ID: 914772223

View in Genome Browser
Species Human (GRCh38)
Location 1:150697977-150697999
Sequence AAAGGCTGGTAGGAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 592}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914772223 Original CRISPR AAAGGCTGGTAGGAGGATGG GGG (reversed) Intergenic
901055304 1:6446383-6446405 GAGGGCTGGAAGGAGGGTGGGGG + Intronic
901133207 1:6975808-6975830 AAGGGCTGGGAGGAAGTTGGGGG - Intronic
901366792 1:8758694-8758716 AAAGGCTGAGAGGAGGACTGGGG + Intronic
901464620 1:9413330-9413352 GGAGGCTGGGAGGAGGAGGGCGG + Intergenic
902253606 1:15172406-15172428 AAAGGAAGGAAGGAGGAGGGAGG + Intronic
902365236 1:15968852-15968874 ACAGGCTGGTTGGAAGCTGGAGG - Intronic
902380517 1:16050311-16050333 AGAGGCTGATAGGAGAATTGGGG - Intronic
902754700 1:18541318-18541340 AAAGGCTGGTGGGAGGTGAGAGG - Intergenic
903321108 1:22543676-22543698 CAGAGCTGGTGGGAGGATGGAGG - Intergenic
903334888 1:22618299-22618321 CAACGCTGGTGGGAGCATGGAGG + Intergenic
903468655 1:23569234-23569256 ACAGGCTAGTGGGAGGAAGGGGG + Intergenic
903827394 1:26156055-26156077 AGAGGGTGGTGGAAGGATGGGGG - Intergenic
903926292 1:26833241-26833263 AAAGGAGGGAAGGAGGATGAAGG + Intronic
904207116 1:28862622-28862644 AAAGGCTGGGAGGAGGTGGTGGG + Intronic
904363988 1:29999015-29999037 GAAGGCTGGTAGGACCAGGGTGG + Intergenic
904889069 1:33764367-33764389 CAGGGGTGGTAGCAGGATGGGGG - Intronic
905106943 1:35569191-35569213 AAAGGCTGGGAGGATGAGGGTGG + Intergenic
905479796 1:38253822-38253844 AAAAGATGGTAAGAGGCTGGTGG - Intergenic
905641202 1:39591163-39591185 AAAGGATGGGAGGAGGATTCTGG + Intergenic
905700739 1:40011551-40011573 AGAGGCTGGGAGGAGTATGTGGG + Intergenic
905803774 1:40861901-40861923 AAGGGCTGGAAGGAGGACGGCGG + Exonic
905934460 1:41812667-41812689 CAAGGCTGGTAGGGGGTGGGGGG + Intronic
905998571 1:42403566-42403588 TAAGGCTTATAGGAGTATGGTGG + Intronic
906382592 1:45342241-45342263 CAAGACTGGTATGAGGAGGGTGG + Intronic
906387827 1:45386970-45386992 AAAGGTTGGGAGGGGGATGAAGG - Intronic
906997102 1:50807995-50808017 AAAGGCAGCTAGGAAGAAGGAGG + Intronic
907797004 1:57727922-57727944 CAAGGCTGGGAGTAGGGTGGAGG + Intronic
908668103 1:66514792-66514814 AAAGGGTGGGAGGAGGGTGAGGG + Intergenic
910664696 1:89711742-89711764 AAACGTTGGTGGAAGGATGGTGG + Intronic
910899151 1:92101065-92101087 AAACGGTGGAAGGAGGATGAGGG - Intronic
911126112 1:94342524-94342546 AAAGCCTGGCAGGAGATTGGAGG + Intergenic
911265408 1:95737338-95737360 AAAGGCTGGAAGGGGGGTGAGGG - Intergenic
912076718 1:105884528-105884550 AAAGCTTGGTAGGGAGATGGGGG - Intergenic
912250972 1:108012145-108012167 AAAGGATGGGAGGGGGATGAGGG + Intergenic
912360706 1:109092678-109092700 AATTGCTTGTAGGAGGAAGGGGG - Intronic
913572892 1:120139169-120139191 AGAGGCAGGAAGGAGGAAGGGGG - Intergenic
914294152 1:146303957-146303979 AGAGGCAGGAAGGAGGAAGGGGG - Intergenic
914555196 1:148754740-148754762 AGAGGCAGGAAGGAGGAAGGGGG - Intergenic
914772223 1:150697977-150697999 AAAGGCTGGTAGGAGGATGGGGG - Intergenic
914847989 1:151293311-151293333 GCAGGCTGGGAGGAGGCTGGAGG + Intronic
915091304 1:153428276-153428298 CAAGGCTGATAGGAAGGTGGGGG + Intergenic
916317591 1:163467517-163467539 AAAGGCTGGGAGGGGCTTGGGGG + Intergenic
916382791 1:164231616-164231638 AGAGGCTGGTAAGGGGAGGGTGG + Intergenic
916585357 1:166145061-166145083 GAAGACAGGTGGGAGGATGGGGG + Intronic
917573396 1:176294389-176294411 AGAGGTTGGGAGGAGGATGAGGG + Intergenic
918121405 1:181544284-181544306 AAAGGCTGGTAGAAGTGAGGTGG + Intronic
919534236 1:198766934-198766956 AAAGGATGGAAGGAGGAAGAAGG + Intergenic
920006226 1:202835678-202835700 AGAGGCTGCAAAGAGGATGGGGG - Intergenic
920379538 1:205527717-205527739 CAAGGCTGGGACCAGGATGGGGG - Intronic
920714683 1:208328500-208328522 AAAGAGGGGTAGGAGGAAGGAGG - Intergenic
921409472 1:214819741-214819763 AAAGACTGGGAGGGGGATGAGGG - Intergenic
921657749 1:217760895-217760917 GAAGGTTTGTAGGAGGATGGTGG + Intronic
921742506 1:218702056-218702078 AAACACTGGTAGGAGTTTGGAGG - Intergenic
922722620 1:227906450-227906472 AGAGGGTGGGAGGAGGAGGGAGG - Intergenic
923799055 1:237189048-237189070 AAGGGCTGGGAGGAGGACGGGGG - Intronic
924384589 1:243489467-243489489 ACAGGCTTTTTGGAGGATGGTGG + Intronic
924454243 1:244205590-244205612 AAAGCTTGGTTGGAAGATGGAGG + Intergenic
924617458 1:245624402-245624424 AAATGCTGGTGGGGGTATGGAGG - Intronic
924789625 1:247233041-247233063 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
1063077496 10:2731606-2731628 AAAGGAAGGTAGGAGGAAGTCGG + Intergenic
1063578439 10:7282966-7282988 AAAGGCCGGTAAGAGGAGGCCGG + Intronic
1064177712 10:13089821-13089843 AAAGGGTGGGAGGGGGGTGGGGG - Intronic
1064533522 10:16334186-16334208 AATGGCTGGCAGGAGAATTGAGG + Intergenic
1065484855 10:26227796-26227818 AAAGGCTGGCTGTAGGATGCTGG - Intronic
1066242367 10:33550816-33550838 AGGGGCTGGAAGGAGGAAGGTGG - Intergenic
1066656106 10:37701191-37701213 AGAGGGTGGGGGGAGGATGGGGG - Intergenic
1066784421 10:38987433-38987455 AAAGGCTGGGAGGAGGGTAAGGG - Intergenic
1067092682 10:43277285-43277307 GAAGGCTGGGAGAAGGCTGGAGG - Intergenic
1067371498 10:45687857-45687879 AAAGGCTGGGAGGAGGGTGAGGG - Intergenic
1067388285 10:45838293-45838315 AAAGGCTGGGAGGAGGGTGAGGG + Intronic
1067417840 10:46118990-46119012 AAAGGCTGGGAGGAGGGTGAGGG - Intergenic
1067445980 10:46346281-46346303 AAAGGCTGGGAGGAGGGTGAGGG - Intergenic
1067503196 10:46825552-46825574 AAAGGCTGGGAGGAGGGTGAGGG - Intergenic
1067591401 10:47514464-47514486 AAAGGCTGGGAGGAGGGTGAGGG + Intronic
1067638519 10:48022559-48022581 AAAGGCTGGGAGGAGGGTGAGGG + Intergenic
1067695375 10:48531271-48531293 AAAGGGTGGCAGGAGGCTGAGGG + Intronic
1067704729 10:48598343-48598365 AAGGGCTGGGTGGAGGGTGGTGG + Intronic
1067874971 10:49997773-49997795 AAAGGCTGGGAGGAGGGTGAGGG - Intronic
1068605382 10:58999562-58999584 GCAGTCTGATAGGAGGATGGGGG + Intergenic
1069218343 10:65851359-65851381 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
1069797545 10:71062938-71062960 AAAGGCTGTTGGGAGGAGGCAGG - Intergenic
1070135118 10:73686976-73686998 AAAGGCTGGGAGGAGGGTGAGGG + Intronic
1070389630 10:75958146-75958168 GAAGGATGGGAGGAGGAGGGTGG + Intronic
1070511418 10:77164492-77164514 AATGGCATGTAGGAGGGTGGGGG - Intronic
1070716621 10:78727118-78727140 AAAGGGTGGTAGGGGGCAGGAGG + Intergenic
1070897843 10:80000315-80000337 AAAGGCTGAGAGGGGGATGAAGG - Intergenic
1071353035 10:84765771-84765793 AAAGACTGGAATGAGGAGGGTGG + Intergenic
1071464059 10:85923477-85923499 GAAGGCTGGTTGCAGGCTGGGGG + Intronic
1071728455 10:88223157-88223179 ACAGGATAGAAGGAGGATGGGGG - Intergenic
1072770157 10:98131357-98131379 TAAAGCTGGTATGAGGCTGGGGG + Intergenic
1073643225 10:105274084-105274106 AAAGCATGGAAGGAGGGTGGGGG - Intergenic
1073756843 10:106589869-106589891 AAAGGCTGCTAGAAGGATTTTGG - Intronic
1074046238 10:109841948-109841970 AAAGGGTGGTATGTGGAAGGAGG - Intergenic
1074887236 10:117703824-117703846 AAGAGCTGGGATGAGGATGGGGG - Intergenic
1075494293 10:122906359-122906381 GAAGGGTGGTAGGGGGATGAGGG + Intergenic
1075886979 10:125908600-125908622 AAAGGGTGGGAGGGGGATGAGGG + Intronic
1076047751 10:127308183-127308205 AAGGACTGACAGGAGGATGGAGG - Intronic
1076116378 10:127904591-127904613 AAAGCCTGGGAGGAGGATAGGGG + Intergenic
1076265209 10:129104166-129104188 AAATGCTGGCAGGAGGAAGGAGG + Intergenic
1076280429 10:129242067-129242089 GAAGGCTGGCAGTAGGAAGGAGG + Intergenic
1076639044 10:131901419-131901441 GAAGGCAGGCAGGAGGATGGGGG + Intronic
1076948715 10:133667467-133667489 AAAGGCTCGGAGGAGCAGGGCGG - Exonic
1076949699 10:133670766-133670788 AAAGGCTCGGAGGAGCAGGGCGG - Intronic
1076950683 10:133674065-133674087 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1076951673 10:133677375-133677397 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1076952662 10:133680685-133680707 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1076953646 10:133683984-133684006 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1076955619 10:133743646-133743668 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1076956609 10:133746956-133746978 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1076957596 10:133750265-133750287 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1076958581 10:133753564-133753586 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1076959570 10:133756874-133756896 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1076960554 10:133760173-133760195 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
1077233060 11:1467123-1467145 AACAGGTGGTAGAAGGATGGAGG - Intergenic
1077268863 11:1665844-1665866 AAAGGCCGGCAGGTGGATGTTGG + Intergenic
1077423623 11:2464385-2464407 AGAGGCTGGTAAGAGGATTCTGG + Intronic
1078133684 11:8634944-8634966 ACAGGCTGGGAGTGGGATGGAGG + Intronic
1079158313 11:17969492-17969514 AAAAGCTAGTAGTAGGCTGGGGG + Intronic
1079876969 11:25870884-25870906 TGAGGCTTGTAGGAGGGTGGAGG - Intergenic
1080596585 11:33778662-33778684 AAAGGGTGGGAGGATCATGGTGG + Intergenic
1080807234 11:35664305-35664327 AAAGGAGGGTAAGAAGATGGAGG + Intronic
1080835472 11:35936545-35936567 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
1081374373 11:42341299-42341321 AAAAGCTGGCAGCTGGATGGGGG + Intergenic
1081391012 11:42528875-42528897 AAAGGCTGGTAGGCTGCTGAGGG - Intergenic
1081787540 11:45757825-45757847 AAAGCGTGGGAAGAGGATGGAGG + Intergenic
1081787544 11:45757836-45757858 AGAGGATGGAGGGAGGATGGAGG + Intergenic
1081842162 11:46210364-46210386 AAAGTTGGGTAAGAGGATGGAGG + Intergenic
1081962921 11:47151476-47151498 GAAGGCTGGGGGTAGGATGGTGG + Intronic
1082234206 11:49803135-49803157 AAAGGATAGTAGGAAGATGGTGG + Intergenic
1082769434 11:57195422-57195444 TAAAGCTGGGTGGAGGATGGGGG - Intergenic
1083540162 11:63506793-63506815 AATGGATGCTAGGAGGATGAGGG + Intronic
1083790417 11:64981288-64981310 AAAGGCTAGGAAGAGGATTGGGG - Intergenic
1084328719 11:68417186-68417208 AAACACTGGAAGGAGGATTGTGG + Intronic
1085503380 11:77041561-77041583 AAAGGCTGGTGGGAACATGGAGG + Exonic
1085986063 11:81789938-81789960 AAAGGGTGGGAGGAGGGTGAGGG + Intergenic
1087956909 11:104299664-104299686 AAAGGCTGGTAGGTGGCGGGAGG + Intergenic
1088221085 11:107570476-107570498 AAATGCTGGGAGGAGAAGGGCGG - Intergenic
1088342395 11:108783447-108783469 AAAGGCAGGAAGGTGGATAGTGG + Intronic
1088732097 11:112692727-112692749 ACAGGCTAGTATGAGGTTGGGGG + Intergenic
1089067283 11:115671384-115671406 AAGGGCGGGAAGGAGGAGGGAGG - Intergenic
1089135543 11:116246231-116246253 AAGGGCTGGTGGGAGGAGTGAGG - Intergenic
1089634121 11:119801489-119801511 AAGGGCTGGTGTGAGGATGGTGG + Intergenic
1089960944 11:122616891-122616913 AAATGCTGGCAGGAGGAGGAAGG - Intergenic
1090023304 11:123146622-123146644 AATGGCAGGTAGCAGGAAGGAGG - Intronic
1090124363 11:124070229-124070251 AAGGGCTGGGAGGAGAACGGCGG - Intergenic
1091741169 12:2961027-2961049 AAAAGCTGGTAGGAGGCTGAAGG + Intronic
1092035267 12:5329128-5329150 AAAGGCTGGAAGGAGGTTTAGGG + Intergenic
1092782843 12:12003322-12003344 AAAGGATGGATTGAGGATGGGGG - Intergenic
1093347170 12:18052065-18052087 AAAGGGTGGTAGGCGGGTGAGGG + Intergenic
1095983476 12:47985496-47985518 GAGGGCTGCTAGGAGGGTGGGGG - Intronic
1096230290 12:49893038-49893060 AAAGGGTGGTAGTGGGGTGGAGG - Intronic
1097169522 12:57105099-57105121 AAGGGCTGTTAGGGTGATGGAGG - Intronic
1097224273 12:57467860-57467882 AAAGGAAGTAAGGAGGATGGAGG - Intronic
1097379593 12:58878985-58879007 ATAGCCTGGCAGAAGGATGGGGG - Exonic
1097697794 12:62791253-62791275 CAAGACTGGTAGAAGGCTGGAGG + Intronic
1097862785 12:64534610-64534632 CAAGGCTGGTAGTAGGAAGGAGG + Intergenic
1098785971 12:74756284-74756306 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
1099203429 12:79701645-79701667 AAAGGCGGGTAGGATTATGGTGG + Intergenic
1099766007 12:86985177-86985199 AAAGGGTGGGAGGAGGGTGAGGG + Intergenic
1100647139 12:96543453-96543475 AAGGGCTGCTAGGAGACTGGGGG + Intronic
1101529672 12:105562612-105562634 GAAAGCTCGTAGGGGGATGGAGG + Intergenic
1102234189 12:111283989-111284011 AAAGGAGGGAAGGAGGAGGGAGG - Intronic
1102303087 12:111785071-111785093 AAAGGCAGGGAGGAGGAGGAAGG - Intronic
1102510725 12:113413664-113413686 AAATCCTAGGAGGAGGATGGTGG + Intronic
1102571062 12:113827340-113827362 AAATGGTGGTTGGAGGTTGGTGG - Intronic
1102748989 12:115275687-115275709 GAAGGGTGGGAGGAGGATGAGGG + Intergenic
1103196415 12:119047473-119047495 AAAGGGTGGGAGGAGGGTGAGGG - Intronic
1103251625 12:119504983-119505005 AAAGGAGGGAAGGAGGAAGGTGG - Intronic
1103520456 12:121534390-121534412 CAGGGCTGGTTGGAGGAGGGAGG + Intronic
1103844784 12:123893718-123893740 AAAGGCTGGCATGAGGCTGGTGG - Intronic
1104068563 12:125326049-125326071 ACAGCGTGGTAGGAGGCTGGAGG - Intronic
1104239911 12:126978451-126978473 GAAGGGTGGTAGGAGGAGGAAGG - Intergenic
1104748251 12:131223155-131223177 ATAGGCAGGGAGGAGGATGCAGG - Intergenic
1104837145 12:131799123-131799145 AAAGGCTGGGAGCGGGAGGGGGG - Intronic
1105257401 13:18753211-18753233 GAAGGCTGGCAGTAGAATGGTGG - Intergenic
1105275216 13:18916042-18916064 GAAGGGTGGTAGGAGGGTGAAGG + Intergenic
1105659059 13:22472747-22472769 AAAGGAAGGTAGGAGGAGGCAGG + Intergenic
1105795124 13:23843996-23844018 CAATGATGGGAGGAGGATGGAGG + Intronic
1106306653 13:28517042-28517064 AAAGGGTGGGAGGAGGGTGAGGG + Intergenic
1106483792 13:30155608-30155630 AAGCCCTGGTAGGAGGGTGGAGG + Intergenic
1106976831 13:35228526-35228548 AAAGGCTGGAGGGTGGAAGGTGG - Intronic
1107747244 13:43523693-43523715 AGAGGCTACCAGGAGGATGGAGG - Intronic
1107872424 13:44759663-44759685 AAAGGCTGGGAGTGGGATCGGGG + Intergenic
1109797099 13:67329795-67329817 AAATGTAGGTATGAGGATGGGGG - Intergenic
1110037251 13:70703748-70703770 AAAGGAAGGAAGGAGGATGAAGG + Intergenic
1110059577 13:71024723-71024745 AAAGGGTGGGAGGAGAATGAGGG - Intergenic
1110454065 13:75670108-75670130 AAAGGCAGGGAGGAGGAGAGAGG - Intronic
1110539671 13:76694112-76694134 AAAGGCTGGGAGGGGGATGAGGG - Intergenic
1112206719 13:97331387-97331409 ATCCGTTGGTAGGAGGATGGAGG - Intronic
1113364118 13:109660664-109660686 GAAGGCTGGGAGGAGGATGAGGG + Intergenic
1115530268 14:34320643-34320665 AAAAACTGGTAAGAGAATGGGGG + Intronic
1115652796 14:35415167-35415189 AAAGGCTATTAGGAGGATGGGGG + Intergenic
1116297103 14:43126099-43126121 AGAGGGTGGAAGGAGGACGGAGG + Intergenic
1116406588 14:44574004-44574026 GAAGGCTGGGAGGAGGGTGATGG + Intergenic
1116698889 14:48212368-48212390 ATGGGCTGGTAGGAGGAAAGGGG - Intergenic
1116919768 14:50560555-50560577 AAATGCTGGGAGGAGGCGGGAGG - Intronic
1117011947 14:51480025-51480047 AAAGTCTGGTAGCAGGATGCAGG + Intergenic
1117517610 14:56518016-56518038 CATGGCTGGTGGGAAGATGGTGG - Intronic
1117608541 14:57457943-57457965 AGGGGCTGGGTGGAGGATGGGGG + Intergenic
1118332921 14:64827778-64827800 AATGTCTGGTAGGCAGATGGAGG - Intronic
1119709958 14:76814417-76814439 AAAGGCTAATAGGAGGAAGAAGG + Intronic
1121304444 14:92897226-92897248 AATGGCTGGGAGCAGGGTGGAGG - Intergenic
1121850595 14:97218602-97218624 AAAGGCTGGTGGGGGGGTGGGGG + Intergenic
1121915394 14:97833096-97833118 AATGGCTGGAAGGAGGGAGGGGG + Intergenic
1122252954 14:100453153-100453175 AAAGGCTGGCAGTAGGAAGAGGG + Intronic
1122770854 14:104097062-104097084 ATGGGCTGGAAGGAGGGTGGTGG - Intronic
1202852499 14_GL000225v1_random:30384-30406 AAAGGCTCGGAGGAGCAGGGTGG - Intergenic
1202871133 14_GL000225v1_random:165409-165431 AAAGGGTGGGAGGGGGATGAGGG - Intergenic
1126057723 15:44747368-44747390 AGAGACTTGTATGAGGATGGAGG - Intronic
1126286227 15:47014654-47014676 AAAGGGTGGCAGGAGGGTGAGGG - Intergenic
1126485895 15:49180666-49180688 AAAGGAGGGGAGGAGGTTGGAGG - Intronic
1127178905 15:56393266-56393288 AGAGGCTGGTAGGAGAGTTGAGG + Intronic
1127788536 15:62377920-62377942 GAAAGTTGGCAGGAGGATGGGGG - Intergenic
1128091542 15:64922297-64922319 AGAGCCTGGCAGGAGGGTGGAGG - Intronic
1128226050 15:66001956-66001978 CAGGGCTGGCAGGGGGATGGGGG + Intronic
1129671591 15:77610817-77610839 CAAGGCTGGTAAGAGCAGGGAGG - Intergenic
1129884357 15:79028246-79028268 TAAGGCTGGTAGAAGGATGAGGG - Intronic
1130415536 15:83691280-83691302 AAAGCCAGGCAGGAGGATGAAGG - Intronic
1130718563 15:86363000-86363022 TCAGGCTGGTTGCAGGATGGTGG + Intronic
1130894409 15:88159081-88159103 AAAGGCTGGTGGGAGCCTGCAGG + Intronic
1131445892 15:92497620-92497642 AAAGACTGCTATGAGGATGATGG + Intronic
1132149976 15:99452390-99452412 AAAGGCTGGTAGAAGTACAGAGG - Intergenic
1132700136 16:1218762-1218784 ATGGGCGGGAAGGAGGATGGGGG + Intronic
1132776249 16:1596194-1596216 GGAGGCTGGGAGGGGGATGGGGG - Intronic
1133388764 16:5392133-5392155 AAAGGATGGGAGGAGGATGAGGG + Intergenic
1133402436 16:5498545-5498567 AAAGGGTGGTGGGAGGAAAGGGG + Intergenic
1133466073 16:6028242-6028264 AAAGGCTGATAAGAGGAGGGAGG + Intronic
1133497009 16:6328280-6328302 AAAGGGTGGGAGGGGGATGAAGG + Intronic
1133908426 16:10042462-10042484 AAAGGCTGGACTGAGGCTGGAGG - Intronic
1134235090 16:12459165-12459187 AAAGGCGGGTAGGAGGATAGGGG - Intronic
1134291747 16:12907162-12907184 GAAGGGTGGAAGGGGGATGGAGG - Intronic
1134649579 16:15898140-15898162 GAGGGCTGGGAGGAGGAAGGAGG - Intergenic
1135028145 16:19014508-19014530 ACAGACTGGTGGGAGGGTGGAGG + Intronic
1138110770 16:54321983-54322005 AGGGGCTGGAAGGAGGATGGTGG + Intergenic
1138187847 16:54989929-54989951 AAAGACTGGGAGGGGGATGAGGG - Intergenic
1138686256 16:58728658-58728680 AAAGGTTGGTTGGAGGGTTGTGG - Intronic
1138718714 16:59053617-59053639 ATAGGCAGGTAGGATGATGGAGG - Intergenic
1138833314 16:60402672-60402694 AAAGGGTGGGAGGAGAATGAGGG + Intergenic
1139286025 16:65815148-65815170 AAAGGGTGGTAGGGGGGTGAGGG - Intergenic
1139476377 16:67204507-67204529 CCAGGCTGGTAGGAGGATGTGGG + Intergenic
1140786480 16:78347207-78347229 AAAGGATGGAAAGAGAATGGAGG - Intronic
1141128388 16:81417400-81417422 CAGGGCTGGGTGGAGGATGGTGG + Intergenic
1141406916 16:83802716-83802738 GAAGACTGGTACCAGGATGGTGG + Intergenic
1141453908 16:84125703-84125725 AAAGTCGGGTAGGTGGGTGGTGG - Intronic
1141677635 16:85525910-85525932 AAAGGCTGATGGGAGGCTGGAGG - Intergenic
1141792709 16:86247701-86247723 AAAGGGAGGAGGGAGGATGGAGG - Intergenic
1142112393 16:88339532-88339554 ACAGGATGGCAGGGGGATGGGGG + Intergenic
1142112401 16:88339555-88339577 ACAGGATGGCAGGGGGATGGAGG + Intergenic
1142112427 16:88339621-88339643 ACATGGTGGCAGGAGGATGGGGG + Intergenic
1142112466 16:88339729-88339751 ACAGGATGGCAGGGGGATGGGGG + Intergenic
1142178954 16:88657947-88657969 AATGGCCGGGAGGAGGATGTGGG - Exonic
1142748130 17:1970756-1970778 ACAGGGTGGTAGGAGCCTGGGGG - Intronic
1142832906 17:2562451-2562473 AAAGGAAGGAAGGAAGATGGTGG + Intergenic
1144196949 17:12903737-12903759 AAAGGGTGGGAGGAGGGTGAGGG - Intronic
1144675512 17:17159025-17159047 AAAGGCTGCTGGGAGCAGGGTGG - Intronic
1144878912 17:18420726-18420748 AAAGGCTGCAAGAAGGATGTTGG + Intergenic
1145153323 17:20523668-20523690 AAAGGCTGCAAGAAGGATGTTGG - Intergenic
1145269867 17:21399090-21399112 AGATGCTGGCAGGAGGCTGGAGG + Intronic
1145400340 17:22526890-22526912 AGAGATTGGTAGGAGGAGGGTGG - Intergenic
1146767893 17:35540543-35540565 GAAGGGTGGGAGGAGGATGAGGG - Intergenic
1146948435 17:36889936-36889958 ACAGGCAGGGAGGAGGAGGGAGG - Intergenic
1147391321 17:40111184-40111206 GAAGGCTGGTAGCTGGAAGGAGG - Intergenic
1147603182 17:41758500-41758522 ACAGGATGGTGTGAGGATGGAGG - Exonic
1148945541 17:51259674-51259696 AACGGCTGGAAGGGGGAGGGGGG + Intronic
1149516522 17:57285013-57285035 GAAGACTTGTAGGAGGATAGGGG + Intronic
1150439099 17:65177206-65177228 AATGGGTGGTAGGTGGATGGTGG - Intronic
1151345854 17:73500744-73500766 GAAGGATGGATGGAGGATGGAGG - Intronic
1151458752 17:74242223-74242245 AAGGGCTTGGAGGAGGCTGGAGG + Intronic
1151472741 17:74327983-74328005 ACAGGCTGTTGGGATGATGGGGG + Intronic
1151757706 17:76083977-76083999 ACAGGCTGGGAGGGGAATGGAGG + Intronic
1152114062 17:78374052-78374074 AAAGGCTAGAAGCAAGATGGGGG - Intergenic
1152200331 17:78941878-78941900 AAAGGCTGGAAAGTGAATGGTGG + Intergenic
1152222815 17:79078437-79078459 GAAGGCTGGTAGTAGATTGGAGG + Intronic
1152316835 17:79585950-79585972 GAAGGCTGGTTGGTGGATGCAGG - Intergenic
1153163000 18:2229726-2229748 AAAGGATGGGAGGGGGATGAGGG + Intergenic
1153564272 18:6404097-6404119 GAAGGGTGGGAGGAGGGTGGGGG + Intronic
1154193008 18:12245933-12245955 AAGGGCAGGAAGGAGGTTGGTGG - Intergenic
1155096224 18:22559219-22559241 GAGGGCTGGTGGGAGGATGGGGG + Intergenic
1155225224 18:23724020-23724042 AAAGGGTGGGAGGGGGATGAAGG - Intronic
1155763258 18:29592202-29592224 GGAGGGTGGTAGGAGGATGAGGG + Intergenic
1156898153 18:42270116-42270138 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
1157484727 18:48078696-48078718 ATAGGCAGGTAGCAGGGTGGGGG + Intronic
1157712212 18:49857895-49857917 AGAGGCTGTTAGGAGCAGGGAGG - Intronic
1157910696 18:51615089-51615111 AATGGCAGGGATGAGGATGGAGG + Intergenic
1158149319 18:54349644-54349666 AAAGGGTGGGAGGAGGAGGATGG - Intronic
1158547295 18:58407027-58407049 AAAGGCTGGAGGGAGGCGGGGGG - Intergenic
1158836812 18:61339479-61339501 GAAGGCTGGAAGGAAGTTGGTGG - Intronic
1159460991 18:68722520-68722542 GAAGTCTGGTAGGAGGAAGTTGG - Intronic
1159554750 18:69933409-69933431 AAGGGCTGGCAGGAAGAGGGAGG - Intronic
1160827519 19:1087570-1087592 AGAGACTGGAAGTAGGATGGGGG - Exonic
1160899504 19:1420496-1420518 AAAGGATGGTTGGTGGGTGGGGG + Intronic
1161678200 19:5665089-5665111 AAATGCTGGCAGGAGGAGGAAGG - Intronic
1161719789 19:5896411-5896433 CCAGGCTGGGAGGAGGGTGGGGG + Intronic
1161906861 19:7163248-7163270 GAAAGCTGGTGGGAGGATGGCGG + Intronic
1161933330 19:7355767-7355789 AAAAGCTCGAAGGGGGATGGCGG - Intronic
1162152082 19:8653823-8653845 AAAGGTTGGGAGGCGGATGAGGG + Intergenic
1162183833 19:8889236-8889258 AAAGGCAGGTAGGGGAAAGGAGG + Intronic
1162200547 19:9016821-9016843 AAAGGGTGTTCTGAGGATGGGGG + Intergenic
1162445361 19:10719224-10719246 AAGGGGTGGTAGGAGGGTAGAGG + Intronic
1162591491 19:11595247-11595269 AAAGGCAGGTTGGAGGATTCAGG - Intronic
1163156911 19:15444637-15444659 AAGGGCTGGTTTTAGGATGGGGG + Intronic
1163463147 19:17451098-17451120 AAAGGCTATTATGAGGAAGGAGG - Intronic
1163501720 19:17680173-17680195 AGAGGCTTGGAGGAGGAAGGGGG + Intronic
1163754095 19:19096277-19096299 AGAGGCTGGGAGGAGGAGGCAGG - Intronic
1164705374 19:30315422-30315444 AAAGGAAGGAAGGATGATGGTGG + Intronic
1165080782 19:33304764-33304786 AGAGGCTGCTGGGAGGAAGGAGG + Intergenic
1165148811 19:33749374-33749396 GGGGGATGGTAGGAGGATGGTGG - Intronic
1165149672 19:33753477-33753499 GGGGGATGGTAGGAGGATGGTGG - Intronic
1165149756 19:33753690-33753712 GAGGGTTGGTAGGAGGATGGTGG - Intronic
1165149859 19:33753962-33753984 GGGGGATGGTAGGAGGATGGTGG - Intronic
1165562773 19:36694959-36694981 AAAGATAGGTAGGAGGATGTAGG - Intronic
1165742088 19:38210683-38210705 AAGGGCTGGGAAGAGGACGGTGG - Intergenic
1165929249 19:39345425-39345447 AAAGGCTGGTAGTGGGCTGGAGG - Intronic
1165981300 19:39726594-39726616 AATGTCTAGTTGGAGGATGGAGG - Intergenic
1166872962 19:45882152-45882174 AACAGCTGGTAGGTGGGTGGGGG - Intergenic
1167103287 19:47416996-47417018 AGAGGCTGGGAGGTGGATGGAGG + Intronic
1167106080 19:47430527-47430549 AAAGGCTGGGAGGGGGCAGGCGG - Intronic
1167108625 19:47446136-47446158 AGAGGCTGGGAGGAGGAGGGAGG + Intronic
1167902648 19:52633518-52633540 TGAGGCTGGAAGGAGGGTGGAGG + Intronic
1167917899 19:52756968-52756990 GGAGGCTGGAAGGAGGGTGGAGG + Intergenic
1167925010 19:52814154-52814176 GGAGGCTGGAAGGAGGATGGAGG + Intronic
1167925232 19:52816085-52816107 TGAGGCTGGAAGGAGGGTGGAGG + Intronic
1167929566 19:52853251-52853273 TGAGGCTGGAAGGAGGGTGGAGG + Intronic
1167980787 19:53273138-53273160 TAAAGCTGTCAGGAGGATGGGGG + Intergenic
1167989081 19:53342547-53342569 TGAGGCTGGAAGGAGGGTGGAGG - Intronic
1167992646 19:53373528-53373550 TGAGGCTGGAAGGAGGGTGGAGG - Intronic
1168001317 19:53448436-53448458 TGAGGCTGGAAGGAGGGTGGAGG - Intronic
1168005703 19:53484999-53485021 TGAGGCTGGAAGGAGGGTGGAGG - Intronic
1168328781 19:55553911-55553933 AAAGGAGGGAAGGAGGAGGGAGG - Intergenic
1168433890 19:56302622-56302644 AAAGGAAGGGAGGAGGAGGGAGG - Intronic
924960819 2:32928-32950 AAAGGCTGGGTGGAGGTTAGGGG - Intergenic
925242850 2:2347734-2347756 AGAGACTGGCGGGAGGATGGAGG - Intergenic
925495166 2:4439954-4439976 AAAGGCTTCTAGGAGGAGGGAGG - Intergenic
926423971 2:12724716-12724738 TGAGGCTGGTAGGGGGAGGGTGG - Intronic
926772572 2:16391539-16391561 AAAAGGTGGGAGGAGGATGAGGG - Intergenic
926804561 2:16695085-16695107 AAAGGGTGGAAGGGGGATGAGGG - Intergenic
927075932 2:19577620-19577642 AAAGGATGGCAGGATGATGCAGG + Intergenic
927783488 2:25956736-25956758 CAGGGCTAGGAGGAGGATGGGGG + Intronic
927955120 2:27202543-27202565 AAAGGCTGCTAGGGGGCTGATGG + Intronic
929044043 2:37773452-37773474 AGATGCTGGTAGCAGGAGGGAGG + Intergenic
929658727 2:43760792-43760814 CAGGGCTGGGAGGAGGAGGGAGG - Intronic
930019126 2:46990431-46990453 GAGGGCTGGTAGGCGGAAGGTGG + Intronic
930569475 2:53066777-53066799 AAAGAGTGTTAGGAGGATGAGGG - Intergenic
930765194 2:55078028-55078050 AAAGGGTGGGAGGGGGATGAGGG + Intronic
931785215 2:65612027-65612049 AAAGGGTGGTGGAAGGAAGGGGG - Intergenic
931835205 2:66091808-66091830 AAAGGGTGGGAGGAGGGTGAGGG + Intergenic
932705884 2:74024630-74024652 AATGGCTGGTTGGAGGCAGGAGG - Intronic
932713124 2:74082326-74082348 AGAGGAAGGCAGGAGGATGGAGG + Intronic
933554370 2:83813438-83813460 AAGGGATGGCAGGAGGAAGGAGG - Intergenic
933564202 2:83930200-83930222 GAAGGCTGGGAGGGGGATGAGGG - Intergenic
934064776 2:88330711-88330733 AAAGTCTGGGAGGAGAATGGAGG - Intergenic
934573614 2:95386549-95386571 AAAGCCTGGGAGGAGGGAGGAGG + Intergenic
935080267 2:99786148-99786170 AAAGGATGGTAGGGAGATGAAGG + Intronic
935371555 2:102352119-102352141 AAATGGTGGCTGGAGGATGGTGG - Intronic
935383584 2:102478586-102478608 GAAAGCAGGAAGGAGGATGGGGG + Intronic
936504503 2:113094702-113094724 AAAGGGTGGGAGGAGGAATGAGG - Intergenic
936769961 2:115900308-115900330 AAAGGATGGGAGTAGGCTGGTGG - Intergenic
937302890 2:120854000-120854022 AAATGCTGGTAGAATGAAGGAGG - Intronic
937851699 2:126642118-126642140 GATGGCTGGTTGGAGGGTGGGGG - Intergenic
939346561 2:140973406-140973428 TAAGAATTGTAGGAGGATGGGGG + Intronic
940303478 2:152200735-152200757 AAAGCCTGGAAGGCGGCTGGTGG + Intergenic
941474873 2:165938711-165938733 AAAGGCAGGAAGAAGGAGGGAGG + Intronic
942482290 2:176402795-176402817 GAAGGCAGGAAGGAGGAAGGAGG - Intergenic
943439716 2:187913156-187913178 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
943608268 2:190001925-190001947 AAAGGCTGGCCAGAGGAAGGGGG - Intronic
944428345 2:199607118-199607140 AATGGCATGTAGGAGGAGGGAGG - Intergenic
944762650 2:202832883-202832905 AAGGGGTGGGAGGAGGAAGGAGG + Intronic
944897770 2:204182797-204182819 AAAGGTTGGGAGGGGGATGAGGG + Intergenic
945700142 2:213159536-213159558 TAAAGCAGGTAGAAGGATGGTGG - Intergenic
945935136 2:215896194-215896216 AAAACTTGGCAGGAGGATGGAGG + Intergenic
946100382 2:217315499-217315521 AAAGACTGGGAGGAAGAGGGCGG + Intronic
946146564 2:217735489-217735511 AATGGCGGGCAGGAGGCTGGAGG - Intronic
947154265 2:227145583-227145605 AAAGGATGGTAGGAGAACTGGGG + Intronic
947545593 2:231008214-231008236 AAAGGCTGCGAGGAGGGAGGTGG + Intronic
948095031 2:235326645-235326667 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
948428318 2:237902304-237902326 AGGGGCTGGGAGGAGGAGGGAGG + Intronic
948458415 2:238117931-238117953 GAAGGGTGGAAGGAGGAGGGTGG + Intronic
948486552 2:238285005-238285027 CAAGGCGGGTAGGGGGAGGGAGG + Intronic
1169064954 20:2689969-2689991 AAACTGTGGCAGGAGGATGGGGG + Intergenic
1169975216 20:11317988-11318010 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
1171418135 20:24997471-24997493 GTAGGCTGGGAGGAGGAGGGAGG - Intergenic
1172117077 20:32579494-32579516 AAATGCTGCTGGGAGGATTGGGG - Intronic
1172848560 20:37944635-37944657 GAGGGATGGTAGGAGGAGGGAGG - Exonic
1173093663 20:40002377-40002399 CAAGGCCAGTAGGGGGATGGGGG + Intergenic
1173288173 20:41691510-41691532 AAAGTGTTGTAGAAGGATGGAGG - Intergenic
1174842576 20:53914242-53914264 AAAGACTGGGAGGAGGAGGTGGG - Intergenic
1175020209 20:55838954-55838976 AGAGGCTGGGAAGAGTATGGAGG - Intergenic
1175385638 20:58593196-58593218 GAAGGCTGGAAGGAGGAAGAAGG - Intergenic
1176588723 21:8618674-8618696 AAAGGGTGGGAGGAGGTTGAGGG + Intergenic
1176807676 21:13504494-13504516 GAAGGGTGGTAGGAGGGTGAAGG - Intergenic
1177325477 21:19582897-19582919 AAAGGATGGATGGAGGATGGAGG - Intergenic
1177608471 21:23413752-23413774 AAGGCATGGTTGGAGGATGGGGG + Intergenic
1178588623 21:33890837-33890859 AAAGGCTGGGATCAGGATGCCGG - Exonic
1179156796 21:38858003-38858025 AAAGGATGAAAGGAGGATGGAGG + Intergenic
1179282110 21:39942607-39942629 AAAGGGTGATGTGAGGATGGAGG - Intergenic
1179645983 21:42776536-42776558 AGAGGCTGGCAGGAAGGTGGAGG - Intergenic
1179647445 21:42784474-42784496 AAATCCTGGTGGGAGGGTGGGGG + Intergenic
1180116082 21:45705998-45706020 AAAGGCTGTAAGAAAGATGGAGG - Intronic
1180167987 21:46040033-46040055 AAGGGCTGGAGGGAGGGTGGAGG - Intergenic
1180168011 21:46040110-46040132 AGAGGCTGGAGGGAGGATGGAGG - Intergenic
1180271551 22:10595670-10595692 AAAGGGTGGGAGGAGGTTGAGGG + Intergenic
1181082138 22:20422995-20423017 GAAGGCTGGTGGTAGGTTGGGGG + Intergenic
1181865121 22:25848581-25848603 ATGGGCTGGCAGGGGGATGGGGG + Intronic
1182566910 22:31206862-31206884 CAAGGGTGGCAGGAGGAGGGTGG - Exonic
1183723009 22:39573173-39573195 AAAGGCTGGTAGGAGGACCAGGG + Intronic
1184480363 22:44743172-44743194 AAACGCTGGGAGGAGTAGGGAGG + Intronic
1184942728 22:47780954-47780976 AATGGATGGTTGGAGGATGGAGG + Intergenic
1185061944 22:48611727-48611749 AAAAGGTGGGAGGAGGAAGGAGG - Intronic
1185342644 22:50298519-50298541 CAAGGCTGGCAGGAGTTTGGGGG - Intronic
1203296167 22_KI270736v1_random:44848-44870 AGATGCTGGTAGCAGGAGGGAGG + Intergenic
949266607 3:2164024-2164046 AAAGGGTAGGAGGTGGATGGGGG + Intronic
949347149 3:3087068-3087090 AGAGGGTGGGAGGAGCATGGGGG + Intronic
949479158 3:4477041-4477063 AAAGGATGCCAAGAGGATGGAGG - Intergenic
950235807 3:11319383-11319405 AAGTGCTGGTAGGAGGAGGAGGG - Intronic
950664672 3:14488054-14488076 AAGGGCTGCTGGGAGGAAGGAGG - Exonic
955104935 3:55888762-55888784 AAAGGCTGGGAGGGGGTTGAGGG + Intronic
955173511 3:56588304-56588326 AAAGGCTGGGAGGGGGCTGAGGG + Intronic
955644695 3:61124422-61124444 AACGGCTGGTGGTGGGATGGGGG + Intronic
956881745 3:73518309-73518331 AGAGGCAGGAAGGAGAATGGTGG + Intronic
957030291 3:75232927-75232949 GAAGACTTGTAGGAGGAAGGTGG + Intergenic
957084768 3:75669247-75669269 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
957266514 3:77973066-77973088 AAAGGCCTGTAGGGGGGTGGGGG + Intergenic
958012198 3:87894166-87894188 AAAGGGTGGGAAGAGGATGAGGG - Intergenic
958444412 3:94197366-94197388 AAAGGGTGGAAGGTGGATGAGGG - Intergenic
958945350 3:100355758-100355780 AAAGGCTGGTAGGAGGGGTGGGG - Exonic
959239192 3:103766831-103766853 AAAGGGTGGGAGGAGGGTGAAGG + Intergenic
960549032 3:118953040-118953062 AAAGGTTGGAAGGGGGATGCGGG - Intronic
963113471 3:141705946-141705968 AAAGGCTGGGAAGAGGGTGAGGG + Intergenic
963282623 3:143400536-143400558 AAAGGCTGGCAGGTGGGTGAGGG + Intronic
963424502 3:145109244-145109266 AAAGGCTGGTGAGAATATGGAGG - Intergenic
963849589 3:150197334-150197356 AAAGGCATGTAGGAAGAGGGGGG - Intergenic
964123982 3:153216912-153216934 TAGGGCTGGTAGGTGGAAGGAGG + Intergenic
964422298 3:156516388-156516410 AAAGCCTGGGAGTAGGAAGGAGG + Intronic
964556771 3:157948432-157948454 AAGGGCTGTTAGGAGGATCAAGG - Intergenic
964679674 3:159323811-159323833 AAAGGCTGATTGGAGGCTGTTGG + Intronic
965063955 3:163820123-163820145 ATAGGCTGGTAAGAGTATGGGGG + Intergenic
966148074 3:176834389-176834411 AAAGTCTGATAGGAGGAAGAGGG - Intergenic
966402538 3:179562669-179562691 GAAGGCTGGAAGAAGCATGGGGG - Intergenic
967265787 3:187691155-187691177 AGAGGTGGGCAGGAGGATGGAGG - Intergenic
967900040 3:194440509-194440531 GAAGGCTTGTTGGGGGATGGGGG - Intronic
968070075 3:195779273-195779295 AAAGGCTGGTGAGAGGAAGAGGG + Exonic
968070744 3:195782873-195782895 AAAGGCTGGTGAGAGGAAGAGGG + Exonic
968227974 3:196987779-196987801 AAAGGCAGGAAGTAGAATGGTGG + Intergenic
968548245 4:1209615-1209637 AGAGGCTGGTATTAGGCTGGAGG - Intergenic
968657554 4:1785252-1785274 AAAGGCTGCTGGGAGCAGGGAGG + Intergenic
969037968 4:4271151-4271173 AAAGGGTGGTGGGAGGCTGTGGG - Intronic
969135036 4:5022480-5022502 AAGAGCTGGTGGGAGGATGCAGG - Intergenic
969474123 4:7411617-7411639 AAAGGCAGGTAGGTGGATGGAGG - Intronic
969951992 4:10846543-10846565 GGAGGGTGGGAGGAGGATGGGGG + Intergenic
971100425 4:23460178-23460200 AAAGGCAGACAGTAGGATGGTGG - Intergenic
971263412 4:25077016-25077038 GAGGGCTGGAAGGAGGTTGGGGG - Intergenic
971581071 4:28341723-28341745 AAAGGCTGGAAGCAGGATTATGG + Intergenic
971663136 4:29446430-29446452 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
971934318 4:33128121-33128143 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
972261891 4:37416946-37416968 AAAGGGTGGGAGGGGGATGAAGG + Intronic
973012001 4:45087739-45087761 AAGGGCTGGTGGGATCATGGAGG + Intergenic
975050584 4:69859275-69859297 AAAGGCAGGTTGGAAGATGCAGG - Intronic
975099939 4:70501243-70501265 GAAGGGTGGTAGGAGAATGAGGG + Intergenic
975649305 4:76576501-76576523 GAAGGGTAGTAGGAGGCTGGTGG + Intronic
976015561 4:80548663-80548685 ACAGGGAGATAGGAGGATGGAGG - Intronic
976088115 4:81427159-81427181 AAAACCTTGTAGGAGGAGGGAGG + Exonic
976104853 4:81605729-81605751 AAAGCCTGAAATGAGGATGGGGG - Intronic
976191115 4:82488078-82488100 AAAGGATGGGAGGGGGATGAGGG - Intronic
976203864 4:82606271-82606293 AAAGGAAGTTAGGAGGCTGGTGG - Intergenic
976511939 4:85921384-85921406 AAAGGGTGGAAGGTGGAAGGAGG + Intronic
976512531 4:85928304-85928326 AAAGGAGGGAAGGAGGAGGGAGG - Intronic
976982932 4:91254502-91254524 AAAGGCTGGAAACAGAATGGTGG + Intronic
977027357 4:91835292-91835314 AGAGGGTGGGAGGAGGATGGGGG + Intergenic
978262947 4:106784071-106784093 AAAGGGTAGTGGGAGGATGAGGG + Intergenic
978414702 4:108463366-108463388 AAATGCTGGGAGGAGAAGGGTGG + Intergenic
979558251 4:122075542-122075564 CAAGGGTGGCAGGAGGAGGGTGG + Intergenic
980788417 4:137585326-137585348 ATATGCTTGTGGGAGGATGGGGG - Intergenic
982316316 4:154035752-154035774 AAAGGCTGGTTTAGGGATGGAGG - Intergenic
982455178 4:155601384-155601406 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
983580169 4:169301625-169301647 AGAGGTTGGGAGGGGGATGGAGG + Intergenic
985336970 4:188906161-188906183 AAAGGGAGGGAGGAGGAAGGAGG - Intergenic
985446203 4:190022327-190022349 AAAGGCTCGGAGGAGCAGGGCGG + Intergenic
985452169 4:190068251-190068273 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
985453153 4:190071548-190071570 AAAGGCTCGGAGGAGCAGGGCGG - Exonic
985454143 4:190074841-190074863 AAAGGCTCGGAGGAGCAGGGCGG - Exonic
985455131 4:190078134-190078156 AAAGGCTCGGAGGAGCAGGGCGG - Exonic
985456119 4:190081434-190081456 AAAGGCTCGGAGGAGCAGGGCGG - Exonic
985457103 4:190084728-190084750 AAAGGCTCGGAGGAGCAGGGCGG - Intergenic
985458090 4:190088021-190088043 AAAGGCTCGGAGGAGCAGGGCGG - Exonic
985459079 4:190091321-190091343 AAAGGCTCGGAGGAGCAGGGCGG - Exonic
985463332 4:190174090-190174112 AAAGGCTCGGAGGAGCAGGGCGG - Exonic
985786012 5:1895303-1895325 AAAGGCCTGTCGGGGGATGGGGG - Intergenic
985985304 5:3510752-3510774 CAGGGCTGGCAGCAGGATGGGGG + Intergenic
987868396 5:23576865-23576887 AAAGGCTGGCAGGGAGAGGGAGG - Intergenic
989031756 5:37126571-37126593 AAATGCTTGTGAGAGGATGGCGG - Intronic
989351658 5:40493796-40493818 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
990523447 5:56602182-56602204 AAAGGCAGGCAGGAGGAGAGGGG - Intronic
992444108 5:76819217-76819239 AGAGGCTGCTAGCAGGATGGCGG - Exonic
992496787 5:77301468-77301490 AGAGGCATGCAGGAGGATGGAGG + Intronic
993213873 5:84993879-84993901 GGAGGCTGGGAGGAGGATGAGGG - Intergenic
993276362 5:85864827-85864849 AAAGGCTGGTAAGGGTAGGGAGG + Intergenic
993657184 5:90592451-90592473 AAAGGGTGGTAGGAGGGTGAGGG + Intronic
993952764 5:94196604-94196626 AAAGGGTGGAAGGAGGATAAGGG - Intronic
994458861 5:100049016-100049038 AAGGGATAGGAGGAGGATGGGGG + Intergenic
994557844 5:101327381-101327403 AAAGGGTGGGAGGAGGGTGAGGG + Intergenic
996495682 5:124152466-124152488 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
997576054 5:134978142-134978164 AAAGGCTGGGAAGAGCAGGGGGG + Intronic
997749111 5:136327573-136327595 AAAGGAAGGTATGAGGATGGAGG + Intronic
997872721 5:137519424-137519446 AAAGTATGGTAGGTGAATGGTGG + Intronic
997921852 5:137988279-137988301 AGAGGCTGGTAGGATGCTGATGG + Exonic
998029482 5:138852731-138852753 AGAGGCGGGTAGAAGGAGGGAGG - Intronic
999242831 5:150137484-150137506 AAGGGATGGGAGGAGGAGGGGGG + Intronic
999319020 5:150601798-150601820 AAAGGAATGAAGGAGGATGGTGG - Intronic
999645315 5:153711828-153711850 AGAGGGTGCTAGGAGAATGGAGG + Intronic
999742265 5:154565332-154565354 AAAGGCTTGATGGAGGAGGGAGG + Intergenic
999910462 5:156192459-156192481 AAAGGCTGGGAAGTGTATGGGGG + Intronic
1000612969 5:163395435-163395457 AAGGGGTGGGAGGAGGGTGGAGG + Intergenic
1000996454 5:167964066-167964088 ATAGGCTGGGAGGAAGGTGGAGG - Intronic
1001514330 5:172344932-172344954 AAAGGCAGGAAGGAGGATGGAGG + Intronic
1001684053 5:173579370-173579392 GAAGGCTGGAATGAGGCTGGAGG + Intergenic
1001855566 5:175007598-175007620 AAAGGAGGGAAGAAGGATGGAGG - Intergenic
1001979329 5:176028040-176028062 AAAGGATGGGAGGGGGATGAGGG + Intronic
1002238087 5:177815721-177815743 AAAGGATGGGAGGGGGATGAGGG - Intergenic
1002380457 5:178824400-178824422 AAAGGATGGGAGGGGGATGAGGG + Intergenic
1002466970 5:179412721-179412743 GAAGGCCGGTAGGGGGATGGTGG - Intergenic
1002467000 5:179412790-179412812 GAAGGCCGGTAGGGGGATGGTGG - Intergenic
1002467009 5:179412812-179412834 GAAGGCCGGTAGGGGGATGGTGG - Intergenic
1003028613 6:2580528-2580550 GGAGGCAGGTGGGAGGATGGAGG - Intergenic
1003313379 6:4988113-4988135 AAAAGGTGATAGGAGGAGGGAGG - Intergenic
1004203624 6:13572461-13572483 CAGGGCTGGTATGTGGATGGCGG + Intergenic
1005058308 6:21751965-21751987 AAAAACTGGTAGGGGTATGGGGG - Intergenic
1005065024 6:21809290-21809312 AAAAGCTGGAGAGAGGATGGAGG - Intergenic
1005205535 6:23399276-23399298 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
1005365604 6:25073675-25073697 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
1006337983 6:33431093-33431115 ACAGGCTGGAAGGAGGGGGGTGG - Intronic
1006430362 6:33992191-33992213 AGAAGCTGGTAGGAGGATTTGGG - Intergenic
1006439127 6:34042446-34042468 GATGGCTGGGAGGAGGAAGGGGG + Intronic
1006615420 6:35322835-35322857 GAAGGCTGTTACAAGGATGGGGG - Intergenic
1006731131 6:36236860-36236882 TAAGGCTGGTTGGAAGAGGGTGG + Intergenic
1007340074 6:41185817-41185839 AAGGGCTGGAAGGAGGACAGAGG + Intergenic
1007387181 6:41528026-41528048 AAGGGCTGGTATGGGGGTGGAGG - Intergenic
1007398474 6:41590353-41590375 CAGGGCAGGTAGGAGGAGGGTGG + Intronic
1007690628 6:43699009-43699031 GAAGGCAGGGAGGGGGATGGGGG + Intergenic
1008110231 6:47484109-47484131 AAAAGCTGGGAGGAGTATGAGGG - Intronic
1008428985 6:51392586-51392608 AAAAGCTTGAAGGAGGATGGAGG - Intergenic
1010095370 6:72037124-72037146 AAAGGCGGTTTGGAGGTTGGGGG + Intronic
1011844620 6:91548069-91548091 AAGAGCTGGTTGGAAGATGGTGG + Intergenic
1012179419 6:96133077-96133099 AAAGGGTGGGAGGGGGATGAGGG - Intronic
1012319075 6:97820077-97820099 CAAGGATTGCAGGAGGATGGGGG - Intergenic
1013893161 6:115050780-115050802 AACGGATGGTTGGAGTATGGAGG + Intergenic
1014088565 6:117375291-117375313 AAAGGGTGGGAGGAGGGTGAGGG + Intronic
1014853387 6:126368929-126368951 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
1015293555 6:131564751-131564773 GAAGGGTAGTAGGAGGATGGGGG - Intergenic
1015895773 6:138015236-138015258 AAAGGGTGGTAAGGGGATGAGGG - Intergenic
1016351252 6:143171180-143171202 AAAGGGTGGGAGGTGGATGAGGG - Intronic
1016992961 6:149942373-149942395 GGAGGCTGGCAGGAGGGTGGAGG + Intronic
1017005374 6:150025149-150025171 CGAGGCTGGCAGGAGGGTGGAGG - Intronic
1017113020 6:150950273-150950295 TAGGGCTGGCAGGAGGATGGAGG - Intronic
1017846468 6:158262669-158262691 GAAGGCTGGAAGAAGGCTGGAGG + Intronic
1017891419 6:158642941-158642963 AAAGGCTGCTAAGAGGCTGGTGG + Intronic
1017935530 6:159001572-159001594 AAATTCTGTTAGGAGGATGTTGG + Intergenic
1017935984 6:159005614-159005636 AAAGGCTGGTAGGAATAGGAAGG - Intergenic
1018334950 6:162776931-162776953 AAAGGGTGGCAGGGGGATGAGGG + Intronic
1018964558 6:168474351-168474373 AAATGCTGGAAGGAGGAGCGGGG - Intronic
1018974235 6:168552822-168552844 ACAGGCTGGTGGGGGGGTGGGGG - Intronic
1019311846 7:366135-366157 AGAGGCTGGGAGGGGGATGGTGG - Intergenic
1019928458 7:4208278-4208300 CCAGGCCGGTAGGAGGAAGGCGG + Exonic
1020737036 7:11963712-11963734 CAAGGGTGGTAAGAGGAAGGAGG + Intergenic
1021239027 7:18178034-18178056 AAGGGGAGGTAGGGGGATGGAGG - Intronic
1022120196 7:27300656-27300678 AAGGCCTGCTAGGAGGAAGGCGG + Intergenic
1022403967 7:30069197-30069219 CAAGTCTGGCAGGAGGCTGGTGG - Intronic
1023581810 7:41691717-41691739 CCAGGCTGGCAGGAGGGTGGTGG - Intronic
1024000043 7:45183957-45183979 AAAGGCTGGGAGGAGAAGGGAGG + Exonic
1025929105 7:65980735-65980757 GAAGGCTGGTTGGAGGAATGGGG + Intronic
1026365685 7:69646019-69646041 AAATGCTGGAAGGAAGAAGGAGG + Intronic
1026486621 7:70827258-70827280 AGAGGGTGGAAGGAAGATGGGGG - Intergenic
1026518313 7:71092416-71092438 AAAGGCTGGGAGGAGGGAGAGGG + Intergenic
1028797611 7:94921879-94921901 AAAGGCTGGCTGGAAGATTGAGG + Intronic
1029194349 7:98794419-98794441 GTAGGGTGGTAGGAGGATAGAGG - Intergenic
1029535246 7:101154221-101154243 GTGGGCTGGTTGGAGGATGGGGG - Intergenic
1029931254 7:104373682-104373704 AAAGGCAGGTGGGAGGTGGGAGG + Intronic
1031056167 7:116995014-116995036 GAAGCCTGGTAGGAGATTGGGGG + Intronic
1031165642 7:118224385-118224407 AGAGGCTGGGAGTAGGTTGGAGG + Intronic
1031604829 7:123756149-123756171 AAAGGGTGGAAGGTGGCTGGTGG - Intergenic
1033414033 7:141146784-141146806 AAAGGATGGTAGAAGGATTATGG - Intronic
1033771279 7:144555445-144555467 TAAGACTGGCAGGAGAATGGAGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034301720 7:150021609-150021631 GAAGGCTGGGAGGGGGATGAAGG - Intergenic
1034550085 7:151814923-151814945 AAAGACAGGCAGCAGGATGGAGG + Intronic
1034804326 7:154075658-154075680 GAAGGCTGGGAGGGGGATGAAGG + Intronic
1035047263 7:155975811-155975833 AAGGTTTGGTAGTAGGATGGTGG + Intergenic
1035858190 8:2999608-2999630 AAAAGCTGATAGTAGGAGGGTGG - Intronic
1037707279 8:21325961-21325983 AAATCCTGGAAGGAGGATAGAGG - Intergenic
1037868278 8:22465990-22466012 TGGGGCTGGTCGGAGGATGGGGG - Intronic
1038154585 8:24976660-24976682 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
1038238786 8:25788338-25788360 TGAGGATGGGAGGAGGATGGAGG + Intergenic
1038559275 8:28556983-28557005 AAAGGCTTCTAGGAGAATGGTGG + Intronic
1038818067 8:30926568-30926590 GAAGGTTGGTAGCAGGAAGGAGG + Intergenic
1040897556 8:52384635-52384657 ACAGGCTGTTAGGAGGGCGGGGG - Intronic
1041419196 8:57647580-57647602 AAATGCTGTTTGGAGGATTGTGG - Intergenic
1041952338 8:63517622-63517644 AAAGGCAGGTAGGAGGTGAGAGG + Intergenic
1042144447 8:65713519-65713541 AAAGTCTGATAGGATGGTGGGGG - Intronic
1042646954 8:70997614-70997636 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
1044332190 8:90933578-90933600 AAAGGGTGGTAGGGAGATGAGGG + Intronic
1045160275 8:99533905-99533927 AAAAGTTGGGAGGAGGAAGGAGG - Intronic
1045415363 8:101960963-101960985 ACAGGCTGTTATGATGATGGTGG - Intronic
1047683856 8:127283592-127283614 AAAGACTGGAATGTGGATGGAGG + Intergenic
1048581308 8:135731717-135731739 AAAGGGTGGGAGGAGGAGGAAGG + Intergenic
1048931731 8:139320733-139320755 ACCGGCTGACAGGAGGATGGAGG + Intergenic
1049257600 8:141622293-141622315 AAGGGCTGGGAGGAAGCTGGAGG - Intergenic
1049321270 8:141997823-141997845 AAGGGCAGGTGGGTGGATGGTGG - Intergenic
1050734188 9:8744648-8744670 AAAGGCTGGCAGCAGGGTGAGGG + Intronic
1050952131 9:11610837-11610859 AATGGCTGATATTAGGATGGTGG + Intergenic
1051599338 9:18856880-18856902 AAAAGCTGGTTGGAGAAAGGGGG + Intronic
1051604464 9:18906675-18906697 ACAGGCCTGCAGGAGGATGGTGG - Exonic
1051870769 9:21735246-21735268 AAAGCCAGTTTGGAGGATGGTGG + Intergenic
1051966765 9:22837015-22837037 AGTGGCTGGTGGGAGGATGGAGG + Intergenic
1052485374 9:29091518-29091540 AAAGGCTCCTAGGAGCATGTTGG - Intergenic
1052564336 9:30128419-30128441 AAAGGGTGGGAAGGGGATGGGGG - Intergenic
1053367744 9:37535687-37535709 AAAGGCTGGCAGGAGGAGCCTGG - Intronic
1053411859 9:37920972-37920994 AAATGCTGGTGGGAGGACTGTGG - Intronic
1053666420 9:40321034-40321056 GTAGGGTGGTAGGAGGATGGGGG + Intronic
1053916006 9:42946080-42946102 GTAGGGTGGTAGGAGGGTGGGGG + Intergenic
1054377572 9:64461062-64461084 GTAGGGTGGTAGGAGGATAGGGG + Intergenic
1054518189 9:66055249-66055271 GTAGGGTGGTAGGAGGATGGGGG - Intergenic
1054985004 9:71251844-71251866 AGAGGATGGTGGGAGGGTGGGGG - Intronic
1055873085 9:80908405-80908427 AAAAGCAGATAGTAGGATGGTGG - Intergenic
1056890645 9:90488691-90488713 AAAGGAGGGTAAGGGGATGGAGG + Intergenic
1057988030 9:99737544-99737566 AGAGTGTGGTAGGAGAATGGAGG - Intergenic
1058087914 9:100770213-100770235 AAAGGATGGAAGGGGGATGAGGG - Intergenic
1058793360 9:108472927-108472949 AAAGGCTGTCAGGAGGAAGCTGG + Intergenic
1059332520 9:113544671-113544693 CAAGGCTGCTGGGAGGCTGGGGG - Intronic
1059365951 9:113786574-113786596 AAAGGCAGGAAAGAGGCTGGTGG + Intergenic
1059489731 9:114657232-114657254 GCAGGCTGTTAGGAGGATGAAGG - Intergenic
1060081728 9:120653796-120653818 AAAGACTGGAAGGAGCATGGAGG + Intronic
1060122895 9:121011964-121011986 GAAGGGTAGTAGGAGGATGAGGG + Intronic
1060201068 9:121651977-121651999 AATGGCTGGAAGGAGGATCCCGG - Intronic
1060769518 9:126321778-126321800 AATGGCTGAGAGGAGGATGGAGG + Intergenic
1060816737 9:126639089-126639111 AGAGGCTGGTAGGAGAAGAGGGG + Intronic
1061573060 9:131489596-131489618 AAAAGCTGCTAGGAGGGTGGGGG - Intronic
1061656484 9:132095199-132095221 AAAGGATGGGAGGGGGATGAGGG - Intergenic
1061848271 9:133400316-133400338 AGAGGCTGGTAGGAGCCTGCAGG - Intronic
1062146346 9:134991923-134991945 AAGGGGTGGTGGGGGGATGGGGG - Intergenic
1062282337 9:135757623-135757645 AATGGCTGGCAGGAGGAGGAGGG + Intronic
1062607770 9:137355690-137355712 AAAGGGAGGAAGGAGGAAGGAGG + Intronic
1203733322 Un_GL000216v2:111178-111200 AAAGGGTGGGAGGGGGATGAGGG + Intergenic
1203618730 Un_KI270749v1:97253-97275 AAAGGGTGGGAGGAGGTTGAGGG + Intergenic
1186080420 X:5924856-5924878 AAAGGGTGGGAGGGGGTTGGGGG + Intronic
1186171342 X:6880243-6880265 AAATGCTGGGAGGGGGATGAGGG - Intergenic
1186402606 X:9273637-9273659 GAAGGCAGGAAGGAGGAAGGAGG + Intergenic
1187045792 X:15646789-15646811 ACAGGCTGGTGGGGGGGTGGCGG - Intronic
1187409932 X:19042344-19042366 AAAGGCGGGGAGCAGGATGAAGG + Intronic
1187415037 X:19086129-19086151 AAAGGCTGGTGGGTGTGTGGTGG - Intronic
1187614151 X:20974924-20974946 CAAGGCTGTTAAGAGGATTGAGG + Intergenic
1187643113 X:21316456-21316478 AAATGATGGTAGAAAGATGGTGG + Intergenic
1188013025 X:25077504-25077526 AAAGGCTGGAAGAATGATGTGGG + Intergenic
1188649001 X:32606992-32607014 ATAGGCTGGTAGGGGGGTGAGGG + Intronic
1188729679 X:33631170-33631192 TAATGCTGCTAGGGGGATGGGGG + Intergenic
1188963696 X:36524767-36524789 AGATGTTGGTAAGAGGATGGAGG - Intergenic
1189104877 X:38225187-38225209 AAAGTCTGGCAGGAGGAGGGAGG + Intronic
1189398539 X:40645080-40645102 AAAGGCAGGCAGGAGGACAGAGG + Intronic
1189599809 X:42611907-42611929 AAAGGGTGGGAGGAGGGTGAGGG - Intergenic
1189754952 X:44261558-44261580 AAAGACTGGGGTGAGGATGGGGG + Intronic
1192442030 X:71181754-71181776 AAAGGATGGGAGGAGGGTGGGGG - Intergenic
1193119377 X:77807492-77807514 AAAGGATGGGAGAGGGATGGGGG - Intergenic
1193221021 X:78927199-78927221 AAAGGGTGGGAAGAGGATGATGG + Intergenic
1193227871 X:79007173-79007195 AAAGGGAGGTAGGAGGGAGGGGG + Intergenic
1194013978 X:88597065-88597087 AAAGGTTGGGAGGAGGATGAGGG - Intergenic
1194798981 X:98247916-98247938 CAAGGCTGGTATGAAGATGATGG + Intergenic
1195969553 X:110458403-110458425 AGAGGATGGTAGAAGGATGAAGG - Intergenic
1196321260 X:114342669-114342691 AAAGTATGGTAAGAGGATGCTGG + Intergenic
1197211206 X:123829705-123829727 AAAAGTAGGTAGGAAGATGGAGG - Intergenic
1197316398 X:124971319-124971341 ACAGGCTGGTAGGATTATGGGGG - Intergenic
1197626247 X:128805202-128805224 AAAAGCTGGTGGCAGGATGGGGG + Intergenic
1197758788 X:130013878-130013900 AAAGGCGGGGATGAGGGTGGGGG - Exonic
1199020554 X:142872325-142872347 ACAGGCTGAGAGCAGGATGGAGG + Intergenic
1200284758 X:154809662-154809684 AAAGGGTGGGAGGGGGATGAGGG + Intronic
1201179627 Y:11332647-11332669 AAAGGCTCGGAGGAGTAGGGCGG - Intergenic
1202627688 Y:56877247-56877269 AAAGGGTGGGAGGGGGATGAGGG - Intergenic