ID: 914751184

View in Genome Browser
Species Human (GRCh38)
Location 1:150536139-150536161
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914751176_914751184 20 Left 914751176 1:150536096-150536118 CCAAGTGCTGAATGAAGCTGGAA No data
Right 914751184 1:150536139-150536161 CAGTATGTGCTTCTTGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr