ID: 914753221

View in Genome Browser
Species Human (GRCh38)
Location 1:150549534-150549556
Sequence GTCTAACGGGACCCGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914753221_914753235 24 Left 914753221 1:150549534-150549556 CCCTCTCCCGGGTCCCGTTAGAC 0: 1
1: 0
2: 0
3: 6
4: 46
Right 914753235 1:150549581-150549603 TCCCCTCTCCCTGCGCTGTGCGG 0: 1
1: 0
2: 6
3: 23
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914753221 Original CRISPR GTCTAACGGGACCCGGGAGA GGG (reversed) Intronic
902348784 1:15837945-15837967 GTCTAATAGGATCCTGGAGATGG + Intergenic
904464267 1:30698639-30698661 GTCTCTCGGGACCAGGCAGAGGG + Intergenic
907312114 1:53544661-53544683 GTGTAACAGGAACCTGGAGAGGG - Intronic
913508176 1:119538423-119538445 TTCTAAGGTGACCCAGGAGAGGG - Intergenic
914753221 1:150549534-150549556 GTCTAACGGGACCCGGGAGAGGG - Intronic
920648326 1:207819116-207819138 GTGTATCGGGAGCCGGGAGATGG - Intergenic
922682724 1:227614096-227614118 GTCTAACTGGGCCCAGCAGATGG - Intronic
1067284207 10:44895539-44895561 GTCAAACGGTGCCCAGGAGAAGG + Intergenic
1074434022 10:113418479-113418501 GTCCAAAAGGACCTGGGAGATGG + Intergenic
1075677649 10:124307350-124307372 GTCTAATGGGACCATGGAGTGGG - Intergenic
1076786705 10:132753277-132753299 GTTTAACCGGACCGTGGAGATGG - Intronic
1077749406 11:4948055-4948077 GTCTAATGGGTCTGGGGAGATGG - Intronic
1077750013 11:4956685-4956707 GTCTAATGGGTCCGGGGAGATGG - Intronic
1084146856 11:67269631-67269653 ATCTGACGGGACCCTGGAGTGGG - Intronic
1089363776 11:117908771-117908793 CTCTTGCAGGACCCGGGAGAAGG - Exonic
1090806096 11:130203261-130203283 GTCTCATGGGACGGGGGAGAGGG - Intronic
1102224088 12:111215759-111215781 GTCTAAGCTGACCAGGGAGAGGG - Intronic
1104645979 12:130497502-130497524 GTCTCACGGGCCATGGGAGAAGG + Intronic
1113488793 13:110676307-110676329 GTCCAAGGGGACCAGGGAGAAGG + Intronic
1114255238 14:20996112-20996134 GTCAAAAGGGGCCAGGGAGAAGG - Intronic
1115400164 14:32948881-32948903 ATCTAAAGGGAGCGGGGAGAGGG + Intronic
1121751603 14:96362821-96362843 GTCCAAGGGGACCTGGGCGAGGG + Exonic
1121904039 14:97723524-97723546 GTCTTAGGGGTCCTGGGAGAAGG - Intergenic
1136929986 16:34410049-34410071 GTCAAACAGGGCCAGGGAGAAGG - Intergenic
1136974588 16:35001756-35001778 GTCAAACAGGGCCAGGGAGAAGG + Intergenic
1137250642 16:46738029-46738051 GTCTCACCGGGCCAGGGAGATGG - Exonic
1139594947 16:67951992-67952014 GTCAAACTGGTCCCGGGACAGGG + Exonic
1148195064 17:45707302-45707324 GGCTGACGGGGCCCAGGAGAAGG - Intergenic
1151823321 17:76509072-76509094 GAATAAAGGGACCAGGGAGAGGG + Intergenic
1151825067 17:76519430-76519452 GAATAAAGGGACCAGGGAGAGGG - Intergenic
1156488962 18:37485333-37485355 GCCCAACGGGATCCGGGACAGGG - Intronic
1163740641 19:19009783-19009805 TTCTAAAGAGACCCTGGAGATGG + Intronic
1166960688 19:46494298-46494320 CACTAACGGGACCCGCGTGAAGG - Exonic
933310361 2:80652724-80652746 GTATACCGGGACTTGGGAGAAGG + Intergenic
939234834 2:139477689-139477711 GTGGAAGGGGACCCGGAAGAGGG - Intergenic
945998670 2:216462445-216462467 GTCTAACGGTCCCCAGGAGCAGG - Intronic
1173834374 20:46115651-46115673 GTCAAATGGGACCAGGCAGAAGG + Intergenic
1173916001 20:46709431-46709453 AACGAAGGGGACCCGGGAGATGG + Intergenic
1175633513 20:60561324-60561346 CTCCAAGGGGACCCTGGAGATGG - Intergenic
1179374959 21:40841941-40841963 GTCTAACAGGAACCGGGCAAAGG - Intronic
950498222 3:13347117-13347139 GCCTCACAGGACCCAGGAGATGG + Intronic
950939037 3:16874705-16874727 CTTTAATGGGACCAGGGAGAAGG + Intronic
951282684 3:20771987-20772009 GTCTCAGGAGACCAGGGAGAGGG + Intergenic
961038687 3:123661807-123661829 GACACAGGGGACCCGGGAGAGGG - Intronic
961402322 3:126656059-126656081 GCCTCATGGGACCCAGGAGATGG - Intergenic
1016886907 6:148967496-148967518 GTCTAATGGGACCAAGGAGATGG - Intronic
1019478514 7:1255487-1255509 GCCTCACGGGACCGGGGAGAGGG - Intergenic
1027243068 7:76345852-76345874 TTGAACCGGGACCCGGGAGATGG + Intronic
1044188787 8:89288557-89288579 GTCTAAGGGGACCATGGATAGGG + Intergenic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1053070868 9:35101219-35101241 GTCTGAGGGGACCCGAGAGTCGG - Exonic
1057272802 9:93660248-93660270 GTGTGACGGGGACCGGGAGAAGG + Exonic
1187675356 X:21710993-21711015 TTCTACCGGGACCCGGGAGTGGG - Intronic