ID: 914764310

View in Genome Browser
Species Human (GRCh38)
Location 1:150624511-150624533
Sequence CCACTTTCCCAGCCTACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 2, 1: 0, 2: 2, 3: 26, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914764310_914764315 -10 Left 914764310 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG 0: 2
1: 0
2: 2
3: 26
4: 231
Right 914764315 1:150624524-150624546 GGGAAAGTGGGCTGGGTCAGAGG 0: 2
1: 0
2: 5
3: 50
4: 572
914764310_914764316 6 Left 914764310 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG 0: 2
1: 0
2: 2
3: 26
4: 231
Right 914764316 1:150624540-150624562 TCAGAGGCAAGAAGCTTCCATGG 0: 3
1: 0
2: 1
3: 28
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914764310 Original CRISPR CCACTTTCCCAGCCTACCTC TGG (reversed) Intronic
900092609 1:926946-926968 CCCCTCCCCCATCCTACCTCAGG - Intronic
900181856 1:1314619-1314641 CCCCTTTTCCCTCCTACCTCAGG - Intronic
900243841 1:1628894-1628916 CCCCTTTCCCAGGCTGCCTAGGG - Intronic
900355222 1:2258354-2258376 CCACTGTCCCATCCTCCCTAGGG - Intronic
900423394 1:2565273-2565295 CCACTAACCCAGCCTCCCCCGGG - Intronic
900432049 1:2607089-2607111 TCACTCTCCCAGCCTCCCTGTGG + Intronic
902609412 1:17588354-17588376 CCCCTTTCCCAGCCTCCCCAGGG - Intronic
903152806 1:21424505-21424527 CCACTTTCCCATCCTATGACTGG + Intergenic
903160324 1:21483479-21483501 CCACTTTCCCATCCTATGACTGG - Exonic
903231850 1:21927058-21927080 GCCCCTTCCCAGCCCACCTCCGG - Intronic
903464797 1:23544687-23544709 CCACTTTGTCATCCTTCCTCTGG + Intergenic
903873507 1:26455184-26455206 CCATTTTCACAGATTACCTCAGG + Intronic
904480439 1:30789832-30789854 CCACGTCCCCAGACTCCCTCAGG + Intergenic
905242803 1:36591943-36591965 CCACTCTCCCAGTTTGCCTCAGG + Intergenic
906258159 1:44366459-44366481 CCTCTATGCCAGCCCACCTCAGG - Intergenic
906884749 1:49632207-49632229 CCATATTCCCAGACTCCCTCTGG - Intronic
906966506 1:50462569-50462591 CCACTTTCCCACACTGCCTAGGG - Intronic
907272168 1:53297552-53297574 CCACCTTCCCATCCCACCTGGGG + Intronic
909572295 1:77129095-77129117 CCATTTTCACAGATTACCTCAGG - Intronic
910000924 1:82341383-82341405 CCACTTTTCTAGCTTATCTCTGG - Intergenic
910299231 1:85686801-85686823 CCTCTCCCCCATCCTACCTCTGG - Intronic
911163245 1:94702515-94702537 CCTTGTTCCCAGCCTTCCTCAGG + Intergenic
912348879 1:108992263-108992285 CCATTTTCACAGATTACCTCAGG - Intronic
913480137 1:119280253-119280275 CAACTTTCTGAGCCTGCCTCAGG + Intergenic
914764310 1:150624511-150624533 CCACTTTCCCAGCCTACCTCTGG - Intronic
915954375 1:160210222-160210244 CCACATTCCCAGCCTAATGCTGG + Intronic
916053183 1:161050074-161050096 CCACTATCCTATCCTGCCTCAGG + Intronic
916498940 1:165369903-165369925 CCACTCTTCCAGCTGACCTCAGG + Intergenic
918375220 1:183902025-183902047 CCTCTTTCTCAGCTTATCTCAGG + Intronic
919697367 1:200591628-200591650 ACACTCTCCCAGTCTTCCTCTGG + Intronic
920749519 1:208660353-208660375 CAGCTTTCCCAGGCTACCTTTGG + Intergenic
921314228 1:213875371-213875393 CCACATTCCAGGGCTACCTCTGG - Intergenic
921553320 1:216566228-216566250 CCACTTTCTCAGCAAAGCTCAGG + Intronic
922241225 1:223756565-223756587 CCAGTTTCCCAGCACACCCCTGG + Intronic
922617164 1:226967688-226967710 CCACTAACCCAGGCTCCCTCTGG - Intronic
922801980 1:228368611-228368633 CCACTGTCCCACCCTGCCCCCGG + Intronic
923498114 1:234542367-234542389 CCACTGTCCCACTCTCCCTCTGG + Intergenic
1063391304 10:5651414-5651436 CCACTTTCCCATCCTGCTGCAGG + Intronic
1067169734 10:43896928-43896950 CCACTTTATCAGCTTGCCTCTGG - Intergenic
1067703365 10:48589324-48589346 CCGCTTCCCCAGCCTGCTTCTGG + Intronic
1067759123 10:49029991-49030013 CCAGGTTCCCAGTGTACCTCTGG + Intronic
1069450908 10:68517083-68517105 CAAGATTCCCAGCCTTCCTCAGG - Intronic
1069610986 10:69772421-69772443 CACCTCTCCCAGCCTACCTCTGG + Intergenic
1069634999 10:69919696-69919718 CCTCTTTCCCAGCAAACCTGGGG - Intronic
1070685643 10:78478384-78478406 CCAGTCTCCCAGCCTAAGTCTGG - Intergenic
1072215532 10:93284555-93284577 CCATTTTCACAGATTACCTCAGG + Intergenic
1072914712 10:99530816-99530838 CCACTTCCCCACCCCACCTCCGG - Intergenic
1073205964 10:101769530-101769552 ACACTTCCCCAGGCCACCTCAGG - Intergenic
1074360502 10:112821333-112821355 CCACTTCCCCGGCCTCCCCCAGG + Intergenic
1074495634 10:113977928-113977950 CCCCTTTCCCATCCTTTCTCTGG + Intergenic
1075011307 10:118872599-118872621 CCATTTTCACAGATTACCTCAGG + Intergenic
1075353183 10:121744780-121744802 CCTGTTTCCCAGCCTTCCTGTGG + Intronic
1076103691 10:127803417-127803439 CCACCACCCCAGCCCACCTCTGG - Intergenic
1079279083 11:19072109-19072131 CGACTTTCCCAGTCTTCCACAGG + Intergenic
1080658762 11:34278887-34278909 CCACTTTCCCAGCCTGTTTATGG - Intronic
1083488192 11:62996517-62996539 CCACCTCCCCAGCCTTCCTTGGG + Intronic
1084189461 11:67492375-67492397 CCAGTCCCCCAGCCTGCCTCAGG - Intronic
1085517020 11:77117508-77117530 CCACTTTGCCAGTCTTGCTCAGG + Intronic
1088858283 11:113776292-113776314 CTCCTTTCTCAGCCTAACTCTGG - Intergenic
1089615240 11:119691394-119691416 CCACTTTCCCCGCCCACCTCAGG - Intronic
1089843055 11:121435429-121435451 AACCTTTCCAAGCCTACCTCAGG - Intergenic
1090356534 11:126144245-126144267 CCTCTTTCCCAGCCCAGCTTTGG - Intergenic
1091751000 12:3021095-3021117 ACACTGTCCCAGCCTCTCTCTGG + Intronic
1092412947 12:8268182-8268204 CGACTGTCCCAGCCAAACTCTGG + Intergenic
1092487536 12:8914939-8914961 TTGCTTTCCCTGCCTACCTCCGG + Intronic
1092954251 12:13534939-13534961 CCAGTCTCCCAGGCTCCCTCTGG + Intergenic
1096572272 12:52530465-52530487 CCACCTTCCCAGCCTTCTCCTGG + Intergenic
1097051584 12:56226377-56226399 TCAGCTTCCCAGCCTACCACTGG + Exonic
1099091008 12:78308110-78308132 CTAATCTCCCAGCCTGCCTCTGG + Intergenic
1099533969 12:83823412-83823434 CCACTTTGCCAGCCTTGCTTGGG + Intergenic
1100161293 12:91864164-91864186 CCACCGTCCCAGCCTCACTCTGG + Intergenic
1100200778 12:92295828-92295850 TCACTTTCCCATCATTCCTCAGG - Intergenic
1101708152 12:107240139-107240161 CCACCTTCACAGCAGACCTCTGG - Intergenic
1102219752 12:111186488-111186510 CCTCTTCCCCACCCGACCTCAGG - Intronic
1102436127 12:112925355-112925377 CCCCTCTCCCAGCCAACCGCAGG + Intronic
1103043635 12:117717111-117717133 CCACTCTCCCAGCCCACCTTGGG + Intronic
1104967872 12:132517395-132517417 CTGCTTTCCCAGCCTCACTCTGG + Intronic
1106704504 13:32266366-32266388 TCACTTTCCCTGCGTATCTCTGG + Intronic
1108372223 13:49781291-49781313 CCATTTTCCTACTCTACCTCAGG - Intronic
1108688634 13:52843459-52843481 CCTCTTTCCTTGCCTTCCTCTGG - Exonic
1112264768 13:97913227-97913249 CCTCTTTCCCATCCTCCCACTGG - Intergenic
1114667017 14:24384042-24384064 CCACTCTCCAAGCCTATGTCAGG - Intergenic
1118206424 14:63727809-63727831 CCGCTTTCTCATCCTCCCTCCGG + Exonic
1118810162 14:69267302-69267324 CCTCTTTCCCAAAGTACCTCTGG - Intronic
1119129919 14:72162524-72162546 CCCCACTCCCATCCTACCTCAGG - Intronic
1120299751 14:82691571-82691593 CCACTTTCCCAGCCTACCTCTGG - Intergenic
1122115364 14:99524862-99524884 CCACCTGCCCAGTCTTCCTCGGG + Intronic
1122455392 14:101846195-101846217 CCAATGTCCCCGCCTCCCTCCGG - Intronic
1124465662 15:29936951-29936973 CCAATTTCCCATCATACCTATGG + Intronic
1125887982 15:43243079-43243101 GCACTTTCCCACCCTAACACAGG + Intronic
1128079942 15:64850969-64850991 CACCTCTCCCAGCCTGCCTCAGG + Intronic
1128115939 15:65105515-65105537 CCATTTTCACAGATTACCTCAGG - Intronic
1128892233 15:71341709-71341731 CCATTTTCACAGATTACCTCAGG + Intronic
1129110188 15:73332613-73332635 CCACTTTCTCAGCTTTCCTGGGG + Intronic
1129814770 15:78541658-78541680 CCCTTTTCCCACCCTACCCCCGG + Intronic
1131157569 15:90084567-90084589 CCCCTTTCCCAGCTTCTCTCAGG - Intronic
1133677945 16:8093160-8093182 CCACCTTCCCAGCCAATCTCTGG + Intergenic
1134756822 16:16674565-16674587 CCACTTTCCCTGCCAACGTCAGG - Intergenic
1134989246 16:18684598-18684620 CCACTTTCCCTGCCAACGTCAGG + Intergenic
1135166423 16:20143046-20143068 CCACTTTCCCCCACTCCCTCTGG - Intergenic
1135336799 16:21608501-21608523 CCACTATCCCAGCCTAACTATGG - Intronic
1137405966 16:48189720-48189742 ACACTTTCCCACCCGGCCTCTGG - Intronic
1139641674 16:68296249-68296271 CCACTTCACCAGATTACCTCTGG - Intronic
1140410219 16:74736695-74736717 CCTCTTCCCCATCCTTCCTCAGG - Intronic
1141126691 16:81405800-81405822 CAACTTTTCCAGCCTGACTCCGG + Intergenic
1141432215 16:83976121-83976143 CCCCAATCCCAGCCTCCCTCTGG - Intronic
1141779733 16:86151460-86151482 CCACTTTCCTGGCGTTCCTCAGG - Intergenic
1141798257 16:86289053-86289075 CCAGTTTGCCAGAATACCTCAGG + Intergenic
1142314677 16:89336157-89336179 CCACTTGTCCAGGATACCTCTGG + Intronic
1142485555 17:245723-245745 CCACTTCTCCAGCCAATCTCGGG + Intronic
1143588238 17:7862885-7862907 CCACCTTCCCATCCTAACTTTGG - Intronic
1145055586 17:19701835-19701857 CCACCATGCCAGCCTTCCTCTGG + Intronic
1146306170 17:31731314-31731336 CCACTTTCCCAGGCTGCCTCTGG + Intergenic
1147358784 17:39918336-39918358 CCACTTCCCCATCCTACCTTTGG + Intronic
1148204935 17:45774283-45774305 CCTCCTTCCCAGCCTTGCTCCGG - Intergenic
1148618246 17:49015610-49015632 CCACTTCCTCAGTCTACCCCAGG + Intronic
1148669108 17:49397146-49397168 CCACTTTTCCAGTCTAGCTGGGG + Intronic
1149422992 17:56528852-56528874 TCTCTTTCCCAGCTTACCTGTGG + Intergenic
1150741761 17:67784734-67784756 CCATTTTCACAGATTACCTCAGG - Intergenic
1151781719 17:76251099-76251121 CCAGTTTACCAGCATACCCCTGG + Intergenic
1152136928 17:78509892-78509914 CCACTGCGCCAGCCTACTTCTGG - Intronic
1152244894 17:79180217-79180239 CCCCATCCCCAGCCTACCTAGGG + Intronic
1152415727 17:80160509-80160531 CCACTTCCCCAAGCTACCTTTGG - Intergenic
1155164115 18:23218861-23218883 CCCCTTCCCCAGCCTCCATCAGG - Intronic
1155833614 18:30549417-30549439 CAACGTGCCCAGCCTTCCTCAGG + Intergenic
1155937811 18:31772373-31772395 CCCCCTTCCCAGCCTTCCCCCGG - Intergenic
1157437863 18:47686513-47686535 CCACTCTCCCAATCTACATCGGG + Intergenic
1157438601 18:47692374-47692396 CCCCTTTCCCAGCCAACCTGGGG + Intergenic
1157500331 18:48186053-48186075 GCAGTTTCCCGGCCGACCTCAGG + Intronic
1157604771 18:48919195-48919217 CCCCTTCCCCAGCCTAGCTCTGG - Intergenic
1157763646 18:50282235-50282257 CCACATTCCCAGCCTCCCACGGG - Intergenic
1158881416 18:61782928-61782950 CCTCCTTCCCAGCCTACCTGGGG + Intergenic
1158942248 18:62415657-62415679 CCATTTTCACAGATTACCTCAGG - Intergenic
1161524925 19:4748318-4748340 CCACATTCCCAGCCTACTCCCGG + Intergenic
1162102258 19:8346496-8346518 CCATTTTCCCAGATTACCTCAGG - Intronic
1165099485 19:33430389-33430411 CCACTTACCCAGACTGCCCCCGG - Intronic
1166344020 19:42154153-42154175 CCACACTCACATCCTACCTCTGG - Intronic
1166978925 19:46621455-46621477 CCCCTTTCCCAGCTCGCCTCAGG - Exonic
1167568390 19:50271555-50271577 CCACTTTCCCAGCTGCCCTCAGG - Intronic
925076347 2:1019456-1019478 CCACATTCCCAGCACACCTATGG - Intronic
927478905 2:23434922-23434944 CCACTTCCAGAGCCTCCCTCTGG - Intronic
929488760 2:42378149-42378171 CCATTTTCCCAGCCCCCCTTAGG + Intronic
929777741 2:44939195-44939217 GCACCTGCCCAGCCTCCCTCCGG + Intergenic
932218731 2:69983972-69983994 CTCCTTTCCCAGCCTTCCTGAGG + Intergenic
934539008 2:95159446-95159468 CCGCTGTCCCTGCCTAGCTCCGG + Exonic
936083524 2:109451393-109451415 CCACTTTCCAAGTCTGCCCCTGG - Intronic
937323081 2:120972531-120972553 CCACACACCCAGCCTAGCTCAGG + Intronic
940930195 2:159419447-159419469 ACCCTTTCACTGCCTACCTCTGG - Intronic
944215881 2:197255210-197255232 CAGCATTCCCATCCTACCTCTGG - Intronic
945824102 2:214699190-214699212 CCACTTTTCCAGTCTACATCGGG + Intergenic
946186896 2:217986164-217986186 CCACCCTACCAGGCTACCTCTGG + Intronic
946286160 2:218704533-218704555 CCACTGCCCCAGCCTTACTCAGG + Intergenic
946606541 2:221411440-221411462 ACAATTTGCCAGCTTACCTCAGG - Intergenic
946797319 2:223369646-223369668 ACACTTCCCCAGCCTCCCCCTGG + Intergenic
946857651 2:223968670-223968692 CCACTTTCCTAGCCAGGCTCAGG - Intergenic
1168802421 20:652164-652186 CCACTTCCCCAGACAACCACAGG - Intronic
1169483366 20:6005892-6005914 CCCCTTTCCCCGCCCACCCCCGG + Intergenic
1171089957 20:22275690-22275712 CCACTTTCCCATCCCCGCTCAGG - Intergenic
1171465951 20:25328181-25328203 CCACTTTCCAGGCATTCCTCTGG - Intronic
1174098056 20:48105226-48105248 CCACTTACTCAGGCTACCTGGGG - Intergenic
1174731911 20:52926159-52926181 CCACTTTCTCGTCCTCCCTCTGG - Intergenic
1175920374 20:62447882-62447904 CCACCTTCGCACCCTCCCTCTGG - Intergenic
1175923546 20:62461274-62461296 CCACTTTGCCTGCCAACCTCCGG + Intergenic
1176264842 20:64203709-64203731 CCACCCTCCCCGACTACCTCTGG - Intronic
1176602650 21:8807223-8807245 CAACTTTCCCAGGCTACACCTGG + Intergenic
1178202817 21:30427049-30427071 CAACTCTCCCAGCCTCTCTCAGG + Intergenic
1178628919 21:34242569-34242591 TTCCTTTCCCAGCCAACCTCTGG - Intergenic
1179923510 21:44520346-44520368 CCACTTTCCCAGCCCTCACCAGG - Intronic
1180344935 22:11698780-11698802 CAACTTTCCCAGGCTACACCTGG + Intergenic
1181025302 22:20124303-20124325 CCACTTTCCCTGTCTACCAAGGG - Intronic
1181977092 22:26737828-26737850 CCTCTTCCCCAGCCTTCCCCAGG + Intergenic
1183383414 22:37501863-37501885 ACACTTTCCCAGCCTGACTCAGG + Intronic
1183390502 22:37543046-37543068 GCAGTTTCCCAACCTGCCTCAGG - Intergenic
1184770907 22:46595877-46595899 CCACCTTCCCAGCTTACCCAGGG + Intronic
953002490 3:38948563-38948585 CCACTTTCCCAGCTAGGCTCTGG + Intronic
953008938 3:39005446-39005468 CCTCTTTCCTTTCCTACCTCTGG + Intergenic
953517709 3:43612421-43612443 CCAGTTTCCCTGCCTTTCTCAGG + Intronic
953581859 3:44164778-44164800 CAACTATCCCAGCCTGCCTGCGG + Intergenic
954067859 3:48121212-48121234 CCATTTTCACAGATTACCTCAGG + Intergenic
954450124 3:50567264-50567286 CCACTTTCCAGGCCTGCCTCAGG + Intronic
954699929 3:52445794-52445816 CCCCTTGCCCTGCCTCCCTCAGG + Intergenic
957895175 3:86412361-86412383 GCACCTTCCAAGCCTAACTCTGG - Intergenic
958846345 3:99269540-99269562 CCACTCTCCCATCCCAGCTCTGG - Intergenic
960530317 3:118756831-118756853 CCACTTCCCCAGCCTGTATCAGG + Intergenic
960972182 3:123147799-123147821 CCACTTTTCCAGCCTTGCTCTGG + Intronic
961039627 3:123668498-123668520 CCCCTCCCCCACCCTACCTCTGG - Intronic
961443813 3:126968736-126968758 CCCCTGTCCCAGCCTGCTTCGGG - Intergenic
961890510 3:130126835-130126857 CGACTGTCCCAGCCAAACTCTGG + Intergenic
962342383 3:134596453-134596475 CCACATTCCCAGCCCTCCCCAGG + Intergenic
962389906 3:134962696-134962718 TAATTTTCCCAGCTTACCTCTGG + Intronic
965681611 3:171257639-171257661 CCACTTTCAAAGCCTAGCTGGGG + Intronic
967875685 3:194267093-194267115 CCTCTTTCCCTGCCTCACTCTGG + Intergenic
969593838 4:8137067-8137089 CCACTCTCCGTGCCTCCCTCTGG + Intronic
970609598 4:17712658-17712680 CCACTTGCTCAGCCTCCCCCAGG - Intronic
970815486 4:20151296-20151318 CCACTTGCCCAGGCTGCCTAAGG + Intergenic
971530727 4:27685261-27685283 CCACTATACCAGGCTGCCTCTGG - Intergenic
971538669 4:27786996-27787018 CCACTTGCTCAGCCAACCCCAGG + Intergenic
972762127 4:42117165-42117187 ACACTACCCCAGCCTACCTTGGG + Exonic
976833390 4:89341478-89341500 CCACTCTCCTTGCCTTCCTCAGG + Intergenic
978522578 4:109631969-109631991 CCCCTTTCACAGCCCACCTCTGG + Intronic
982733319 4:158979418-158979440 CCATCTTGCCAGCCTTCCTCAGG - Intronic
984703141 4:182831777-182831799 TTACTTTCCCACCCAACCTCTGG + Intergenic
986350812 5:6878047-6878069 TCACGTTCCCAGCCACCCTCAGG + Intergenic
1001433339 5:171680686-171680708 CCACCTTCCCAGCCAGCCACAGG - Intergenic
1001698992 5:173693116-173693138 CCTCTTTCCCTGCCAACCTCAGG + Intergenic
1002703261 5:181142303-181142325 CCTCTGTCCGAGCCTCCCTCTGG - Intergenic
1005199644 6:23329301-23329323 CCACTCTGCCAGCCTCCATCTGG + Intergenic
1006702359 6:35985787-35985809 CTCCTTTCCCAGCCCATCTCTGG - Intronic
1006930621 6:37685865-37685887 CCACTCTGCCAGCCTAGCTCAGG - Intronic
1008923867 6:56871172-56871194 CCATTTTCACAGACTACCTCAGG - Intronic
1010817373 6:80374566-80374588 CCATTTTCACAGATTACCTCCGG + Intergenic
1011110016 6:83827529-83827551 CCACCTGCCCAGCCTGCCTCAGG + Intergenic
1012390284 6:98730264-98730286 CCCCTTTCCCTGTCTCCCTCTGG + Intergenic
1015965347 6:138692309-138692331 CCACCTGCCCAGCCTCCCGCTGG + Intronic
1018131350 6:160734952-160734974 CCACCTTCCCAGGCAATCTCAGG - Intronic
1018759031 6:166874230-166874252 CCACCTTCTCTGCCCACCTCAGG - Intronic
1019095635 6:169577229-169577251 CCACTTTCCCAGGTTGCCCCTGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1021052441 7:16004856-16004878 CCACTTTCTCAGCTGAGCTCAGG - Intergenic
1022234490 7:28447771-28447793 CCACATTCCCAGCCCGTCTCAGG + Intronic
1022272859 7:28827084-28827106 CCATTTTCAAAGCCTCCCTCTGG - Intergenic
1025104258 7:56157904-56157926 CCCCTACCCCTGCCTACCTCAGG + Intergenic
1032727811 7:134607379-134607401 CTACTTTCCCATACTACTTCAGG + Intergenic
1033578069 7:142705013-142705035 CCCCTTCCCCACCCTGCCTCAGG + Intergenic
1033578214 7:142707049-142707071 CCTCTTCCCCACCCTGCCTCAGG + Intergenic
1035713347 8:1735305-1735327 CCAGTTTCCCATCTCACCTCTGG - Intergenic
1037317731 8:17614834-17614856 CAACTTTCCCAGGGTGCCTCAGG - Intronic
1037709402 8:21343680-21343702 CCTCCTTCCCATCCTACATCCGG + Intergenic
1037756761 8:21715253-21715275 CCTCTTCCCCAGCCCACCCCAGG - Intronic
1037973557 8:23192322-23192344 CCACTCTCCCTCCCTCCCTCGGG - Intronic
1038778645 8:30552457-30552479 CCACTTTCCCATCCTGTCGCTGG - Intronic
1042927883 8:73985150-73985172 CCACTTTGCTATCCTACCCCAGG + Intergenic
1045246741 8:100448650-100448672 CCACTTTTCCAGCCTAAGTTAGG + Intergenic
1047257713 8:123228216-123228238 CCACTGTACCAGCCTAGGTCAGG + Intronic
1047458465 8:125038654-125038676 ACACTTTCCCCGCCTGGCTCAGG - Intronic
1048408265 8:134144890-134144912 CCATTTTGCCAGCCTGTCTCTGG - Intergenic
1048999010 8:139813016-139813038 CCACTTCTCCACCCTTCCTCAGG + Intronic
1049736554 8:144210136-144210158 CCACTTTAAAAGCCTACCTATGG + Intronic
1051836241 9:21341305-21341327 CCACTTCCCCATCCCATCTCAGG - Intergenic
1052891550 9:33704825-33704847 CCCCTTCCCCACCCTGCCTCAGG + Intergenic
1056581280 9:87889357-87889379 CCACATTCCCAGGCTACCACGGG - Intergenic
1059186190 9:112273720-112273742 TCTTTTTCCCAGCCTTCCTCTGG - Intronic
1060294255 9:122332515-122332537 CCACTTTCCAAGTCCTCCTCAGG - Intergenic
1060526049 9:124321918-124321940 CCAGTGCCCCAGCCTACCACAGG + Intronic
1060547111 9:124468218-124468240 GCACTTTCCCAGGCTTCCCCGGG - Intronic
1061065679 9:128276202-128276224 CCGCTGTCCCCGCCCACCTCGGG + Exonic
1062238706 9:135524734-135524756 CCCCTTCCCCAGCCCAGCTCAGG + Intronic
1062501335 9:136853273-136853295 CCACTCTCCCAGGTTACCACGGG + Exonic
1062501630 9:136854356-136854378 CCAGTCTCCCAGCCTCACTCTGG - Intronic
1187833847 X:23410598-23410620 CCCCTTTCCCTGTCTTCCTCTGG + Intergenic
1188462600 X:30445823-30445845 CCATTTTCAAGGCCTACCTCAGG - Intergenic
1189089880 X:38070501-38070523 CTAATTTGCCTGCCTACCTCTGG + Intronic
1189090149 X:38073493-38073515 TCACTTTCCCAGATTAGCTCAGG - Intronic
1191606255 X:63065942-63065964 CCCCTTCCCCAACCAACCTCCGG - Intergenic
1192353349 X:70375983-70376005 CTGCTTTCCCAGCCTAGTTCTGG + Intronic
1194040862 X:88940797-88940819 CCCCTTCCCCATCCTGCCTCAGG - Intergenic
1194455052 X:94093509-94093531 TCTGTTTCCCAGCTTACCTCTGG + Intergenic
1197163236 X:123346931-123346953 CCAGTTTTCCAGCATACCACTGG - Intronic
1199943042 X:152642701-152642723 CCACTTTGCCTGCCTTCCTGAGG + Intronic
1200072361 X:153535524-153535546 CCTGTTTCCCACCCTTCCTCCGG + Intronic
1201942563 Y:19475552-19475574 CCAGGTTCTCAGCCTTCCTCTGG - Intergenic