ID: 914760912

View in Genome Browser
Species Human (GRCh38)
Location 1:150597537-150597559
Sequence ATCTGAGGCCAGGAGTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914760912_914760917 10 Left 914760912 1:150597537-150597559 CCTTAAAACTCCTGGCCTCAGAT No data
Right 914760917 1:150597570-150597592 CGTTAGCCTCTGAAGTAGCTGGG No data
914760912_914760916 9 Left 914760912 1:150597537-150597559 CCTTAAAACTCCTGGCCTCAGAT No data
Right 914760916 1:150597569-150597591 ACGTTAGCCTCTGAAGTAGCTGG No data
914760912_914760919 18 Left 914760912 1:150597537-150597559 CCTTAAAACTCCTGGCCTCAGAT No data
Right 914760919 1:150597578-150597600 TCTGAAGTAGCTGGGACTATAGG 0: 15
1: 573
2: 9444
3: 80477
4: 248585

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914760912 Original CRISPR ATCTGAGGCCAGGAGTTTTA AGG (reversed) Intergenic
No off target data available for this crispr