ID: 914764311

View in Genome Browser
Species Human (GRCh38)
Location 1:150624511-150624533
Sequence CCAGAGGTAGGCTGGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 2, 1: 0, 2: 3, 3: 41, 4: 448}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914764300_914764311 26 Left 914764300 1:150624462-150624484 CCTCAGGCCTGCAGCTCCGCTGC 0: 1
1: 0
2: 6
3: 49
4: 411
Right 914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG 0: 2
1: 0
2: 3
3: 41
4: 448
914764302_914764311 10 Left 914764302 1:150624478-150624500 CCGCTGCCAGAGAAGCTTTTTAG 0: 1
1: 1
2: 0
3: 11
4: 155
Right 914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG 0: 2
1: 0
2: 3
3: 41
4: 448
914764303_914764311 4 Left 914764303 1:150624484-150624506 CCAGAGAAGCTTTTTAGCAGCTA 0: 2
1: 0
2: 0
3: 11
4: 128
Right 914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG 0: 2
1: 0
2: 3
3: 41
4: 448
914764301_914764311 19 Left 914764301 1:150624469-150624491 CCTGCAGCTCCGCTGCCAGAGAA 0: 1
1: 1
2: 0
3: 19
4: 201
Right 914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG 0: 2
1: 0
2: 3
3: 41
4: 448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914764311 Original CRISPR CCAGAGGTAGGCTGGGAAAG TGG Intronic
900092610 1:926946-926968 CCTGAGGTAGGATGGGGGAGGGG + Intronic
900181857 1:1314619-1314641 CCTGAGGTAGGAGGGAAAAGGGG + Intronic
900243842 1:1628894-1628916 CCCTAGGCAGCCTGGGAAAGGGG + Intronic
900611336 1:3545812-3545834 CCAGCGGGAGGCTGGGGGAGGGG - Intronic
901238901 1:7681610-7681632 CTAGAGGTAGGCAGGCAATGGGG + Intronic
901445842 1:9307642-9307664 TAAGAGGTTGGCTGGGAAATAGG + Intronic
902609413 1:17588354-17588376 CCCTGGGGAGGCTGGGAAAGGGG + Intronic
903152805 1:21424505-21424527 CCAGTCATAGGATGGGAAAGTGG - Intergenic
903160325 1:21483479-21483501 CCAGTCATAGGATGGGAAAGTGG + Exonic
903464796 1:23544687-23544709 CCAGAGGAAGGATGACAAAGTGG - Intergenic
904825135 1:33269371-33269393 CCAGAGGGAGGCTGGGAGCAAGG - Intronic
905435836 1:37954617-37954639 CCAGTGGGATGCTGGGACAGCGG - Intergenic
906258160 1:44366459-44366481 CCTGAGGTGGGCTGGCATAGAGG + Intergenic
906884750 1:49632207-49632229 CCAGAGGGAGTCTGGGAATATGG + Intronic
907014930 1:51003392-51003414 GCAGAGGTAGGTGGGAAAAGGGG + Intergenic
907046577 1:51303446-51303468 CTACAGGGAGGCTGGGGAAGGGG - Intronic
907275862 1:53316298-53316320 GTAGAGGCAGGCTGGGAATGGGG + Intronic
908115231 1:60934098-60934120 TCAGAAGTAGGCTGGGACAAAGG - Intronic
909003441 1:70246457-70246479 GGAGAGGTGGGTTGGGAAAGTGG + Intronic
909102566 1:71367712-71367734 CCAGAGGTTAGCGGGGAGAGAGG - Intergenic
909273341 1:73652688-73652710 GCTGAAGTAGGATGGGAAAGGGG - Intergenic
909358887 1:74739924-74739946 CCAGAGGGAGGAGGAGAAAGAGG + Intronic
910000925 1:82341383-82341405 CCAGAGATAAGCTAGAAAAGTGG + Intergenic
910299232 1:85686801-85686823 CCAGAGGTAGGATGGGGGAGAGG + Intronic
910644996 1:89504965-89504987 CCAGAAGTAGAATTGGAAAGGGG - Intergenic
910920896 1:92345454-92345476 ACAGAGGGAGGGAGGGAAAGAGG + Intronic
911163244 1:94702515-94702537 CCTGAGGAAGGCTGGGAACAAGG - Intergenic
912972147 1:114293672-114293694 CTGGAGGAAGGCTGGGAAACTGG - Intergenic
913179083 1:116302082-116302104 CCAGAGGTTGGCTGGGTTGGGGG + Intergenic
913277058 1:117148696-117148718 TCAGAGCTAAGCTGGGGAAGAGG - Intronic
914517721 1:148388384-148388406 ACAGTGGAAGGCTGGGAAATAGG - Intergenic
914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG + Intronic
914825674 1:151136774-151136796 CCATCAGTAGGCTGTGAAAGGGG + Intronic
915366604 1:155320420-155320442 GCAGAAGGAGGCTGAGAAAGTGG + Exonic
915513869 1:156401585-156401607 TGAGAGGGAGGCTGGGGAAGAGG - Intergenic
915596329 1:156898365-156898387 CCAGAGGCTGGGCGGGAAAGGGG - Intronic
915954374 1:160210222-160210244 CCAGCATTAGGCTGGGAATGTGG - Intronic
916412290 1:164558855-164558877 TCAGAGGTGGGCCGGGAAGGAGG - Intronic
917912794 1:179668605-179668627 CCATACACAGGCTGGGAAAGAGG - Intronic
918121690 1:181546217-181546239 CAAGAGGGAGGCTGGAAGAGAGG + Intronic
918375219 1:183902025-183902047 CCTGAGATAAGCTGAGAAAGAGG - Intronic
919918989 1:202157065-202157087 CAAGAGGAAGACAGGGAAAGGGG + Intronic
920215996 1:204361866-204361888 CCAGAGGGAGGCCGGGGAGGGGG + Intronic
920905085 1:210156654-210156676 AAAGAGGTAAACTGGGAAAGTGG + Intronic
921159611 1:212463730-212463752 CCAGAGCTGAGCTGGGGAAGGGG + Intergenic
921314229 1:213875371-213875393 CCAGAGGTAGCCCTGGAATGTGG + Intergenic
922241224 1:223756565-223756587 CCAGGGGTGTGCTGGGAAACTGG - Intronic
922617165 1:226967688-226967710 CCAGAGGGAGCCTGGGTTAGTGG + Intronic
922969941 1:229727762-229727784 CCAGACGGAGGAGGGGAAAGGGG + Intergenic
923048460 1:230372879-230372901 ACAGAGGAAGGCTGGGCCAGGGG - Intronic
923424237 1:233853057-233853079 CCAGAGGTCAGTGGGGAAAGAGG + Intergenic
923498113 1:234542367-234542389 CCAGAGGGAGAGTGGGACAGTGG - Intergenic
1062858908 10:794610-794632 CCAGAGGTGGGGTGGGGAGGAGG - Intergenic
1062922848 10:1293044-1293066 GCAGAGGGAGGGAGGGAAAGGGG + Intronic
1063891342 10:10631873-10631895 CAAGAGGTAGGCTGGGAACTTGG + Intergenic
1064504705 10:16015833-16015855 AGAGAGGGAGGATGGGAAAGAGG + Intergenic
1065317501 10:24478077-24478099 CCAGTGGGAGGCTGAGAAATCGG + Intronic
1067169735 10:43896928-43896950 CCAGAGGCAAGCTGATAAAGTGG + Intergenic
1067216151 10:44305600-44305622 CCAGAGGCAGGAAGGGGAAGAGG + Intergenic
1067703364 10:48589324-48589346 CCAGAAGCAGGCTGGGGAAGCGG - Intronic
1067759122 10:49029991-49030013 CCAGAGGTACACTGGGAACCTGG - Intronic
1069102090 10:64334801-64334823 GCAGTGGTCGGCAGGGAAAGGGG + Intergenic
1069264660 10:66443091-66443113 CCACAGGGAGGCTGGGGGAGGGG + Intronic
1069635000 10:69919696-69919718 CCCCAGGTTTGCTGGGAAAGAGG + Intronic
1070085919 10:73236999-73237021 ACAGAGGCAGGCTGGGCATGTGG - Intronic
1070685644 10:78478384-78478406 CCAGACTTAGGCTGGGAGACTGG + Intergenic
1071402684 10:85291283-85291305 TAGGAGGTGGGCTGGGAAAGGGG + Intergenic
1072867467 10:99079266-99079288 CCAGAGGGAAGCTGGGAACTAGG + Intronic
1072914713 10:99530816-99530838 CCGGAGGTGGGGTGGGGAAGTGG + Intergenic
1073489674 10:103844655-103844677 CCAGGCGCAGGCTGGGGAAGGGG + Intronic
1074447514 10:113532849-113532871 CCAGGGGTTGGCTGGCAGAGAGG - Intergenic
1074495633 10:113977928-113977950 CCAGAGAAAGGATGGGAAAGGGG - Intergenic
1075353182 10:121744780-121744802 CCACAGGAAGGCTGGGAAACAGG - Intronic
1075389983 10:122084925-122084947 CCAGGGGAAGGCTGGATAAGAGG + Exonic
1075449929 10:122544275-122544297 GCATAGGAAGGCTGTGAAAGAGG + Intergenic
1076103692 10:127803417-127803439 CCAGAGGTGGGCTGGGGTGGTGG + Intergenic
1076276515 10:129204177-129204199 CCAGAGGCAGGGTGGAAAGGAGG - Intergenic
1076285187 10:129288809-129288831 CCAGAGTCTGCCTGGGAAAGAGG + Intergenic
1077887496 11:6396323-6396345 CAAAATGTAGGCTGGCAAAGTGG - Intronic
1077888392 11:6402474-6402496 CCACAAGCAGGCTGGGGAAGGGG - Intronic
1078058912 11:8031261-8031283 CAAGAGGTAGGATTGGGAAGTGG + Intronic
1078970898 11:16409997-16410019 CCAGAGGTTGGGTGGGGATGGGG + Intronic
1079782481 11:24625170-24625192 CCAGGGGTGGGTTGGGGAAGGGG + Intronic
1080658763 11:34278887-34278909 CCATAAACAGGCTGGGAAAGTGG + Intronic
1080716016 11:34800619-34800641 CCAGAGGTAGACAGAGAAATAGG - Intergenic
1081811371 11:45915938-45915960 GCACAGTTAGGCTTGGAAAGGGG - Intronic
1081984808 11:47293821-47293843 CTAGGGGCAGGCTGGTAAAGGGG - Intronic
1083937157 11:65875662-65875684 CCAGAGGAAGGTGGGGAATGGGG + Intergenic
1084036640 11:66515412-66515434 GCAGAGGTAGGCTGGCAGGGAGG + Intronic
1084085127 11:66851473-66851495 CCAGTGGCAGGCTGTGGAAGAGG + Intronic
1084163544 11:67364407-67364429 CCACAGATACCCTGGGAAAGGGG + Exonic
1084664574 11:70569524-70569546 GCAGAGGTAAGATGGGGAAGCGG - Intronic
1085318048 11:75557844-75557866 AGAGAGGGAGGCTGGGAGAGGGG + Intergenic
1085733656 11:79020552-79020574 TCAGAGGTGGGATGGGAAGGAGG - Intronic
1088560259 11:111107766-111107788 CAAGAGTTAGGCTGATAAAGAGG - Intergenic
1089505536 11:118959533-118959555 CAAGAGGGAGCCTGGGAAATTGG - Intergenic
1089615241 11:119691394-119691416 CCTGAGGTGGGCGGGGAAAGTGG + Intronic
1089647467 11:119889679-119889701 CCAGAGGGAGGATGGGTATGGGG - Intergenic
1090356535 11:126144245-126144267 CCAAAGCTGGGCTGGGAAAGAGG + Intergenic
1090384540 11:126349042-126349064 CCAGAGCTAGGCTCTGAATGAGG + Intergenic
1091405669 12:207865-207887 CAAGAGTTAGGCTGGGAAGGAGG + Intronic
1091826966 12:3520077-3520099 CCAGAGCCAGGCTGGGCCAGGGG + Intronic
1092432895 12:8423033-8423055 GCAGCGGTAGACTGGGATAGAGG - Intergenic
1092954250 12:13534939-13534961 CCAGAGGGAGCCTGGGAGACTGG - Intergenic
1093349573 12:18081396-18081418 CGAGAGGTTGGCTGGGAAGAAGG - Exonic
1093491733 12:19712587-19712609 ACAGAGGTAAGCAGGGAAAATGG - Intronic
1095402477 12:41830819-41830841 CCAGAGGGAGGGAGGGAGAGAGG + Intergenic
1096572271 12:52530465-52530487 CCAGGAGAAGGCTGGGAAGGTGG - Intergenic
1096572922 12:52533998-52534020 CCAGGGGTAGGAAGAGAAAGGGG + Intergenic
1096779228 12:53982733-53982755 TGAGAGGTGGGCTTGGAAAGAGG + Intergenic
1096824368 12:54263445-54263467 CAAGAGGTAGGCCGGCACAGCGG + Intronic
1096843109 12:54391038-54391060 GCAGCGGCAGCCTGGGAAAGAGG + Intronic
1097287560 12:57889504-57889526 CCAGAGGGAAGCAGGGAAACAGG + Intergenic
1099222862 12:79935037-79935059 CCAGAGGAGGGCTGGGAACCCGG + Exonic
1100161292 12:91864164-91864186 CCAGAGTGAGGCTGGGACGGTGG - Intergenic
1101334754 12:103786468-103786490 TCAGAGGTGGGCTGGGGAAGGGG + Intronic
1101377030 12:104180037-104180059 CCAGAGATAGGCTTTGACAGAGG - Intergenic
1101399209 12:104373402-104373424 AAAGAGGTAGGCTGGGGAACGGG - Intergenic
1101399268 12:104373719-104373741 CAAGAGGTAGGCTGGGGATGAGG - Intergenic
1101708153 12:107240139-107240161 CCAGAGGTCTGCTGTGAAGGTGG + Intergenic
1101974446 12:109343783-109343805 CAAGAGGGAGTCTGGGAAACAGG + Intergenic
1102219753 12:111186488-111186510 CCTGAGGTCGGGTGGGGAAGAGG + Intronic
1102246492 12:111359754-111359776 ACAGATGGAGGCTGGGGAAGTGG - Intergenic
1102436126 12:112925355-112925377 CCTGCGGTTGGCTGGGAGAGGGG - Intronic
1102887095 12:116530440-116530462 CCAGTGGGAGGATGGGAAGGAGG + Intergenic
1103043634 12:117717111-117717133 CCCAAGGTGGGCTGGGAGAGTGG - Intronic
1103703408 12:122859355-122859377 CCACGGGCAGCCTGGGAAAGAGG - Intronic
1104830815 12:131750035-131750057 CAAGGGGTGGGCTGGGCAAGCGG + Intronic
1105474260 13:20717542-20717564 CCAGCGGGGGCCTGGGAAAGAGG - Intronic
1108688635 13:52843459-52843481 CCAGAGGAAGGCAAGGAAAGAGG + Exonic
1109825189 13:67709925-67709947 TCAGAGATAGGCAGGGAAATGGG - Intergenic
1112147557 13:96718051-96718073 GCTGTGGAAGGCTGGGAAAGAGG - Intronic
1112264769 13:97913227-97913249 CCAGTGGGAGGATGGGAAAGAGG + Intergenic
1113517464 13:110914662-110914684 CCAGTGGGAGTCGGGGAAAGCGG - Intronic
1113536968 13:111075964-111075986 GGAGAGGTAGGCTGGGCAGGTGG + Intergenic
1113670278 13:112171275-112171297 CCAGAGCCAGGGTGGGAAAAAGG + Intergenic
1116229948 14:42203331-42203353 GCAGAGGTAGGTTGTAAAAGTGG - Intergenic
1116744534 14:48799977-48799999 CCAGAGGTTGGGGGGGTAAGGGG - Intergenic
1117784523 14:59268778-59268800 ACAGAGGAAGACTGGGAGAGGGG - Intronic
1118002670 14:61538087-61538109 CCAGGAGAAGGCTGGGGAAGAGG + Intronic
1118206423 14:63727809-63727831 CCGGAGGGAGGATGAGAAAGCGG - Exonic
1118810163 14:69267302-69267324 CCAGAGGTACTTTGGGAAAGAGG + Intronic
1119129920 14:72162524-72162546 CCTGAGGTAGGATGGGAGTGGGG + Intronic
1119132754 14:72190064-72190086 ACACAGGTTGGCTGGCAAAGAGG - Intronic
1119348396 14:73944632-73944654 CCAGAGGCAGGGTGAGGAAGAGG - Exonic
1119589623 14:75873434-75873456 TCAGAGGCTGGATGGGAAAGAGG - Intronic
1119620816 14:76130805-76130827 CCAGAAGGTGGGTGGGAAAGGGG - Intergenic
1119756454 14:77123581-77123603 CCAGAGGTAGGCAGGGAGCTGGG - Intronic
1120138869 14:80904324-80904346 CCAGAGGGTGGCGGGGAGAGGGG + Intronic
1120299752 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG + Intergenic
1120785109 14:88526801-88526823 CCAGGGGAAGGATGGGAATGGGG - Intronic
1120942633 14:89963417-89963439 GCAGAAGCAGGCTGAGAAAGTGG + Exonic
1121818337 14:96945089-96945111 GCAGTGGTGGGCTGGGCAAGGGG - Intergenic
1123510035 15:20989257-20989279 TCAGATATAGGTTGGGAAAGTGG + Intergenic
1123567251 15:21563006-21563028 TCAGATATAGGTTGGGAAAGTGG + Intergenic
1123603514 15:22000299-22000321 TCAGATATAGGTTGGGAAAGTGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1124926644 15:34076428-34076450 CCAGAGGTAGGCAGAGAACAAGG + Intergenic
1126098158 15:45103872-45103894 TCAGAGGAGGGCTGGCAAAGAGG - Intronic
1127270058 15:57392331-57392353 CTAGAGGGAGGTTGGGGAAGGGG + Intronic
1127958323 15:63872060-63872082 CCACAGCTAGGCTGGGATGGAGG - Intergenic
1128214451 15:65924515-65924537 CTAGAGGGAGCTTGGGAAAGTGG + Intronic
1128328756 15:66742223-66742245 TGAGAAGTAGGCTGAGAAAGGGG - Intronic
1128482731 15:68054210-68054232 CTAGAGGCGGGCTGGGAAGGTGG + Exonic
1128532609 15:68464904-68464926 CCAGAGGGAGGCTGGGGGAAGGG - Intergenic
1128865386 15:71111164-71111186 CCAGATGTGGGGTGAGAAAGAGG + Exonic
1129265135 15:74389322-74389344 CCAGAGTGAGGCAGGGAAGGAGG - Intergenic
1129644564 15:77419192-77419214 CCAGAGGCAGGCGGGGGAGGAGG + Intronic
1129655482 15:77521863-77521885 ACAGAGGTAGGGTGGGAATGGGG + Intergenic
1129814769 15:78541658-78541680 CCGGGGGTAGGGTGGGAAAAGGG - Intronic
1130033172 15:80333980-80334002 CCAGAGGAATGCTGGGGAGGAGG + Intergenic
1130386597 15:83417407-83417429 CCAGAGAAAGGCTGGGGAACAGG - Intergenic
1130749080 15:86690549-86690571 GCAGAGGTAGGTTTGAAAAGTGG + Intronic
1131157570 15:90084567-90084589 CCTGAGAGAAGCTGGGAAAGGGG + Intronic
1131662971 15:94538504-94538526 TCAGAGGTAGGCTGGGTGTGGGG + Intergenic
1131800433 15:96063808-96063830 CTAGAGGAAGGCTGAGAGAGTGG - Intergenic
1202975616 15_KI270727v1_random:290100-290122 TCAGATATAGGTTGGGAAAGTGG + Intergenic
1132925205 16:2425726-2425748 CGAGAGGGAGGCAGGGAAGGAGG - Intergenic
1132997451 16:2830560-2830582 CCAGAGTTAGTCTGGGACAAGGG - Intronic
1133677944 16:8093160-8093182 CCAGAGATTGGCTGGGAAGGTGG - Intergenic
1134614788 16:15642914-15642936 CCAGCAATAGGCGGGGAAAGAGG + Intronic
1134756823 16:16674565-16674587 CCTGACGTTGGCAGGGAAAGTGG + Intergenic
1134989245 16:18684598-18684620 CCTGACGTTGGCAGGGAAAGTGG - Intergenic
1135166424 16:20143046-20143068 CCAGAGGGAGTGGGGGAAAGTGG + Intergenic
1135336800 16:21608501-21608523 CCATAGTTAGGCTGGGATAGTGG + Intronic
1136536543 16:30902962-30902984 GCAAAGAGAGGCTGGGAAAGTGG - Exonic
1136555651 16:31006359-31006381 GCAGAGGGAGGATGAGAAAGGGG - Intronic
1138237638 16:55398524-55398546 GCAGAGATAGGAAGGGAAAGAGG + Intronic
1138830244 16:60366708-60366730 ACAGAGTTGGGGTGGGAAAGAGG - Intergenic
1139632011 16:68236633-68236655 CCAGAAGTCACCTGGGAAAGGGG + Intronic
1139641675 16:68296249-68296271 CCAGAGGTAATCTGGTGAAGTGG + Intronic
1140410220 16:74736695-74736717 CCTGAGGAAGGATGGGGAAGAGG + Intronic
1140591346 16:76356427-76356449 TAAGAGGGAGACTGGGAAAGAGG + Intronic
1141018000 16:80468243-80468265 CTTGAGGTAGGTTGGAAAAGAGG - Intergenic
1141432216 16:83976121-83976143 CCAGAGGGAGGCTGGGATTGGGG + Intronic
1141691877 16:85601243-85601265 CCAGAGGCAGGCTGAGGGAGAGG + Intergenic
1141919683 16:87127571-87127593 CCAGAGGTGGGCTTGGCAGGGGG + Intronic
1142314676 16:89336157-89336179 CCAGAGGTATCCTGGACAAGTGG - Intronic
1142992287 17:3739437-3739459 CAAGAGGTGGGCCGGGAAAGAGG + Intronic
1143208954 17:5168973-5168995 GCAGAGTTCGGCTGGAAAAGAGG + Exonic
1143381369 17:6498337-6498359 CCAGAGCTAGCCTGGGGAAACGG + Intronic
1143536485 17:7543383-7543405 ACAGAGGGAGGCAGGGAAGGAGG + Intergenic
1143588239 17:7862885-7862907 CCAAAGTTAGGATGGGAAGGTGG + Intronic
1144364210 17:14526367-14526389 CCAAAGGCAGTTTGGGAAAGGGG - Intergenic
1144894261 17:18517245-18517267 GCAGAGTTTGGCTGGGGAAGAGG - Intergenic
1145055585 17:19701835-19701857 CCAGAGGAAGGCTGGCATGGTGG - Intronic
1145137970 17:20426997-20427019 GCAGAGTTTGGCTGGGGAAGAGG + Intergenic
1145737719 17:27244718-27244740 CAAAAGGGAGGCTGAGAAAGGGG + Intergenic
1146306169 17:31731314-31731336 CCAGAGGCAGCCTGGGAAAGTGG - Intergenic
1146525437 17:33563485-33563507 CCAGTGGTGGGCTGGGGATGGGG - Intronic
1146645100 17:34571967-34571989 CCAGAGGGAGGAAGAGAAAGGGG + Intergenic
1146805851 17:35864636-35864658 ACAGAGGTAGGGTAGGAAAAGGG - Intronic
1147235158 17:39051594-39051616 AGAGAGGTAGGCTGTGAAAGGGG + Intergenic
1147358783 17:39918336-39918358 CCAAAGGTAGGATGGGGAAGTGG - Intronic
1148204936 17:45774283-45774305 CCGGAGCAAGGCTGGGAAGGAGG + Intergenic
1148849731 17:50548745-50548767 TCAGAGGGAGGCTGGCCAAGTGG - Intronic
1149459218 17:56813394-56813416 TCAGAGGTGGGCAGGGGAAGAGG - Intronic
1149871176 17:60183225-60183247 GCAGAGTTCGGCTGGGGAAGAGG - Exonic
1150216735 17:63475596-63475618 CAGGAGGGAGGCTGGCAAAGCGG + Intergenic
1150721355 17:67616778-67616800 GCAGAGGCTGCCTGGGAAAGTGG - Intronic
1150785693 17:68161393-68161415 AGAGAGGTAGGCTGTGAAAGGGG - Intergenic
1151781718 17:76251099-76251121 CCAGGGGTATGCTGGTAAACTGG - Intergenic
1151815875 17:76471163-76471185 GCAGAGGTAGGAGGAGAAAGAGG + Exonic
1152136929 17:78509892-78509914 CCAGAAGTAGGCTGGCGCAGTGG + Intronic
1152244893 17:79180217-79180239 CCCTAGGTAGGCTGGGGATGGGG - Intronic
1152415728 17:80160509-80160531 CCAAAGGTAGCTTGGGGAAGTGG + Intergenic
1152962487 18:88123-88145 CCAGAGGTTGGCTGGAGATGAGG + Intergenic
1153581881 18:6582136-6582158 CCAAATGTAACCTGGGAAAGGGG + Intronic
1153939383 18:9964711-9964733 CCAGCTGAGGGCTGGGAAAGAGG + Intergenic
1155164116 18:23218861-23218883 CCTGATGGAGGCTGGGGAAGGGG + Intronic
1155235082 18:23810971-23810993 CCAGAGGAGGGCAGGGAGAGAGG - Intronic
1155937812 18:31772373-31772395 CCGGGGGAAGGCTGGGAAGGGGG + Intergenic
1157412616 18:47476389-47476411 CCAGAGGGCAGCTGGAAAAGAGG - Intergenic
1157438600 18:47692374-47692396 CCCCAGGTTGGCTGGGAAAGGGG - Intergenic
1157604772 18:48919195-48919217 CCAGAGCTAGGCTGGGGAAGGGG + Intergenic
1157763647 18:50282235-50282257 CCCGTGGGAGGCTGGGAATGTGG + Intergenic
1157968140 18:52232935-52232957 CCAAAAGAAGGCAGGGAAAGAGG + Intergenic
1158598659 18:58838468-58838490 CCAAAGGCTGTCTGGGAAAGGGG - Intergenic
1158881415 18:61782928-61782950 CCCCAGGTAGGCTGGGAAGGAGG - Intergenic
1158953637 18:62520686-62520708 CAACAGGTAGGCTGGCTAAGAGG + Intergenic
1159787339 18:72730092-72730114 GCAGGAGTAAGCTGGGAAAGAGG - Intergenic
1161524924 19:4748318-4748340 CCGGGAGTAGGCTGGGAATGTGG - Intergenic
1161807337 19:6452271-6452293 CCAGAGGGGAGCAGGGAAAGAGG + Intronic
1162102259 19:8346496-8346518 CCTGAGGTAATCTGGGAAAATGG + Intronic
1162514282 19:11138785-11138807 CCAGAGGGAGGTGGGGAGAGGGG + Intronic
1163106052 19:15123619-15123641 GCAGAGGGCAGCTGGGAAAGGGG + Intronic
1163228183 19:15979645-15979667 TCAGAGGTGGGCTGGGTCAGTGG - Intergenic
1163544633 19:17933656-17933678 CAGGAGGTAGGCTGGAAAAGGGG - Intronic
1164312911 19:24061767-24061789 TCACAGGTAGGCTTAGAAAGAGG + Intronic
1165717923 19:38058510-38058532 CCAGAGGGAGTCAGGGAGAGCGG - Intronic
1166299455 19:41905834-41905856 CCAGAGGGATGCTGGGTGAGGGG + Intronic
1166344021 19:42154153-42154175 CCAGAGGTAGGATGTGAGTGTGG + Intronic
1166978926 19:46621455-46621477 CCTGAGGCGAGCTGGGAAAGGGG + Exonic
1167568391 19:50271555-50271577 CCTGAGGGCAGCTGGGAAAGTGG + Intronic
1167722899 19:51190978-51191000 GCCGAGGTGGCCTGGGAAAGGGG - Intergenic
1168411203 19:56141415-56141437 CCAGAGGTTGGATGGGAAGAGGG + Intronic
925076348 2:1019456-1019478 CCATAGGTGTGCTGGGAATGTGG + Intronic
927478906 2:23434922-23434944 CCAGAGGGAGGCTCTGGAAGTGG + Intronic
927787430 2:25983062-25983084 CCAGAAGTAGACCGGGACAGGGG - Intergenic
928178830 2:29053357-29053379 ACAGAGGCAAGATGGGAAAGTGG - Exonic
928551722 2:32378367-32378389 TGAGAGGGAGACTGGGAAAGAGG + Intronic
928792999 2:34981131-34981153 CCAGAGGTAGGCTGGCTAGAGGG + Intergenic
929219153 2:39445473-39445495 CCAAAGAGAGACTGGGAAAGAGG + Intergenic
929981404 2:46683640-46683662 GCAGAGGTATGGTGGGAAGGGGG + Intergenic
930495469 2:52136310-52136332 TCAGAGGCATGCTGAGAAAGCGG + Intergenic
931169394 2:59786900-59786922 ACAAAGGAAGGCAGGGAAAGAGG - Intergenic
931247860 2:60506105-60506127 TCAAAGGATGGCTGGGAAAGGGG - Intronic
931704897 2:64939158-64939180 CCAGAGGTTGGCTTGGAGGGAGG + Intergenic
933203678 2:79480090-79480112 GCAGAGGTCACCTGGGAAAGAGG + Intronic
934539007 2:95159446-95159468 CCGGAGCTAGGCAGGGACAGCGG - Exonic
934568270 2:95352578-95352600 CGAGAGGTAGGGAGGGAGAGAGG - Intronic
934683826 2:96305884-96305906 CATGAGGTAGGCAGGAAAAGAGG + Intergenic
935942345 2:108254024-108254046 CTAGAGGCAGGCTGACAAAGTGG - Intronic
936083525 2:109451393-109451415 CCAGGGGCAGACTTGGAAAGTGG + Intronic
936173467 2:110197418-110197440 AAAGAGGAAGGGTGGGAAAGGGG - Intronic
936341618 2:111638733-111638755 CCAGGGGCAGGCAGGGAGAGGGG - Intergenic
936784527 2:116078080-116078102 CACTAGGTTGGCTGGGAAAGAGG - Intergenic
937147992 2:119663790-119663812 CCAGGGGCTGGCTGGGAACGGGG - Intergenic
937925007 2:127161317-127161339 GCAGAGAGAGGCTGGGAAATTGG + Intergenic
940375387 2:152952226-152952248 CAAGAGGTAGGCTGGCATGGTGG - Intergenic
941863895 2:170313711-170313733 CAAGAGGTGGGCGTGGAAAGAGG - Intronic
942118472 2:172752151-172752173 CCATGGGTAGGATGGGAATGAGG - Intronic
942519973 2:176793285-176793307 CCAGAGTGAGGCAGGGAAAAGGG - Intergenic
942601011 2:177641041-177641063 GCAGAGGAAGGCTGGGAGACTGG - Intronic
943762674 2:191626993-191627015 AAAGAGGTAGGATGGGAAGGGGG - Intergenic
944838200 2:203600488-203600510 CCAGGGCTAAGCTGGGGAAGGGG - Intergenic
945824101 2:214699190-214699212 CCCGATGTAGACTGGAAAAGTGG - Intergenic
946143025 2:217707406-217707428 TCAGAGGGAGCCAGGGAAAGTGG + Intronic
946186895 2:217986164-217986186 CCAGAGGTAGCCTGGTAGGGTGG - Intronic
946347043 2:219119044-219119066 GCAGAGGAAGACAGGGAAAGTGG - Intronic
947584781 2:231347824-231347846 CCAAAGGCAGGCAGGGAGAGAGG - Intronic
948039397 2:234887502-234887524 CCAGGGCTAGGCAGGGAGAGGGG + Intergenic
948400053 2:237677737-237677759 CCACAGGTAGGCTGTGCTAGAGG - Intronic
1168751905 20:288558-288580 ACATAGGTAGGCTGGGGGAGGGG - Intronic
1168862422 20:1055330-1055352 GCAGAGCAAGGCTGGGGAAGGGG - Intergenic
1168978848 20:1988215-1988237 CCAGACTGAGGCTGAGAAAGGGG + Intronic
1168994694 20:2124434-2124456 CCAAAGGGAGGATGGGAAAAGGG + Intronic
1169483365 20:6005892-6005914 CCGGGGGTGGGCGGGGAAAGGGG - Intergenic
1169555434 20:6744328-6744350 CTAGAGGTTGGCTGGGCTAGAGG - Intergenic
1170053695 20:12175388-12175410 CAGGAAGTAGGCTGTGAAAGTGG - Intergenic
1170158870 20:13292838-13292860 GCAGAGGGAGGGAGGGAAAGAGG + Intronic
1170803027 20:19606083-19606105 GGAGAGGAAGGCTGGGAAACTGG - Intronic
1171246218 20:23611767-23611789 CCAGGGGTAGGCAGGCAAAAAGG + Intergenic
1171465952 20:25328181-25328203 CCAGAGGAATGCCTGGAAAGTGG + Intronic
1172093559 20:32449775-32449797 CCAGAGGGATGCGGGGGAAGAGG + Intronic
1172929997 20:38579739-38579761 CAAGAGGAAGTCTGGGAAAATGG - Intergenic
1174045480 20:47729805-47729827 CCAGAGAGTGGCAGGGAAAGAGG + Intronic
1174152346 20:48494237-48494259 TCCCAGGTAGGCTGGGGAAGAGG - Intergenic
1174221543 20:48959522-48959544 ACAGAGGGAGGGAGGGAAAGAGG - Intronic
1174731912 20:52926159-52926181 CCAGAGGGAGGACGAGAAAGTGG + Intergenic
1175032547 20:55970212-55970234 CCAGAGGGAGGGAGGGAGAGAGG - Intergenic
1175492956 20:59391147-59391169 GCAGAGCTGGGCTGGGAATGAGG + Intergenic
1175809874 20:61852245-61852267 CCAGAGCTGGGCTGGGAATTGGG - Intronic
1175920375 20:62447882-62447904 CCAGAGGGAGGGTGCGAAGGTGG + Intergenic
1175923545 20:62461274-62461296 CCGGAGGTTGGCAGGCAAAGTGG - Intergenic
1175950146 20:62579085-62579107 ACAGAGGGAGGCAGGGACAGAGG - Intergenic
1176100536 20:63362411-63362433 CCAGAGGTGGGCAGGGAGGGGGG - Intronic
1176264843 20:64203709-64203731 CCAGAGGTAGTCGGGGAGGGTGG + Intronic
1178012927 21:28307294-28307316 GCTGATGTAGGCTGGGAAATTGG + Intergenic
1178258858 21:31080182-31080204 AGAGAGGTGGGCTGGGAAAAAGG + Intergenic
1179356495 21:40665189-40665211 ACAGAGGCAGGCTGGGCATGGGG + Intronic
1179423712 21:41255847-41255869 CCAGAGCTAGGCTGGAAAGCAGG - Intronic
1180070961 21:45435611-45435633 TCAGAGGTTGGCTGGGGCAGAGG + Intronic
1180678724 22:17607962-17607984 ACAGAGGTAGTCTGGCAGAGTGG - Intronic
1181492572 22:23269678-23269700 CCAGAGGGAGGCTGGCAGTGGGG - Intronic
1181939711 22:26465640-26465662 CCACACGTGGGCTCGGAAAGGGG + Intronic
1181977091 22:26737828-26737850 CCTGGGGAAGGCTGGGGAAGAGG - Intergenic
1182481467 22:30611901-30611923 CAAGAGGGAGTCTGAGAAAGAGG - Intronic
1182760867 22:32721354-32721376 CAAGATGGAGGCAGGGAAAGGGG - Intronic
1183741522 22:39671022-39671044 CCAGGGATAGGGTGGGGAAGGGG + Intronic
1184098191 22:42327965-42327987 CCAGAGCTATGATGGGAAGGAGG - Intronic
1184258785 22:43302635-43302657 ACAGAGCCAGGCTGGGAACGGGG + Intronic
1184336008 22:43853639-43853661 GCAGAGCTAGGCTGGGAATCTGG - Intronic
1184770560 22:46594483-46594505 CCAGAGGAGGGCTGGGGTAGGGG + Intronic
949826541 3:8171380-8171402 TCAGAAGTAGGCTGCGAAGGAGG - Intergenic
950477551 3:13223520-13223542 TCAGAGGGAAGCTGGGAATGGGG + Intergenic
951456512 3:22898247-22898269 CCAGAGACAGGCTAGGCAAGAGG + Intergenic
952955859 3:38556744-38556766 CCAGAGGTGGGTAGGGATAGAGG + Intronic
953002489 3:38948563-38948585 CCAGAGCCTAGCTGGGAAAGTGG - Intronic
953008937 3:39005446-39005468 CCAGAGGTAGGAAAGGAAAGAGG - Intergenic
953130419 3:40132723-40132745 CTAGAGGAAAGCTGGTAAAGGGG - Intronic
954450123 3:50567264-50567286 CCTGAGGCAGGCCTGGAAAGTGG - Intronic
954699928 3:52445794-52445816 CCTGAGGGAGGCAGGGCAAGGGG - Intergenic
955169772 3:56551895-56551917 AAAGAGGTAGGTTGGGGAAGGGG - Intergenic
955337589 3:58099647-58099669 CCAGAGGTAGGATTCGGAAGAGG - Intronic
956232543 3:67033230-67033252 ACAGAGCTAGGCTGTGAAAGAGG + Intergenic
958846346 3:99269540-99269562 CCAGAGCTGGGATGGGAGAGTGG + Intergenic
960139719 3:114140284-114140306 TCAGAGGTGGGATGGGAAAAAGG + Intronic
960721563 3:120629037-120629059 CAAGAGATGGGCTGGGAAAAGGG + Intronic
960972181 3:123147799-123147821 CCAGAGCAAGGCTGGAAAAGTGG - Intronic
961039628 3:123668498-123668520 CCAGAGGTAGGGTGGGGGAGGGG + Intronic
961345330 3:126260264-126260286 CTAGAGGGAGGATGGGGAAGAGG - Intergenic
961372624 3:126440798-126440820 GCAGAGGTGGGCTGGGAAGGGGG - Intronic
961433265 3:126898188-126898210 CCAAAGTCAGGCTGGGAACGAGG + Intronic
961443814 3:126968736-126968758 CCCGAAGCAGGCTGGGACAGGGG + Intergenic
962163484 3:133024103-133024125 CAGGAGGTAGGCTGGTATAGTGG - Intergenic
962492050 3:135903880-135903902 AAAGAGGGAGGCTGGGAAAAAGG - Intergenic
964011914 3:151901790-151901812 CCAGAGCTTGGCTGGGAGTGAGG + Intergenic
966525214 3:180912592-180912614 CGAGAAGGAGGCGGGGAAAGGGG - Exonic
967875684 3:194267093-194267115 CCAGAGTGAGGCAGGGAAAGAGG - Intergenic
968746404 4:2362779-2362801 CCAGAGGAGGGCAGAGAAAGGGG - Intronic
969197313 4:5573262-5573284 CTTGAGATAGGGTGGGAAAGTGG + Intronic
969447444 4:7253340-7253362 CCAGAGGCAGGCAGGGACACAGG - Intronic
969593837 4:8137067-8137089 CCAGAGGGAGGCACGGAGAGTGG - Intronic
970479673 4:16460344-16460366 CCACAGGCAGGCTGGGGTAGGGG - Intergenic
971530728 4:27685261-27685283 CCAGAGGCAGCCTGGTATAGTGG + Intergenic
971571163 4:28212833-28212855 CCAGAGAAAAGCAGGGAAAGAGG - Intergenic
973899271 4:55451072-55451094 GCAGTGGTAGGAAGGGAAAGTGG - Intronic
974192961 4:58532319-58532341 GCAGAGGTAGGGTGTGGAAGAGG - Intergenic
975917367 4:79340970-79340992 GCAGTGGTAGGCTGGGCAGGTGG - Intergenic
978522577 4:109631969-109631991 CCAGAGGTGGGCTGTGAAAGGGG - Intronic
979168812 4:117573043-117573065 GCAGAGGGAGACAGGGAAAGAGG + Intergenic
980992796 4:139752523-139752545 AAAGAGGATGGCTGGGAAAGTGG + Intronic
981653434 4:147085087-147085109 CCAGAAGTATGCTTGGAAATCGG - Intergenic
982474986 4:155839405-155839427 CCAGAAGTAGGATGGGGAGGGGG + Intronic
985814244 5:2114836-2114858 GCAGAGGGAGGCAGGGCAAGAGG - Intergenic
985827027 5:2200149-2200171 ACAGAGGTGGGCTGGGGAGGAGG + Intergenic
986165489 5:5268775-5268797 ACAGAGGTGGGCAGAGAAAGAGG - Intronic
989111135 5:37907531-37907553 TCAGAGCGTGGCTGGGAAAGAGG + Intergenic
989650005 5:43677332-43677354 ACAAAGTTAGGCTGGGACAGGGG + Intronic
990129508 5:52564047-52564069 CCAGAGGCAGGCTAGGGATGCGG + Intergenic
991404639 5:66289807-66289829 AGAGAGGTAGGCTTGGGAAGAGG - Intergenic
993455170 5:88119808-88119830 TGAGAGGTAGTCTGGGAAACTGG - Intergenic
995968960 5:117943687-117943709 CCAGAGGAAGCGTGGGAACGGGG - Intergenic
997060600 5:130497333-130497355 GAATAGGTAGGATGGGAAAGTGG + Intergenic
997228440 5:132226957-132226979 TCAGAGGAAGGCTGGCAAAAGGG - Exonic
997240591 5:132303832-132303854 AGAGAGGTAGGCAGGGAAAGCGG - Intronic
997424994 5:133797004-133797026 CAAGAGGAAGGGTGGTAAAGGGG - Intergenic
997504718 5:134408157-134408179 GCAGAGGTAGGCAGGGAATGAGG - Intronic
997839592 5:137226991-137227013 ACAGAGGAAGGCTTTGAAAGAGG - Intronic
998399085 5:141838635-141838657 CCAGAAGCAGGGTGGGAGAGAGG + Intergenic
999768466 5:154757141-154757163 GCAGAGGAATGCTGGGAAGGGGG - Intronic
999944699 5:156582253-156582275 TCAGAGATAGGCTGGAAAGGTGG - Intronic
1000193388 5:158935378-158935400 CCAGAGGCTTGCTGGGCAAGCGG - Intronic
1000452607 5:161408671-161408693 CCAGAGGGAGGGAGGAAAAGAGG + Intronic
1001698991 5:173693116-173693138 CCTGAGGTTGGCAGGGAAAGAGG - Intergenic
1001796700 5:174508230-174508252 GCAAAGGTATGCTGTGAAAGGGG + Intergenic
1001908991 5:175498804-175498826 CCAAAAGAAGGCAGGGAAAGAGG + Intronic
1002703262 5:181142303-181142325 CCAGAGGGAGGCTCGGACAGAGG + Intergenic
1003320757 6:5049060-5049082 GCAGAGGAAGATTGGGAAAGGGG + Intergenic
1004504869 6:16239342-16239364 CCAGGGCTAGGCTGGGACCGCGG - Intronic
1005199643 6:23329301-23329323 CCAGATGGAGGCTGGCAGAGTGG - Intergenic
1006907340 6:37541734-37541756 CCATAGGTAGGCTGTGAGAAGGG + Intergenic
1006930622 6:37685865-37685887 CCTGAGCTAGGCTGGCAGAGTGG + Intronic
1007647715 6:43395771-43395793 CCAGAGCCAGGCTGGGCCAGGGG + Intergenic
1007759687 6:44126942-44126964 CCAGACCTAAGTTGGGAAAGGGG + Exonic
1008429119 6:51394054-51394076 TCAGTGGTAGGCTGTTAAAGTGG + Intergenic
1008664787 6:53705488-53705510 CAGGAGGGAGGCTTGGAAAGTGG + Intergenic
1008923868 6:56871172-56871194 CCTGAGGTAGTCTGTGAAAATGG + Intronic
1008966019 6:57313621-57313643 CGAGAGGTAGGCAGTGAAATGGG + Intergenic
1010112647 6:72258276-72258298 ACAGAGGTAGGCTTTGAAATGGG + Exonic
1010283522 6:74048093-74048115 ACATTGGAAGGCTGGGAAAGTGG + Intergenic
1010492842 6:76495107-76495129 GCAGAGGAAGGTTGGGGAAGAGG + Intergenic
1010615471 6:78006642-78006664 ACAGAAGTAGGCTTAGAAAGTGG + Intergenic
1011110015 6:83827529-83827551 CCTGAGGCAGGCTGGGCAGGTGG - Intergenic
1011520304 6:88197134-88197156 ACAGAGGGAGGCTGAGCAAGTGG + Intergenic
1012390283 6:98730264-98730286 CCAGAGGGAGACAGGGAAAGGGG - Intergenic
1013633552 6:112008039-112008061 CAGGAGGTAGCCTGAGAAAGAGG - Intergenic
1015838078 6:137444114-137444136 GCAGTGGTGGGCTGGGAAAATGG + Intergenic
1015965346 6:138692309-138692331 CCAGCGGGAGGCTGGGCAGGTGG - Intronic
1019095636 6:169577229-169577251 CCAGGGGCAACCTGGGAAAGTGG + Intronic
1019265482 7:114907-114929 CCAGAAGAAGGCTGGCTAAGAGG + Intergenic
1022198949 7:28097124-28097146 GCAGAGGTTGGGTGGGAAAGTGG - Intronic
1022272860 7:28827084-28827106 CCAGAGGGAGGCTTTGAAAATGG + Intergenic
1022962902 7:35446901-35446923 CCAGAGCTAGGGTGAGAATGAGG - Intergenic
1023966955 7:44967751-44967773 CCAGAGGATGGCTGGGAATTCGG - Intronic
1025104257 7:56157904-56157926 CCTGAGGTAGGCAGGGGTAGGGG - Intergenic
1026073776 7:67147064-67147086 CTAGAGGGAGACTGGGAAATAGG + Intronic
1026703104 7:72665104-72665126 CTAGAGGGAGACTGGGAAATAGG - Intronic
1026987982 7:74566888-74566910 CCAGAGGGGTGGTGGGAAAGAGG - Intronic
1028064052 7:86359720-86359742 CCAGAGGTTGGCGGGGCAGGGGG + Intergenic
1028925979 7:96357521-96357543 CCAGACATAGGTTGGGACAGGGG - Intergenic
1029204437 7:98860457-98860479 TCAGAGCTAGGCAGGGAGAGGGG + Intronic
1029702406 7:102256068-102256090 CAAGAGGCAGGCTGGGAGACTGG - Exonic
1030387268 7:108879372-108879394 ACAGAGGTGAGCAGGGAAAGAGG - Intergenic
1031979929 7:128117965-128117987 CCAGAGCCAGGCAGGCAAAGGGG + Intergenic
1032710753 7:134458635-134458657 CGAGAGGGAGGCGGGGAAAGTGG - Intronic
1032761456 7:134947363-134947385 CAGGGGGTAGGCTGGGGAAGGGG - Intronic
1032839994 7:135705955-135705977 CAAGAGCTGGGATGGGAAAGAGG + Intronic
1033578068 7:142705013-142705035 CCTGAGGCAGGGTGGGGAAGGGG - Intergenic
1033578213 7:142707049-142707071 CCTGAGGCAGGGTGGGGAAGAGG - Intergenic
1033590369 7:142803609-142803631 GCAGAGAAAGGTTGGGAAAGAGG + Intergenic
1035713348 8:1735305-1735327 CCAGAGGTGAGATGGGAAACTGG + Intergenic
1036165969 8:6434007-6434029 CCATAGGGAGGCTGGAAAACGGG - Intronic
1036711282 8:11080614-11080636 ACAGAAGTAGGCTGTGAAGGTGG - Intronic
1037294597 8:17386876-17386898 TCAGAGGGAGCCTGGGAGAGTGG + Intronic
1037709401 8:21343680-21343702 CCGGATGTAGGATGGGAAGGAGG - Intergenic
1037754240 8:21700982-21701004 ACAGATGTGGGCTGGGAAGGAGG + Intronic
1037756762 8:21715253-21715275 CCTGGGGTGGGCTGGGGAAGAGG + Intronic
1037756945 8:21716511-21716533 CCAGAAGTAGGCAGGCAAGGGGG + Intronic
1038084939 8:24185676-24185698 AAAGAAGTAGGCTGGGAAAGGGG - Intergenic
1038778646 8:30552457-30552479 CCAGCGACAGGATGGGAAAGTGG + Intronic
1039322672 8:36449900-36449922 CTGGAGCCAGGCTGGGAAAGGGG - Intergenic
1039867435 8:41517749-41517771 CACCAGGAAGGCTGGGAAAGAGG - Intergenic
1040980128 8:53238489-53238511 CAAGGGGCAGGCCGGGAAAGAGG + Intronic
1041971147 8:63744112-63744134 ACAGAGGTAGGGTAGGAGAGTGG + Intergenic
1042528635 8:69792630-69792652 TCAGAAGTAGGCTGGGACAGTGG + Intronic
1045493553 8:102689023-102689045 GCAGAGGTTGCCTGGGACAGCGG + Intergenic
1047656955 8:126988358-126988380 GCAGAGGAAGGTTGGGAGAGAGG - Intergenic
1048408266 8:134144890-134144912 CCAGAGACAGGCTGGCAAAATGG + Intergenic
1049736553 8:144210136-144210158 CCATAGGTAGGCTTTTAAAGTGG - Intronic
1050366771 9:4880069-4880091 CCAGAAACAGGCTGGGAATGGGG + Intronic
1050612892 9:7371589-7371611 TCAGAGGGAGGCTGACAAAGAGG + Intergenic
1052891549 9:33704825-33704847 CCTGAGGCAGGGTGGGGAAGGGG - Intergenic
1053419336 9:37967387-37967409 CAAGAGGGAGGCTGGCTAAGGGG + Intronic
1053446853 9:38159271-38159293 CCATAGGAAGGCTGGGAGGGAGG + Intergenic
1056292530 9:85158089-85158111 CCACAGGGAGGGAGGGAAAGAGG - Intergenic
1056581281 9:87889357-87889379 CCCGTGGTAGCCTGGGAATGTGG + Intergenic
1056692997 9:88823863-88823885 CCAGATCTGGGCAGGGAAAGAGG + Intergenic
1057179301 9:93021299-93021321 GGAGACTTAGGCTGGGAAAGAGG + Intronic
1057851692 9:98571229-98571251 CAGGAGGTGGGCTGGGAAAACGG + Intronic
1058807210 9:108604162-108604184 CCAGAGGTAGACAGAGGAAGAGG - Intergenic
1061065678 9:128276202-128276224 CCCGAGGTGGGCGGGGACAGCGG - Exonic
1062080925 9:134622866-134622888 CAAGAGGAAGGCTGGGAGAGAGG - Intergenic
1062238705 9:135524734-135524756 CCTGAGCTGGGCTGGGGAAGGGG - Intronic
1062501631 9:136854356-136854378 CCAGAGTGAGGCTGGGAGACTGG + Intronic
1062707670 9:137954241-137954263 ACAGAGCAAGGCTGGGAAGGCGG - Intronic
1062735653 9:138135994-138136016 CCAGAGGTTGGCTGGAGATGAGG - Intergenic
1186315760 X:8368472-8368494 CCAAAAATTGGCTGGGAAAGAGG + Intergenic
1187469074 X:19552411-19552433 GCAGAGGAAGGCTCGGGAAGAGG + Intronic
1187833846 X:23410598-23410620 CCAGAGGAAGACAGGGAAAGGGG - Intergenic
1189025962 X:37394706-37394728 TCACAGGAAGCCTGGGAAAGAGG + Intronic
1189445642 X:41078312-41078334 ACAGAGGTAGGCAGGGTAAAAGG - Intergenic
1190101083 X:47523680-47523702 CCAGGGGGAGGCAGGGGAAGGGG - Intergenic
1190118272 X:47639640-47639662 ACAAAGGGAGGCTTGGAAAGGGG - Intronic
1191606256 X:63065942-63065964 CCGGAGGTTGGTTGGGGAAGGGG + Intergenic
1194040863 X:88940797-88940819 CCTGAGGCAGGATGGGGAAGGGG + Intergenic
1195681451 X:107549969-107549991 CCAGAGGAAGGGTGTGAAAAAGG - Intronic
1196260049 X:113568314-113568336 CCAGAGGTTAGGTGGGACAGAGG - Intergenic
1197163237 X:123346931-123346953 CCAGTGGTATGCTGGAAAACTGG + Intronic
1197754604 X:129984595-129984617 CGAGAGGAAGGCTGGGCCAGAGG + Intronic
1199942276 X:152638127-152638149 ACAGAGGTGGGGTGGGAGAGTGG - Intergenic
1200072360 X:153535524-153535546 CCGGAGGAAGGGTGGGAAACAGG - Intronic
1201942564 Y:19475552-19475574 CCAGAGGAAGGCTGAGAACCTGG + Intergenic