ID: 914750393

View in Genome Browser
Species Human (GRCh38)
Location 1:150531162-150531184
Sequence CTGATTATACAAATGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914750390_914750393 7 Left 914750390 1:150531132-150531154 CCCCAAATGACTGATCTGTACAC No data
Right 914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG No data
914750391_914750393 6 Left 914750391 1:150531133-150531155 CCCAAATGACTGATCTGTACACT No data
Right 914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG No data
914750392_914750393 5 Left 914750392 1:150531134-150531156 CCAAATGACTGATCTGTACACTA No data
Right 914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914750393 Original CRISPR CTGATTATACAAATGAACAA TGG Intergenic
No off target data available for this crispr