 4: 345} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
914746703_914746708 | 20 | Left | 914746703 | 1:150506467-150506489 | CCCCTTCAGACACGCGCGCGCAC | 0: 1 1: 0 2: 1 3: 13 4: 73 |
||
Right | 914746708 | 1:150506510-150506532 | ACACACAGTTTCTCTCTGTGGGG | 0: 2 1: 0 2: 3 3: 20 4: 345 |
||||
914746702_914746708 | 21 | Left | 914746702 | 1:150506466-150506488 | CCCCCTTCAGACACGCGCGCGCA | 0: 1 1: 0 2: 0 3: 13 4: 57 |
||
Right | 914746708 | 1:150506510-150506532 | ACACACAGTTTCTCTCTGTGGGG | 0: 2 1: 0 2: 3 3: 20 4: 345 |
||||
914746704_914746708 | 19 | Left | 914746704 | 1:150506468-150506490 | CCCTTCAGACACGCGCGCGCACA | 0: 1 1: 0 2: 3 3: 11 4: 124 |
||
Right | 914746708 | 1:150506510-150506532 | ACACACAGTTTCTCTCTGTGGGG | 0: 2 1: 0 2: 3 3: 20 4: 345 |
||||
914746705_914746708 | 18 | Left | 914746705 | 1:150506469-150506491 | CCTTCAGACACGCGCGCGCACAC | 0: 1 1: 0 2: 8 3: 48 4: 256 |
||
Right | 914746708 | 1:150506510-150506532 | ACACACAGTTTCTCTCTGTGGGG | 0: 2 1: 0 2: 3 3: 20 4: 345 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
914746708 | Original CRISPR | ACACACAGTTTCTCTCTGTG GGG | Intronic | ||