ID: 914784462

View in Genome Browser
Species Human (GRCh38)
Location 1:150816114-150816136
Sequence CTCTCAACAAAGATGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914784460_914784462 29 Left 914784460 1:150816062-150816084 CCACAGACTCTACTGAGATTTTT 0: 1
1: 0
2: 6
3: 38
4: 309
Right 914784462 1:150816114-150816136 CTCTCAACAAAGATGGAAATTGG 0: 1
1: 0
2: 3
3: 20
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914784462 Original CRISPR CTCTCAACAAAGATGGAAAT TGG Intronic
907851761 1:58261491-58261513 CTCTCAAGAGAGAAGGAAAATGG + Intronic
908652929 1:66355895-66355917 GTCTTAGCAAAGATGGAAGTAGG - Intronic
908687885 1:66742412-66742434 CTCTCAAAAATGATCCAAATTGG + Intronic
910818806 1:91323104-91323126 CTTTGAACAAAGATCCAAATCGG - Exonic
914784462 1:150816114-150816136 CTCTCAACAAAGATGGAAATTGG + Intronic
915696412 1:157747255-157747277 CTCACTACATAGAAGGAAATTGG + Intronic
916198806 1:162250341-162250363 CTCTAAAAAAGGATGGAGATAGG + Intronic
918413591 1:184285383-184285405 CTGTCCACAAAGTTGGAATTTGG + Intergenic
921222786 1:212985364-212985386 AGCTCAACAGAGGTGGAAATGGG + Intronic
922493241 1:226035669-226035691 CTCTGAACAAAGCTGGATAATGG - Intergenic
922694865 1:227724823-227724845 CTATCCATAAAAATGGAAATAGG + Intergenic
923308714 1:232712963-232712985 CTATCATAAAAGATGGAATTTGG + Intergenic
923532349 1:234821454-234821476 CTCTCAACAAAGATAGGCAGAGG - Intergenic
1063940587 10:11124403-11124425 TTCCTAATAAAGATGGAAATGGG + Intronic
1065203342 10:23334886-23334908 CTTTCAAAAAAGATGGAAATAGG + Intronic
1067179701 10:43975315-43975337 GTGTCAATAAAGATGGAAAATGG + Intergenic
1067267033 10:44755390-44755412 CCCCCAATAAAGATGGTAATAGG - Intergenic
1067559687 10:47296198-47296220 CTCTGAGCAAACATGGGAATTGG - Intergenic
1072007144 10:91263011-91263033 CTATAAACAAAGATGGAAGGGGG + Intronic
1072118528 10:92386161-92386183 CTCTCAACAAGGAGGGGCATCGG + Intergenic
1074471585 10:113732040-113732062 TTCTCAACAACGATGAGAATTGG - Intergenic
1075763278 10:124872655-124872677 CTGTCAACAAAGCTGGGACTTGG + Intergenic
1075934203 10:126325626-126325648 CACTCAAGGAAGCTGGAAATTGG + Intronic
1076102405 10:127793615-127793637 CTCTAAACAAGCAGGGAAATAGG + Intergenic
1077886001 11:6388558-6388580 CTCACAACAAATTTGGAAGTCGG - Intergenic
1078011523 11:7576397-7576419 CTCTCAAAGGAGATGGGAATAGG + Intronic
1079783903 11:24645957-24645979 TTCTGAACAATGATAGAAATAGG + Intronic
1079825466 11:25185816-25185838 CCATCAAAAAAGATGGAAAAAGG - Intergenic
1079901439 11:26191538-26191560 TAGTGAACAAAGATGGAAATGGG - Intergenic
1081196745 11:40170414-40170436 CTTTCACCAAAGATGTAATTTGG - Intronic
1081239934 11:40692720-40692742 CAATCAACAAAGAAGGAAAAAGG - Intronic
1085028519 11:73255198-73255220 TTATCAACAAAGATTGATATAGG - Intergenic
1085547622 11:77334550-77334572 ATCTCAACACAGGTGCAAATAGG - Intronic
1088129450 11:106470021-106470043 CTTTCAACAAACATGAAAAATGG + Intergenic
1088515951 11:110634027-110634049 CTATGAACAAAGATGGAGACTGG + Intronic
1089645362 11:119875422-119875444 TTCTCAACAAACCTGGAAATAGG - Intergenic
1094285612 12:28789734-28789756 CACTGAACTAAGATGGAACTGGG + Intergenic
1095380738 12:41588340-41588362 ATCTGAAGAAATATGGAAATTGG - Intergenic
1097889523 12:64763375-64763397 ATCTCAATAAAGCTGGAAAGAGG - Intergenic
1100915432 12:99415684-99415706 CTCTCAAAAAAAAGGGCAATGGG - Intronic
1103752691 12:123176648-123176670 CTCTCTATAAAGCTAGAAATAGG - Intronic
1104216244 12:126736524-126736546 CTCTCTACAATGATGGAGAATGG - Intergenic
1105319422 13:19304050-19304072 CTCCCAACAAAAATGTAAACAGG + Intergenic
1105772021 13:23620928-23620950 CTCTTAACAAAGAGGGAAACTGG + Intronic
1108367636 13:49731763-49731785 CACTAAACAAAAATGGAAATAGG + Intronic
1108871570 13:54993348-54993370 CTTTGAATAAACATGGAAATTGG + Intergenic
1110221867 13:73082376-73082398 ATCTAACCAAAGATGGAATTTGG - Intergenic
1111433485 13:88176209-88176231 CTCTCAGCAAAGAAAGAACTGGG + Intergenic
1111610412 13:90599479-90599501 CTCTCTCAAAAGATGGAAAGTGG + Intergenic
1112960722 13:105121935-105121957 TTCTCAACAACGATGGTAACAGG + Intergenic
1114558990 14:23577791-23577813 CGCTCCACAAAGACAGAAATGGG - Intronic
1114866456 14:26599689-26599711 CTCCCAATAATGGTGGAAATTGG - Intergenic
1117095724 14:52295482-52295504 CTGTCAATAATTATGGAAATGGG + Intergenic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1119940504 14:78636060-78636082 CGCTCAACAAATATTGAAATAGG - Intronic
1123010035 14:105345104-105345126 ATCTCAAAAAAGATGGAATCTGG + Intronic
1125522122 15:40354157-40354179 CTCTCAGCAAAGATACATATTGG - Intronic
1127294328 15:57596509-57596531 CACTCACCAAAGAGGGAAAGAGG - Intronic
1127757813 15:62110357-62110379 CTCTCAATAAACATGGAGAGGGG + Intergenic
1129133421 15:73522339-73522361 ATCTCAATAAAGATGGAAAAAGG - Intronic
1133134071 16:3697269-3697291 CCCTTAACAAAAAAGGAAATAGG - Intronic
1134088642 16:11376594-11376616 CTTTCAACAAATTTTGAAATTGG + Intronic
1134533681 16:15006384-15006406 CTCTTAACAGATATGAAAATGGG + Exonic
1135009318 16:18860213-18860235 GTCTCAACAAAAAAGAAAATCGG + Intronic
1135316356 16:21449123-21449145 GTCTCAACAAAAAAGAAAATCGG + Intergenic
1135369279 16:21881380-21881402 GTCTCAACAAAAAAGAAAATCGG + Intergenic
1135442535 16:22489759-22489781 GTCTCAACAAAAAAGAAAATCGG - Intronic
1136326470 16:29529609-29529631 GTCTCAACAAAAAAGAAAATCGG + Intergenic
1136441160 16:30269594-30269616 GTCTCAACAAAAAAGAAAATCGG + Intergenic
1139125643 16:64073058-64073080 CTCTAAACAAAGGTGGAGAAAGG - Intergenic
1139268248 16:65659473-65659495 CTCCCAACCAAGAAGGAAACAGG - Intergenic
1139862351 16:70034348-70034370 CTCTTAACAGATATGAAAATGGG - Intergenic
1140100836 16:71915186-71915208 ATCTCAACAGGGATGGCAATGGG - Intronic
1141550218 16:84801943-84801965 CTCTCAAAAAAAAAAGAAATAGG + Intergenic
1143085356 17:4412129-4412151 CACACATCAAAGGTGGAAATGGG - Intergenic
1149173800 17:53845116-53845138 CTCTCAACAGAGAGGGAAATGGG + Intergenic
1149484897 17:57034926-57034948 CTCTCAACCAAGCTGAAAAGGGG + Intergenic
1149980112 17:61304019-61304041 CTATCAACAAAACTAGAAATGGG + Intronic
1150162332 17:62908950-62908972 CTCTCAACAGAGAGTGAATTAGG + Intergenic
1151076141 17:71274784-71274806 CACTCAACCATGGTGGAAATGGG - Intergenic
1152976381 18:224276-224298 CTCTTAAAAAAGATGAAAACTGG + Intronic
1155737489 18:29242122-29242144 ATCTTAACCAAGAGGGAAATAGG - Intergenic
1155958486 18:31974178-31974200 CACTGAACAAAGAAGGGAATGGG + Intergenic
1156993714 18:43440538-43440560 CTCTCAGCAAAGAGGGGACTTGG - Intergenic
1160109640 18:76014046-76014068 CTCAAAACAGAGATGGAAACTGG + Intergenic
1160900346 19:1424771-1424793 CACAGAACAAAGATGGACATGGG - Intronic
1162051617 19:8037426-8037448 GTCTCAAAAAAGAAGGAAAGAGG - Intronic
1163137125 19:15320061-15320083 CTCTCCACAAAAATGCACATAGG - Intronic
1163358499 19:16830042-16830064 CTCGTAACAAAAATGGAAATGGG + Intronic
1166913807 19:46180107-46180129 CTCTCAATCAAGATGGAGTTAGG - Intergenic
1167283314 19:48584185-48584207 CTCCCAAGAAAGAAAGAAATTGG + Intronic
1167646536 19:50708802-50708824 CACTCAACAAAGATGGAACTAGG + Intronic
926707181 2:15845177-15845199 CTCTGAACAAAGCTGGTGATGGG + Intergenic
927200636 2:20575972-20575994 AACAAAACAAAGATGGAAATGGG - Intronic
929205718 2:39290222-39290244 CTCTCAACAAAGTATTAAATTGG + Intronic
931492268 2:62761216-62761238 CTGTCAACAGACATGGAAATAGG + Intronic
933249375 2:80011759-80011781 CTTTCAACAAATATGGATTTAGG + Intronic
934679418 2:96272010-96272032 TTCTCAACAGGGATGCAAATTGG + Intronic
935309214 2:101766570-101766592 ATCTGAATAAAGCTGGAAATTGG - Intronic
936735483 2:115437346-115437368 CTCTCTATAAAGTTAGAAATAGG - Intronic
937182593 2:120009988-120010010 CTCCTATCAAAGATGGAACTGGG - Intergenic
938254051 2:129840354-129840376 CACTCAACAAAGATTGAAAGTGG + Intergenic
938757979 2:134398024-134398046 TTCCCCACAAATATGGAAATCGG - Intronic
939393172 2:141594185-141594207 CTCTCAGCAAAGAAGGAAACTGG - Intronic
945401128 2:209384587-209384609 CTCTGAATAAAGATGAATATAGG + Intergenic
946028131 2:216684588-216684610 CTCTCTACAAAGAATGAAAAAGG + Intronic
946502539 2:220264903-220264925 CTCAAAAGAAAGATTGAAATTGG - Intergenic
946824787 2:223666287-223666309 CTCTCAACAGTGAGGAAAATAGG - Intergenic
946897060 2:224334712-224334734 CTCTCCGCAAAGATGACAATAGG - Intergenic
948717312 2:239873589-239873611 CTCTTAAGAGAGATGGAAATTGG - Intergenic
948736528 2:240011107-240011129 CTTTCAACAAAGAAAGAAAGGGG + Intronic
1169308766 20:4517551-4517573 CCCTCAACACAGCAGGAAATGGG + Intergenic
1169706228 20:8508108-8508130 GTCTGAACAAAGGTGAAAATTGG + Intronic
1170979467 20:21197679-21197701 CTCTCAACAAAGACATAAAATGG - Intronic
1172488725 20:35316936-35316958 GTCTCAAAAAAAAAGGAAATGGG - Intronic
1173101155 20:40090209-40090231 ATCACAACAAAGGTGGCAATAGG + Intergenic
1176025759 20:62984802-62984824 CACTCAACAAAGCTGGATCTTGG + Intergenic
1177935665 21:27342608-27342630 CTTTCAGCAAAGGTTGAAATTGG - Intergenic
1179006947 21:37523419-37523441 CCCTGAACAAAGGTGGAAGTAGG + Intergenic
1179022205 21:37650476-37650498 CTCTCAACAAAGACGGCAACTGG + Intronic
1179880426 21:44291301-44291323 CTCCCATCCAAGATGGAAAGGGG + Intronic
1181396307 22:22625257-22625279 GTCTCAAAAAAAATGGAATTAGG - Intergenic
1183822369 22:40356839-40356861 GTCTCAAAAAAGAAAGAAATTGG + Intronic
1183895561 22:40965764-40965786 GTCCCAACAAAGATGGAAGAAGG - Intronic
949194334 3:1287445-1287467 CACCCATAAAAGATGGAAATTGG + Intronic
949601529 3:5603892-5603914 CTCTCAACAATGTAGGCAATGGG + Intergenic
950667421 3:14505849-14505871 CACTCAGCACAGCTGGAAATGGG - Intronic
951575940 3:24114189-24114211 CTCCAAACAAATATGGAAGTAGG - Intergenic
953361997 3:42305455-42305477 CTCTAAACAATGAAGCAAATTGG + Intergenic
953782120 3:45880497-45880519 ATCTCAAAAAAAAAGGAAATCGG + Intronic
953823369 3:46229399-46229421 TTCTTAACAAATATAGAAATTGG + Intronic
955238586 3:57161060-57161082 TGCTCAAGAAAGATGGACATGGG + Intronic
956092439 3:65682268-65682290 CTCCCTACAAAGAAGGAAGTGGG + Intronic
957855517 3:85871759-85871781 GTCTCATCAAAGATGGATATAGG - Intronic
959295269 3:104527580-104527602 CTCTCCAAAAATTTGGAAATTGG - Intergenic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
962017922 3:131462186-131462208 CTCCCAACAAAAATGTAAACAGG + Intergenic
962383057 3:134912387-134912409 CTCACCACAAAAATGCAAATAGG + Intronic
962595654 3:136940930-136940952 ATCCAAACAAAGATGCAAATAGG - Intronic
964462350 3:156948290-156948312 CTATCAACAAAAATTGAAATAGG - Intronic
967144409 3:186594295-186594317 GTCTTAACAGAGATGCAAATTGG - Intronic
967665901 3:192171851-192171873 CTCTCTACAAATAAGGAGATTGG - Intronic
967858778 3:194136699-194136721 CTCTGAAGAAAGATGTAAGTGGG + Exonic
969951791 4:10844332-10844354 CTCTCAAGACAAATGGAAAAGGG + Intergenic
970151005 4:13089917-13089939 CTCTCAACAAAAATGCAATATGG - Intergenic
971409719 4:26357430-26357452 CACTTAACGAAGATAGAAATAGG + Intronic
973920716 4:55682168-55682190 CTCTCAGCAAAGGTGGGAATGGG - Intergenic
975188709 4:71434568-71434590 CTCTCAATTATGATGGAAACTGG + Intronic
975917731 4:79344743-79344765 CTCTAAAAAAACATGCAAATGGG - Intergenic
976810996 4:89101115-89101137 CTCTAAAGAATGTTGGAAATTGG + Intronic
979467236 4:121054830-121054852 GTCTCAAAAAAGTTGGCAATGGG - Intronic
980599410 4:135000388-135000410 TTCTCAACAAAGATGTGTATAGG + Intergenic
981145342 4:141317499-141317521 CACTCACCAAAAATGGAAAGAGG - Intergenic
981272826 4:142864702-142864724 CTCTAATCAAAAATGGAAAATGG - Intergenic
982599861 4:157434865-157434887 CTCTGAGCAAAGATAGAAATTGG + Intergenic
985225584 4:187757847-187757869 CACTCAAGAAAGAAGAAAATGGG - Intergenic
986500488 5:8393506-8393528 CTTTCCACCAGGATGGAAATTGG - Intergenic
987441254 5:17959853-17959875 AACTAAACAAAAATGGAAATGGG + Intergenic
992936208 5:81708228-81708250 CTCTCTACAGAAAAGGAAATAGG + Intronic
993265070 5:85716238-85716260 CTCAAAACACAGATGGAAACAGG - Intergenic
993509644 5:88755616-88755638 CTCTAAGCAAATATGGAAAAGGG - Intronic
993815110 5:92533985-92534007 CCCTCATCAGAGATGGATATTGG - Intergenic
995095204 5:108227972-108227994 CTCTCCTCGAAGATGGATATAGG - Intronic
996000520 5:118356372-118356394 CTCTCAACAGAGATGTATTTGGG - Intergenic
996692628 5:126356901-126356923 CTCTTACCAAGGAAGGAAATAGG - Intergenic
998853236 5:146370924-146370946 CCCTCAAAGAAGGTGGAAATTGG + Intergenic
999554381 5:152723977-152723999 CTATAAACAAAAATGTAAATTGG + Intergenic
1001208697 5:169789850-169789872 CTATAAATAAAAATGGAAATGGG - Intronic
1004738183 6:18429195-18429217 CTCTTAAAAAAAATGGGAATGGG + Intronic
1006818534 6:36871223-36871245 CTCTCAATAAAGCAGGAAAAGGG - Intronic
1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG + Intronic
1007215206 6:40231950-40231972 CTCACAAAGAAGATGGAAAAGGG + Intergenic
1009292727 6:61904247-61904269 CTCTGAGCAAAGATTTAAATGGG - Intronic
1009767264 6:68095928-68095950 TTTTCAACAAAGATAGTAATAGG + Intergenic
1010490201 6:76466550-76466572 CTCTCAGCAAAGAGGGGATTTGG - Intergenic
1013019377 6:106197478-106197500 TTATCACCAAAGTTGGAAATGGG + Intronic
1014741004 6:125147551-125147573 TTCTCAGGAAACATGGAAATTGG - Intronic
1015279227 6:131415300-131415322 CTCTCACCAAAGAAAGAAATGGG - Intergenic
1016713075 6:147195587-147195609 ATCACAACAAAAATGGAAAGAGG + Intergenic
1017239602 6:152152341-152152363 CTATCAAAAAATATGAAAATGGG + Intronic
1017620045 6:156287252-156287274 CTCTCAACAATGAAGCACATGGG + Intergenic
1020096430 7:5371897-5371919 GTCTCAAAAAAAAAGGAAATGGG - Intronic
1020941868 7:14549575-14549597 CGCTCAACAAAGTTTAAAATGGG - Intronic
1024428955 7:49263257-49263279 CTCTCATCAAAGAATGAATTGGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026434167 7:70379709-70379731 CTCTCAACAAGGAAGTAAAGGGG + Intronic
1027261347 7:76466896-76466918 CTCTAAAAAAAGAAAGAAATAGG - Intronic
1027312730 7:76965005-76965027 CTCTAAAAAAAGAAAGAAATAGG - Intergenic
1028740996 7:94275120-94275142 CTATCAAAAAATATGAAAATGGG - Intergenic
1030427888 7:109403156-109403178 TTCTCAACTAACATGCAAATAGG - Intergenic
1030733145 7:113013952-113013974 CAGTCTACAAAGATTGAAATAGG - Intergenic
1031906945 7:127470963-127470985 GTCTCTACAAAGCTGGAAGTGGG + Intergenic
1031925698 7:127636191-127636213 CTCACAAAAAAGATTGTAATTGG - Intergenic
1032588714 7:133172582-133172604 CTCTCCTCAAAGATTTAAATGGG - Intergenic
1035252548 7:157606543-157606565 TTCTCAGAAAAGATGGAAATTGG - Intronic
1035966103 8:4193677-4193699 AGCTCAACAAAGATAAAAATCGG + Intronic
1038581336 8:28751674-28751696 CTCTCAAACAAGAGAGAAATGGG - Exonic
1038777456 8:30543852-30543874 CACTCCACAAAGATGTAAACAGG - Intronic
1039186571 8:34923820-34923842 CTTCCAACATATATGGAAATGGG - Intergenic
1039597609 8:38805005-38805027 CTCTCAAGAAATAGGGAAATAGG - Intronic
1042426557 8:68655847-68655869 CATTCTAGAAAGATGGAAATAGG - Intronic
1042441890 8:68838347-68838369 CTCTAAACAAAGAGAGAAAATGG - Intergenic
1044304958 8:90628373-90628395 CTGACAATAAAGATGGAAACAGG + Intronic
1044608449 8:94068376-94068398 GTCTTAAAAAAGAAGGAAATCGG - Intergenic
1044997743 8:97853336-97853358 CACCCAAGAAAGATGGAAACTGG + Intergenic
1046020715 8:108661490-108661512 CTTTCAAAGAAAATGGAAATTGG + Intronic
1046745905 8:117875694-117875716 CTCTCCCCAAAGATGGTACTTGG - Intronic
1048148167 8:131865773-131865795 TTCTCAAAAAGCATGGAAATTGG + Intergenic
1049004679 8:139847324-139847346 CCCTCAGCCAGGATGGAAATTGG - Intronic
1049947764 9:614352-614374 CACTCCTCAAAGATGGAAATGGG - Intronic
1055891316 9:81127012-81127034 GTCTCCACAAAAATGGAACTGGG - Intergenic
1057513791 9:95703799-95703821 CTCCCCACAAAGCTGAAAATCGG - Intergenic
1060199861 9:121646120-121646142 CTCTCAACACAGGCGGAAGTGGG - Intronic
1186142836 X:6595080-6595102 CTGTCAAAAAAAATGGAATTGGG + Intergenic
1188391028 X:29619527-29619549 CACTCAAAAAAGATGCAGATGGG - Intronic
1191699942 X:64031062-64031084 CTCCCAAAAAAGGTGAAAATTGG + Intergenic
1192595859 X:72407548-72407570 CTCACAACAATAAGGGAAATAGG + Intronic
1193963159 X:87949934-87949956 ATCTCAAGACAAATGGAAATAGG + Intergenic
1194866078 X:99069410-99069432 TTCTCTACTAAGGTGGAAATGGG + Intergenic
1195205563 X:102596519-102596541 CTCTTAACAAATAGAGAAATTGG + Intergenic
1196069632 X:111506403-111506425 CTCACAACAATGAAGAAAATGGG - Intergenic
1196485778 X:116204990-116205012 CTCTCAAAAAAGCTGGAACTCGG - Intergenic
1197881478 X:131171220-131171242 GTCTCTACAAAGATGTAAAGAGG - Intergenic
1198731588 X:139736260-139736282 CTCTCAAAAAAGTTAGACATTGG - Intronic
1201219412 Y:11753725-11753747 CTCTCATCAAAGGAGGACATAGG - Intergenic
1201940276 Y:19451398-19451420 CTCTAAACAAAAATGTAGATTGG + Intergenic