ID: 914754550

View in Genome Browser
Species Human (GRCh38)
Location 1:150555287-150555309
Sequence CAGCACAAGCTGAGGTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914754550_914754554 10 Left 914754550 1:150555287-150555309 CCTGACCACCTCAGCTTGTGCTG 0: 1
1: 0
2: 0
3: 28
4: 196
Right 914754554 1:150555320-150555342 TCCTTCATCCACAGTGACCTGGG 0: 1
1: 0
2: 0
3: 23
4: 238
914754550_914754557 21 Left 914754550 1:150555287-150555309 CCTGACCACCTCAGCTTGTGCTG 0: 1
1: 0
2: 0
3: 28
4: 196
Right 914754557 1:150555331-150555353 CAGTGACCTGGGCAACCTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 189
914754550_914754553 9 Left 914754550 1:150555287-150555309 CCTGACCACCTCAGCTTGTGCTG 0: 1
1: 0
2: 0
3: 28
4: 196
Right 914754553 1:150555319-150555341 TTCCTTCATCCACAGTGACCTGG 0: 1
1: 0
2: 1
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914754550 Original CRISPR CAGCACAAGCTGAGGTGGTC AGG (reversed) Intronic
900018189 1:169135-169157 CAGCACAAGCTGCGGAGTGCAGG + Intergenic
900048448 1:527731-527753 CAGCACAAGCTGCGGAGTGCAGG + Intergenic
900070675 1:769583-769605 CAGCACAGGCTGAGGAGTGCAGG + Intergenic
900390324 1:2431073-2431095 CAGCAGAAGCTCAGGAGCTCAGG - Intronic
900695233 1:4005582-4005604 CAGCCCCAGCTGAGCTGGGCAGG - Intergenic
901462757 1:9401245-9401267 CAGGGCAACCTGAGGTGGTGAGG - Intergenic
902268752 1:15288126-15288148 CAGCACAGGCAGTGGTGGACAGG - Intronic
902640883 1:17765379-17765401 GAGCTCAAGCAGAGGTGGTTTGG - Intronic
902670194 1:17967837-17967859 CAGCCCCAGATGAGGTGGGCAGG + Intergenic
903443054 1:23402594-23402616 CAGCCTCAGCTGAGGTGGTGAGG - Intronic
905346896 1:37317537-37317559 CAGCCCAAGATCAGGAGGTCAGG - Intergenic
906193827 1:43916394-43916416 CAGCACAAGGTAAGATGGACTGG + Intronic
907575576 1:55522925-55522947 CAGCTCATGCTGAGGTTGTAGGG - Intergenic
908885117 1:68780260-68780282 AAGTACAAGCTGAGGTGGTGAGG + Intergenic
909013984 1:70363913-70363935 CAGAACAACTTGAGGTGGTGAGG + Intronic
911012574 1:93296880-93296902 CAACACAAGCTAAAGTGCTCTGG - Intergenic
912387385 1:109278500-109278522 CAGCTCTGGCTGAGGTGATCAGG + Intergenic
912643840 1:111372420-111372442 CACCACAGGCTGAAGTGCTCTGG + Intergenic
914754550 1:150555287-150555309 CAGCACAAGCTGAGGTGGTCAGG - Intronic
915273523 1:154772502-154772524 AAGAGCATGCTGAGGTGGTCAGG - Intronic
915540642 1:156563717-156563739 CTGCCCAGGCTGTGGTGGTCAGG + Intronic
917402685 1:174668266-174668288 CACCAGAGGCTGTGGTGGTCAGG - Intronic
920298997 1:204976965-204976987 CAGAACAAGCTGTGCTGGACAGG + Intronic
922106035 1:222514998-222515020 CAGCACAAGCTGAGGAGTGCAGG + Intergenic
922161476 1:223081658-223081680 CAGCACACCGGGAGGTGGTCAGG + Intergenic
924066849 1:240232478-240232500 CATCAGAAGCTGACATGGTCTGG - Intronic
924348216 1:243092566-243092588 CAGCACAAGCTGAGGAGTGCAGG + Intergenic
924481558 1:244439776-244439798 CAGCACAGGCTAAAGTGCTCTGG - Intronic
1063740510 10:8813852-8813874 AAGCACAAGTTGAGATGGTTAGG + Intergenic
1065426977 10:25616010-25616032 CATCACAGGCTGATGTGCTCTGG - Intergenic
1066728144 10:38412335-38412357 CAGCACAAGCTGAGGAGTGCAGG - Intergenic
1067287155 10:44914930-44914952 CAGCCCCTGCTGAGGTGGCCAGG + Intronic
1069071952 10:63998438-63998460 CAGGACAGACTGAGGTGCTCTGG + Intergenic
1071604833 10:86978538-86978560 TAGCACTTGCTGAGGTGGGCGGG + Intronic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1073563234 10:104514669-104514691 CAGCACAAGCTTAGCAGGCCAGG - Intergenic
1073890847 10:108098770-108098792 TAGCAGAGGCTGAGGTGGTTAGG + Intergenic
1074533100 10:114310465-114310487 CAGCAGAGGCTGAGGTCCTCTGG + Intronic
1074864311 10:117535960-117535982 CATCACAACCTGGTGTGGTCAGG - Intergenic
1075894358 10:125982183-125982205 CACCACAAGCTGTGTTGGGCAGG + Intronic
1076974791 11:164331-164353 CAGCACAAGCTGAGGAGTGCAGG + Intergenic
1077037354 11:501838-501860 CAGCATGGGCTGAGGTGGGCGGG - Intronic
1080994814 11:37586741-37586763 CAGCAAAAGAAGAGGTGGTGGGG - Intergenic
1081584145 11:44372609-44372631 CAACCCAAGCTGAGCTGGGCTGG - Intergenic
1083004209 11:59326130-59326152 CAACACAAGCTGATATGGTTTGG - Intergenic
1083996357 11:66274948-66274970 CACCTCAAGCAGAGGTGGTCTGG + Intronic
1084678454 11:70650671-70650693 GAGCAAAAGCTTAGGGGGTCAGG - Intronic
1086240922 11:84690088-84690110 TACCAGAGGCTGAGGTGGTCGGG + Intronic
1086847893 11:91774238-91774260 CACCACAGGCTGAAGTGCTCTGG - Intergenic
1086892241 11:92271409-92271431 CAGCATTAGCTAAGGTGGTCAGG - Intergenic
1088810534 11:113388572-113388594 CAGTGCAGGCTGAGGAGGTCAGG + Intronic
1089498709 11:118920677-118920699 CAGGACAAGAAGAGGTGGACAGG + Intronic
1091005514 11:131949742-131949764 CAGCACTAGCTGGAGTGGGCCGG - Intronic
1092204083 12:6605145-6605167 CAGTGGAAGTTGAGGTGGTCTGG - Intronic
1097338977 12:58416227-58416249 AGGCAGAAGCTGAGGTTGTCGGG + Intergenic
1097563725 12:61240391-61240413 CAGCATCAGCTGAATTGGTCTGG + Intergenic
1097714930 12:62955750-62955772 CATCACAGGCTGAAGTGCTCTGG - Intergenic
1098942295 12:76551751-76551773 CAGCAGGAGCTGAGGTGGGTGGG - Intronic
1101745751 12:107540193-107540215 CAGGTCAAGGTCAGGTGGTCTGG + Intronic
1106107241 13:26743224-26743246 AAGCACAGGCTGTGGTGGCCCGG + Intergenic
1111020067 13:82437724-82437746 AAGTCCAGGCTGAGGTGGTCTGG + Intergenic
1114804201 14:25815306-25815328 CAGGAAAAGCTCAGGAGGTCGGG - Intergenic
1116124907 14:40771908-40771930 CAGCACAACCTAAGGTTATCGGG + Intergenic
1118029597 14:61807532-61807554 GAGGACAGGCTCAGGTGGTCTGG - Intergenic
1118034263 14:61849446-61849468 CACCACAAGCTAAAGTGCTCTGG - Intergenic
1119631433 14:76235735-76235757 CAGCACTAATTGAGTTGGTCAGG + Intronic
1121982834 14:98469501-98469523 CAGAAAAAGCTGAGTTGGTCAGG + Intergenic
1122130421 14:99601985-99602007 CAGCTCAGGCTGAGGGGTTCTGG + Intronic
1122168508 14:99850955-99850977 CAGCTCTAGCTGATGTGGTTCGG + Exonic
1122643894 14:103178579-103178601 CAGCACGATCTGCGGTGCTCAGG - Intergenic
1129686037 15:77686609-77686631 CACCATGAGCTGAGGTGTTCTGG + Intronic
1131183878 15:90258689-90258711 CACCACCTGCTCAGGTGGTCTGG + Intronic
1131997098 15:98143554-98143576 GAGCAGAAGGTGAGGAGGTCTGG - Intergenic
1132302638 15:100785609-100785631 CAGCTACAGCTGAGGTGCTCTGG - Intergenic
1135040383 16:19113692-19113714 CCGCACAAGCTGCGGTGGCGTGG - Intergenic
1138412451 16:56851083-56851105 CAGCACAAGCTGAGGGCCCCAGG - Intergenic
1139340940 16:66267481-66267503 CAGCCCCATCTGGGGTGGTCAGG + Intergenic
1141151440 16:81567226-81567248 CAGCACAAGCTCCCGTGGTGCGG - Intronic
1142068069 16:88074075-88074097 GAGGACAAGCTGAGATGGTAAGG - Intronic
1142445471 16:90133326-90133348 CAGCACAAGCTGCGGAGTGCAGG - Intergenic
1142613550 17:1122492-1122514 CAGCTCACGCTCAGGTAGTCAGG - Intronic
1143048365 17:4101097-4101119 CTGCACAGGCTGAGCTGCTCAGG + Intronic
1146195637 17:30810336-30810358 GATCACAAGATCAGGTGGTCAGG + Intronic
1148349743 17:46932001-46932023 CAGCAGAATCTGAGGGGGCCAGG - Intronic
1150531724 17:65990652-65990674 CACCACAAGCTGGAGTGCTCTGG + Intronic
1151510117 17:74553213-74553235 CCTCACAACATGAGGTGGTCAGG + Intergenic
1151785530 17:76273151-76273173 GAGCCCAAGCTCAGGAGGTCAGG + Intergenic
1152175496 17:78784133-78784155 GAGCAAGAGCTGAGGTGGTCTGG - Intergenic
1152190457 17:78884621-78884643 CAGGACAAGCTTAGGGAGTCTGG - Intronic
1153661516 18:7330369-7330391 CAGCAGAAGAAGAGGAGGTCAGG - Intergenic
1155493485 18:26421681-26421703 CAGAAAAGCCTGAGGTGGTCAGG + Intergenic
1156479958 18:37430136-37430158 CAGCTCAGGCTGAGGTGGGGTGG - Intronic
1157545252 18:48541610-48541632 CAGGACACGCTCAGGTTGTCTGG + Intronic
1160127294 18:76187920-76187942 CACCAGGAGCTGAGGTGGTGGGG - Intergenic
1160433896 18:78831669-78831691 CACCAGAAGCTGGGGTGGACAGG - Intergenic
1160651745 19:234512-234534 CAGCACAGGCTGAGGAGTGCAGG + Intergenic
1160811244 19:1013854-1013876 CAGCAATAGCTGAGGAGGCCTGG - Intronic
1162753713 19:12844498-12844520 TAGCACAAGGTGAGGTGATAGGG + Intronic
1167610961 19:50507544-50507566 CAGCACATGCTGTGCTGCTCTGG + Intronic
1168358034 19:55714432-55714454 CTGCACAAGCTCAGGCAGTCAGG + Intronic
925741015 2:7006382-7006404 CAGCACAGGCTGAGATCTTCTGG - Intronic
926636198 2:15182153-15182175 CAGCACAACCTGAGAGGCTCTGG - Intronic
928787660 2:34909134-34909156 AAACACAAGCTGCCGTGGTCTGG + Intergenic
929555478 2:42923058-42923080 CAGCACAGGATGAGATGATCTGG - Intergenic
930710916 2:54550344-54550366 CAGCAGAAGCTCAGGTGCTGAGG + Intronic
932154002 2:69398914-69398936 CAGAATTACCTGAGGTGGTCAGG + Intronic
932512088 2:72303020-72303042 AAGCAAATGCTGAGGGGGTCTGG - Intronic
934736991 2:96694495-96694517 CAGGACAGGCGGGGGTGGTCTGG + Intergenic
935356682 2:102207863-102207885 CACCACAAGCTAAAGTGCTCTGG - Intronic
935557580 2:104527213-104527235 CAGGGCAAGCTGAGATGGACGGG - Intergenic
946014528 2:216593370-216593392 GAGCACAAGCTGAGAAGGTATGG - Intergenic
1169972668 20:11285949-11285971 AACCAAAAGCTGAGGAGGTCAGG - Intergenic
1170135990 20:13074123-13074145 CGGCACTGGCTGAGGGGGTCTGG + Intronic
1170531527 20:17297498-17297520 CAGCACTAGCTCAGGTTGACTGG + Intronic
1171967564 20:31542105-31542127 CAGCACAGGCTGAGGTTCTCAGG + Intronic
1172043809 20:32064834-32064856 CAGCAGAGGCTGAGGCGGTGAGG + Intronic
1174293030 20:49522313-49522335 CTGCTCTAGCTGGGGTGGTCAGG - Intronic
1175060646 20:56239070-56239092 CAGCCTAAGCTGAGATGGTGGGG + Intergenic
1175361032 20:58412978-58413000 CAGCACAACATGAAGAGGTCAGG - Intronic
1175983836 20:62754546-62754568 CAACACAAGTTCAGGAGGTCCGG - Intronic
1176112554 20:63417202-63417224 CAACAAAAGCACAGGTGGTCGGG + Intronic
1180672488 22:17564231-17564253 CAGGGCAGGCTGAGGTGGTGGGG - Intronic
1180834071 22:18921092-18921114 CACCACAAGGAGAGGGGGTCTGG - Intronic
1181065750 22:20305147-20305169 CACCACAAGGAGAGGGGGTCTGG + Intergenic
1183675465 22:39296878-39296900 CAGAACAGGCTGGGGTGGGCTGG - Intergenic
1183976044 22:41512948-41512970 CAGCACATCCTGAGGAGGCCAGG - Intronic
1184964965 22:47965011-47965033 AAGCACAGGATGAAGTGGTCAGG - Intergenic
1203284159 22_KI270734v1_random:146390-146412 CACCACAAGGAGAGGGGGTCTGG - Intergenic
949809054 3:7986186-7986208 CAGCAGAGGCTGATGGGGTCTGG + Intergenic
950201599 3:11048410-11048432 CATCACAGGCTGTGGGGGTCTGG - Intergenic
952730534 3:36633553-36633575 CGACACAAGCTGAGGAGCTCAGG - Intergenic
954801381 3:53189011-53189033 CAGCAGGAGCTGAGGTGCTGAGG - Intronic
957482049 3:80810855-80810877 CAGCAGGAGGTGAGGAGGTCGGG + Intergenic
958757933 3:98272267-98272289 CACCACAAGCTGAAGTGCTCTGG - Intergenic
962734819 3:138316515-138316537 CAGCATCATCTGAGATGGTCAGG + Intronic
962828707 3:139121210-139121232 GAGCACAGGCTGAGGTGATGAGG - Intronic
963140963 3:141945856-141945878 CAGCACCAGCTGGTGTGGTGTGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967352722 3:188531922-188531944 AATCACAAGCTGCGGTGGTGGGG - Intronic
968010318 3:195270355-195270377 CAGCACCAGCTGAGGGCGTCTGG + Intronic
968366087 3:198185456-198185478 CAGCACAAGCTGAGGAGTGCAGG - Intergenic
968709425 4:2102212-2102234 CAGCACAAGTTCACCTGGTCTGG + Intronic
969545210 4:7821756-7821778 CAGCACAAGCTGAGGGAATTTGG - Intronic
972180679 4:36461498-36461520 CTGGCCAAGCTGAGGTGTTCAGG - Intergenic
972207717 4:36798220-36798242 CATCACAGGCTGAAGTGCTCTGG + Intergenic
972244783 4:37234364-37234386 CAGCAGAAGCTGTGGTCGTTGGG - Intergenic
978654276 4:111048382-111048404 CACCATAAGCTGACGTGTTCTGG + Intergenic
979333831 4:119445398-119445420 CAGCACAAGCTGAGGAGTGCAGG + Intergenic
980322520 4:131297426-131297448 CAGCACAGGCCGAGGCGGGCAGG - Intergenic
980448683 4:132943835-132943857 AAGTCCAAGCTGAGGTGGTCAGG - Intergenic
985522978 5:387623-387645 CAGAAGAGGCTGAGGAGGTCAGG - Intronic
985861624 5:2476030-2476052 CAGCAGAAGCAGAGGGGGTCTGG + Intergenic
986423434 5:7607083-7607105 CAGATGAAGCTGAGGTGGTGTGG - Intronic
986670218 5:10136888-10136910 CACCAGAAGCTAAGGTGGCCAGG - Intergenic
991575462 5:68098849-68098871 CACCACAAGCTGAGATCCTCTGG + Intergenic
993981172 5:94545231-94545253 CACCACAGGCTGCGGTGCTCTGG + Intronic
994310163 5:98259939-98259961 CACCACAGGCTGAAGTGCTCTGG - Intergenic
995393930 5:111667321-111667343 CAGCAAGAGCTGAGCTGGTGAGG + Intronic
995648349 5:114339194-114339216 CAGCTCAAGCTGAGGAGTTGTGG + Intergenic
997285460 5:132675023-132675045 CAGAGCAAGCTGAGGAGCTCTGG - Intronic
998633936 5:143931661-143931683 CATCATAAGCTGAAGTGTTCTGG + Intergenic
998745270 5:145251548-145251570 CATCACCAGCTGAGGTGGTTGGG - Intergenic
1000762336 5:165241817-165241839 CAGCAGAAACTGAAGTGGTAAGG + Intergenic
1001960854 5:175879753-175879775 CAGCACTGGCTGAGGTGGCCAGG - Intronic
1002725313 5:181290681-181290703 CAGCACAAGCTGAGGAGTGCAGG - Intergenic
1002926339 6:1607878-1607900 CACCACTTGCTGAGGTGTTCAGG + Intergenic
1005964260 6:30715679-30715701 CTGATCAAACTGAGGTGGTCTGG - Intronic
1006163306 6:32050198-32050220 CAGGACAGGCTGAGGGAGTCGGG + Intronic
1006163930 6:32053588-32053610 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006164557 6:32056786-32056808 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006165556 6:32062357-32062379 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1006166507 6:32068590-32068612 CAGGACAGGCTGAGGGAGTCAGG + Intronic
1007809843 6:44477976-44477998 CAGCAGGAGATGAGGTGGGCAGG + Intergenic
1011631330 6:89327812-89327834 CAGCAGAGGTTGAGGTGGTGGGG + Exonic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1012978345 6:105803890-105803912 CAATACAAGCTGAGGTGGTGGGG - Intergenic
1013012633 6:106134197-106134219 CAGCACAGGGTGAGCTGCTCTGG + Intergenic
1013055980 6:106583203-106583225 CAGCACAAGGTCAGGTGAGCAGG + Intronic
1013067741 6:106700061-106700083 CAGCAGAGGATGAGGAGGTCTGG + Intergenic
1016425917 6:143935365-143935387 AAGCACAGGCTGTGATGGTCAGG + Intronic
1017192560 6:151669492-151669514 CAGCACAACCTGGGGAGGTGGGG + Intronic
1020402541 7:7795309-7795331 CAGAATATGCTGAGCTGGTCAGG + Intronic
1021034710 7:15784322-15784344 CACCACAAGCTAAAGTGTTCTGG + Intergenic
1023056722 7:36296500-36296522 CAGCACAGGGAAAGGTGGTCAGG - Intronic
1023519327 7:41034938-41034960 CAGCCCATGCTGAGACGGTCTGG - Intergenic
1024070219 7:45778294-45778316 CAGCACAAGCTGAGGAGTGCAGG - Intergenic
1025002420 7:55327770-55327792 CAGGACCAGCTGATGAGGTCAGG - Intergenic
1025990086 7:66491118-66491140 CAGCACAAGCTGAGGAGTACAGG + Intergenic
1026038655 7:66847453-66847475 CAGCACAAGCTGAGGAGTACAGG - Intergenic
1026849738 7:73717322-73717344 CAGCACTGGCTGAGCTGGACTGG - Intronic
1027212727 7:76164098-76164120 CAGCACAAGCTAAGGAGTACAGG + Intergenic
1028622512 7:92840529-92840551 AAGCACATGCTGAGGTCGTGGGG + Intergenic
1028972488 7:96874969-96874991 CACCACAAGCTAAAGTGCTCTGG + Intergenic
1030354477 7:108526825-108526847 CAGCAGAACCTGCGGTGGGCTGG - Intronic
1030629843 7:111883711-111883733 CAGGAAAAGGTGATGTGGTCAGG + Intronic
1031873502 7:127112295-127112317 CAACACTAGATGGGGTGGTCAGG - Intronic
1032047621 7:128622586-128622608 CAGCACAAGCTGAGGAGTGCAGG - Intergenic
1032528462 7:132599117-132599139 TAGCAAAAACTGGGGTGGTCAGG - Intronic
1036579115 8:10056126-10056148 TAGCACAAGCTGAGGAAGTCTGG - Intronic
1036655972 8:10677726-10677748 CAGCAATCGGTGAGGTGGTCAGG + Intronic
1037119186 8:15262597-15262619 CTGTACAACCTGTGGTGGTCAGG - Intergenic
1040511604 8:48100762-48100784 CACCATAAGCTGAAGTGCTCTGG - Intergenic
1042593850 8:70424582-70424604 CAGCACAAGCGGCGGTGTGCAGG + Intergenic
1042898292 8:73694980-73695002 CACCACAGGCTGAAGTGCTCCGG + Intronic
1044404628 8:91813793-91813815 GATCACAAGCTGAGGTGGAGAGG - Intergenic
1045733513 8:105268098-105268120 CATCACAGGCTGAAGTGCTCTGG - Intronic
1046995696 8:120519736-120519758 CCACAGAAGCTGAGGTGCTCAGG + Intronic
1048348373 8:133595533-133595555 CAGCAACAGCTGGGGTGGCCAGG + Intergenic
1048677922 8:136805582-136805604 CAGCACAGCCTTAGGAGGTCCGG + Intergenic
1049853955 8:144850021-144850043 CAGCACAAGGTGGGGAGGACGGG - Intronic
1053433780 9:38061507-38061529 CAGCACAAGCTAAGCTAATCAGG + Intronic
1054754797 9:68946750-68946772 CACCACCATCTGAGGTGGTGGGG - Intronic
1057128381 9:92636870-92636892 CACCAGTTGCTGAGGTGGTCTGG - Intronic
1062750456 9:138248323-138248345 CAGCACAAGCTGCGGAGTGCAGG - Intergenic
1190221950 X:48517383-48517405 CAGCACAGTCTGAGGAGCTCAGG - Intronic
1190265067 X:48823288-48823310 CAGCATCCTCTGAGGTGGTCTGG - Exonic
1190482369 X:50889951-50889973 AAGCACCAGCTGTGGTGGGCAGG - Intergenic
1190752599 X:53375253-53375275 CAGGACAGGCAGAGGTGGTCAGG - Exonic
1191609985 X:63102000-63102022 CAGGGCAACCTTAGGTGGTCTGG + Intergenic
1192534597 X:71916580-71916602 CACCACATGCTGATGTGGTCAGG - Intergenic
1193912902 X:87327519-87327541 CACCACCAACTGAGGTGATCAGG - Intergenic
1194415396 X:93605919-93605941 CACCACAAGCTGAAGTGCTCTGG + Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197587334 X:128364461-128364483 CACCACAAGCTAAAGTGCTCTGG - Intergenic
1197648427 X:129041228-129041250 CAGCCCAAACTGAGCTGTTCTGG - Intergenic