ID: 914758057

View in Genome Browser
Species Human (GRCh38)
Location 1:150577451-150577473
Sequence TTCCATGTAGAGGACCTAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914758057 Original CRISPR TTCCATGTAGAGGACCTAGA AGG (reversed) Exonic
900098868 1:952513-952535 TTTCATGCAGTGGACCTTGACGG - Exonic
904497951 1:30898039-30898061 TTCCATGTGGAGGACCTGTGGGG + Intronic
906050967 1:42871618-42871640 TTCTATGTAGAGGAAGAAGAAGG + Intergenic
907674728 1:56507978-56508000 TTCCATCTAGAGGATCTAAGGGG - Intronic
907689318 1:56645921-56645943 TTCCATGTAAAGCACCTAACAGG - Intronic
914758057 1:150577451-150577473 TTCCATGTAGAGGACCTAGAAGG - Exonic
916894148 1:169144123-169144145 TTCCATGTAGGGAAACTACATGG - Intronic
919076033 1:192813928-192813950 TTCCATGCAGAGGAACTATTAGG - Intergenic
920904933 1:210154390-210154412 TTCCATGGACAGGATGTAGAGGG - Intronic
920980698 1:210831742-210831764 TTCAGTGGAGAAGACCTAGAGGG - Intronic
921667250 1:217887805-217887827 TTCCATGGCGAGGTCTTAGATGG - Intergenic
1066496899 10:35950753-35950775 TTCCATGTCAGGCACCTAGAAGG - Intergenic
1067564278 10:47325693-47325715 ATCCTTGTAGAGGACGGAGATGG - Exonic
1067700553 10:48568431-48568453 TTCCATGTAGAGGGGCTAAGGGG + Intronic
1073514882 10:104067365-104067387 TTACATCCAGAGGACCTAGTAGG + Intronic
1073623228 10:105070583-105070605 TTCCATGTAGAGTTCTTAAAAGG - Intronic
1074176081 10:111004700-111004722 TTCCATGTTGAGGGAATAGATGG - Exonic
1078507817 11:11965533-11965555 GTCCATGGAGAGGACATGGAGGG - Intronic
1086358725 11:86034797-86034819 TTCCATGTAGAGAAAGCAGAAGG + Intronic
1090028067 11:123184620-123184642 TTCTCTGCAGAGGACCTAAAAGG + Intronic
1090498700 11:127240459-127240481 TTCCACATAGTGTACCTAGATGG - Intergenic
1104662124 12:130618691-130618713 TTCCATGGAAAGTGCCTAGACGG + Intronic
1107271978 13:38630417-38630439 TTCGATCCAGAAGACCTAGAAGG - Intergenic
1112719662 13:102229108-102229130 TAACACGTAGAAGACCTAGAAGG + Intronic
1113759697 13:112838731-112838753 TTCCTTGGAGAGGCCCTAGGAGG - Intronic
1117146921 14:52845072-52845094 TTTTCTCTAGAGGACCTAGATGG + Intergenic
1119294729 14:73523690-73523712 TTTCATGTAGAGGACACAGAAGG - Intronic
1119642358 14:76324809-76324831 TTCCATCAAAAGGACCTGGAGGG - Intronic
1124104194 15:26722148-26722170 ACCCTTGTTGAGGACCTAGATGG - Intronic
1124713935 15:32041027-32041049 TTCCCTTTAGAGGACCAAAAAGG - Intronic
1128236247 15:66069423-66069445 TTACATGTAAAGCACTTAGACGG - Intronic
1129500814 15:76035975-76035997 TTTCAGGTGGTGGACCTAGATGG - Intronic
1135571904 16:23556188-23556210 CTCCGTGTAGAGAACGTAGAAGG + Intronic
1138230353 16:55331706-55331728 TTCCATAGAGAGGAGCTAGGAGG - Intergenic
1138413706 16:56859085-56859107 TTCCAAGTAGAGAACCCTGATGG - Intergenic
1139409637 16:66749196-66749218 GTCCATGATGAGGACCGAGATGG - Exonic
1140637490 16:76932539-76932561 TTCTATGTAGAGGTCTTACATGG - Intergenic
1142075664 16:88116181-88116203 TTCCATGAAGAGGATGCAGACGG + Intronic
1145797728 17:27665688-27665710 GTCCATGCAGAGAACCTGGATGG + Intergenic
1146503428 17:33384006-33384028 TTAAAAGTAGAGGAACTAGAAGG + Intronic
1150864242 17:68832912-68832934 CTCCAAATAGAGGACCTTGAGGG - Intergenic
1152593235 17:81223658-81223680 TTCCCTGGAGAGGACCTGGGCGG - Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1162933037 19:13966642-13966664 TTCCCGGTACAGGACCTGGAAGG + Exonic
925607798 2:5676371-5676393 TTCAGTGTTGAGGACATAGAGGG - Intergenic
933987287 2:87602590-87602612 TTCCCTGTAGAGGCGCTTGATGG + Intergenic
934568421 2:95353234-95353256 TTCCATGCAGAGAACCTGGGTGG + Intronic
936306552 2:111348218-111348240 TTCCCTGTAGAGGCGCTTGATGG - Intergenic
937016925 2:118614667-118614689 CCCCAGGCAGAGGACCTAGAGGG + Intergenic
937200774 2:120203414-120203436 TTCCAGAAAGAGGACCTATAGGG + Intergenic
938303193 2:130230442-130230464 TTCCATGCAGCGGACCCTGACGG + Intergenic
940192230 2:151054097-151054119 TTACATGTAGAGCACTTTGAAGG + Intergenic
941085445 2:161112161-161112183 TTCCATGTGGATGAACTATATGG - Intergenic
942285572 2:174412644-174412666 TTCTAGCTAGAGGACCTGGAAGG + Intronic
942312539 2:174668827-174668849 TTCAGTTTAAAGGACCTAGATGG - Intronic
943113037 2:183630405-183630427 TTCCATGTAAAGAACATATATGG - Intergenic
944773947 2:202942893-202942915 TTCCATCTAGTGGACCAAAATGG + Exonic
947058381 2:226133750-226133772 TAGCATGTAGAGGACAGAGATGG - Intergenic
947090633 2:226507554-226507576 TTCAATGAAGAAGACCCAGAAGG - Intergenic
1168936836 20:1673014-1673036 TTCCATAGAGAGGTCCTAAAGGG + Intergenic
1174231462 20:49048578-49048600 TTCCAGGTAGAGGGAATAGAAGG + Intronic
1174909887 20:54595958-54595980 ATGCATGTAGATGACCTGGAAGG + Intronic
1177993331 21:28065039-28065061 TTCACTGTAGAGCAACTAGATGG - Intergenic
1181829464 22:25548173-25548195 TTCCATGTTTAGGACCTGAATGG - Intergenic
1182387887 22:29962162-29962184 TTACATGTAGATGAACTAAAGGG + Intronic
1182835154 22:33335739-33335761 TTCCAGGTAGAGGAAGTAGCTGG - Intronic
950103894 3:10376404-10376426 TTCCATGTAGAGGAAACAGCAGG + Intronic
953043369 3:39274308-39274330 TTCCATGTTAAGGAGCTATAAGG + Intronic
954824392 3:53359170-53359192 TTACCTGTAGCGGACCTTGAAGG + Intergenic
955108345 3:55922666-55922688 TTCCCTGTGGGGGACCTGGAAGG - Intronic
959013572 3:101107953-101107975 CTCCCTCTGGAGGACCTAGAAGG - Intergenic
964134551 3:153329987-153330009 TGCCATGTAGCGGTCATAGAGGG + Intergenic
964245268 3:154644550-154644572 TTTCAGGTAGAGGAAGTAGATGG - Intergenic
964527890 3:157634653-157634675 CTCCAAGTAGAAGACATAGAGGG - Intronic
966059696 3:175740017-175740039 TTACATGTAGAGGACAGAAAAGG + Intronic
966343744 3:178954541-178954563 TTCCATGTTCAGTACCTACAAGG - Intergenic
971941943 4:33226923-33226945 CCCCATGTAGGGGACCTAGTGGG + Intergenic
972492161 4:39598054-39598076 TTGCATGTTAAGGACCAAGAGGG - Intronic
976222956 4:82772761-82772783 TTCTATGAAGAGGACATACAGGG - Intronic
979371417 4:119892437-119892459 TTCTCTGTTGAGGACCTATAGGG - Intergenic
981423545 4:144578418-144578440 TTCCATGCAAGGGACTTAGAAGG + Intergenic
983423717 4:167555283-167555305 TTCAATGTAGAGTAACTATAAGG - Intergenic
984377021 4:178945037-178945059 TTCCAGGTACAGGACAAAGATGG - Intergenic
991347227 5:65682399-65682421 TTCTACGTAGAGGATCTACATGG + Intronic
992033162 5:72744251-72744273 TTCCATGTAAAATATCTAGACGG + Intergenic
992796564 5:80259070-80259092 ATCCAAGTAAAGAACCTAGAAGG + Intergenic
993028414 5:82673444-82673466 TTCCACGTAGAGGAAGGAGAGGG - Intergenic
994870835 5:105348894-105348916 TTCCAATTAGAGCATCTAGAAGG - Intergenic
998897370 5:146814299-146814321 TTTCATGTAGAAGAGCTACAAGG - Intronic
1010825710 6:80471334-80471356 TTTAATGCAGAGGACCTAGTAGG + Intergenic
1013777305 6:113692626-113692648 TTAAATGGAAAGGACCTAGAAGG + Intergenic
1017016722 6:150107019-150107041 TTCCATTTATAAGACCGAGAAGG - Intergenic
1022540764 7:31133575-31133597 AGCCAAGTAGAGGACCCAGAAGG - Intergenic
1023506994 7:40910109-40910131 TTCCATGTTGAAAACCAAGAAGG - Intergenic
1027698065 7:81435878-81435900 TTACATGTATAGGATGTAGAAGG - Intergenic
1028066402 7:86390741-86390763 ATCCATGGAGAAGACCTAGCAGG - Intergenic
1028606091 7:92657330-92657352 TTCCAAGGAGTAGACCTAGAAGG + Intronic
1030529314 7:110693379-110693401 TTAAATGTGGAGGACATAGAAGG - Intronic
1037673697 8:21036940-21036962 GACCATGGAGAGGAACTAGATGG + Intergenic
1043173691 8:76997860-76997882 TTCCATGTAAAGAAACTACAGGG + Intronic
1046692130 8:117297627-117297649 TTCCAGGAAGATGACCTAGAAGG + Intergenic
1047550457 8:125866703-125866725 TTCCAAATAAAGGAGCTAGAGGG + Intergenic
1048408643 8:134149164-134149186 TTCCATGTGGAGGAGCTGAAGGG + Intergenic
1049273981 8:141710661-141710683 TTCCTTGGAGAGCACCTAGGAGG + Intergenic
1053293424 9:36897042-36897064 TTCCTTCAGGAGGACCTAGAAGG + Intronic
1053407583 9:37890884-37890906 TTCCAAGTGAAAGACCTAGACGG - Intronic
1054803590 9:69377230-69377252 ATGCATGTAAAGGACTTAGATGG - Intronic
1055913185 9:81374366-81374388 ACCCATGTACAGGCCCTAGAGGG + Intergenic
1058638752 9:107062561-107062583 TTCTATATAGATGTCCTAGATGG + Intergenic
1058872985 9:109218535-109218557 GTCCATGGAGAGGCTCTAGAGGG - Intronic
1186281518 X:7998357-7998379 TTCCATGTAGAGGCTTTGGAAGG + Intergenic
1189976495 X:46465518-46465540 ATCCATGTAAAGCACCTAAAAGG + Intronic
1194818634 X:98477614-98477636 TATCATGTAGAGAAGCTAGAGGG - Intergenic
1200776053 Y:7171275-7171297 GACCATGAAGAGGACCAAGAAGG - Intergenic