ID: 914787409

View in Genome Browser
Species Human (GRCh38)
Location 1:150847133-150847155
Sequence CAGAAAAAGAAGGGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1377
Summary {0: 1, 1: 0, 2: 11, 3: 117, 4: 1248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914787401_914787409 4 Left 914787401 1:150847106-150847128 CCTTCGATTATTTTGTATATATA 0: 1
1: 0
2: 5
3: 34
4: 492
Right 914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG 0: 1
1: 0
2: 11
3: 117
4: 1248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914787409 Original CRISPR CAGAAAAAGAAGGGGGAGGC TGG Intronic
900077848 1:832535-832557 AAGAAAAAAAAGAGGGAGGAAGG - Intergenic
900090306 1:917345-917367 CAGAAAAGGAGGGGGCAGGTGGG - Intergenic
900253832 1:1686297-1686319 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
900262831 1:1741077-1741099 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900623406 1:3597434-3597456 CAGAACAAGCAGCGGGAGACAGG - Intronic
900822036 1:4897209-4897231 CAGAAGCAGGAGGGAGAGGCGGG + Intergenic
900994797 1:6115015-6115037 AAAAAAAAAAAGGGGGGGGCAGG + Intronic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901377276 1:8848389-8848411 CAGAAATCAAAGTGGGAGGCCGG + Intergenic
901441933 1:9283280-9283302 AAGAAAAGGAAGGGGGTGACAGG + Intergenic
901751728 1:11414211-11414233 CAGACAAAGCAGGGTGAGGAGGG - Intergenic
901788264 1:11638897-11638919 AAAAAAAGGAAGGGGGAAGCCGG - Intergenic
901848470 1:11999796-11999818 CAAAAAAATAAAGGGTAGGCCGG + Intronic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
902264981 1:15256826-15256848 CAGAAACTGCAGGGGGATGCAGG + Intronic
902441851 1:16435611-16435633 AAAAAAAAAAAGGGGGGGGCCGG - Intronic
902793939 1:18788029-18788051 GAGGAAGAGAAGGGGGAGGGAGG + Intergenic
902949835 1:19873672-19873694 CAGAAAGAGACAGGGGAGGCTGG + Intergenic
902964192 1:19986250-19986272 TAAATAAGGAAGGGGGAGGCTGG - Intergenic
903116607 1:21183497-21183519 GAGAAAAAAAAGGAGGTGGCGGG + Intergenic
903175139 1:21576071-21576093 GAGAAAATGCAGGGTGAGGCAGG + Intronic
903228333 1:21906474-21906496 AAGAAGAGGAAGGGGCAGGCAGG + Intronic
903428260 1:23270924-23270946 CAAAAAAAAAAGGGGGGGCCGGG - Intergenic
903545940 1:24123442-24123464 CAGAGAAGGAAGCGTGAGGCTGG + Intronic
903644521 1:24886522-24886544 CAGAAAGAGGAGGGAGTGGCTGG - Intergenic
904016616 1:27426331-27426353 CAGAGAAAGAAGGTAGAGGGAGG + Intronic
904049027 1:27626868-27626890 TACAAAAACAAGGGTGAGGCCGG + Intronic
904285056 1:29448698-29448720 GAGGCAGAGAAGGGGGAGGCTGG - Intergenic
904329576 1:29749507-29749529 CAGAGAAAGCAGGGTGAGGGAGG + Intergenic
904575156 1:31500798-31500820 AAGACTCAGAAGGGGGAGGCTGG - Intergenic
905217995 1:36423576-36423598 AACAATAAGAAGGGAGAGGCTGG + Intronic
905679578 1:39858954-39858976 AAGAAAACTAAAGGGGAGGCCGG + Intronic
905716502 1:40155877-40155899 CTGAAAAAACAGGGGGAGGGAGG - Intergenic
905842058 1:41189562-41189584 CACCAGAAGAAGGGGGAGGAAGG + Intronic
905847514 1:41244737-41244759 CTAAAAAAGAAGCAGGAGGCTGG - Intergenic
905992440 1:42350364-42350386 TAGAAATAAAAGAGGGAGGCAGG - Intergenic
906058340 1:42932685-42932707 CAGAAGAAGAAGGTGTGGGCAGG + Intronic
906058654 1:42934533-42934555 CAGGAAAGGCAGGGGGATGCTGG + Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906274832 1:44507877-44507899 GAGAAAAAGAAGGGGGAGTGTGG - Intronic
906291790 1:44624140-44624162 CCCAAAGAGAAAGGGGAGGCTGG + Intronic
906482014 1:46205264-46205286 CAAAAAAAGAAGGGGAAGAAGGG + Intronic
906681165 1:47726301-47726323 CAGAGAATGAAGGGGGAGTAAGG - Intergenic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
908319225 1:62964431-62964453 CAGAAAAAGAGGGGGAATGTGGG + Intergenic
908376459 1:63547041-63547063 GGGAAAAAGAATGGGGAGGTGGG - Intronic
908702178 1:66913684-66913706 CACAGTAAGAAGGTGGAGGCCGG + Intronic
909096361 1:71293173-71293195 GAGAGAAAGAAGAGGGAGGGAGG - Intergenic
909107803 1:71434793-71434815 TAAAAAAACAAGGGGGAGGCCGG + Intronic
910480121 1:87649605-87649627 GAGAAAAAGAAGGGAGAAGGGGG - Intergenic
910490418 1:87763469-87763491 GAGAAAAAGAAGGAGAAGGGGGG + Intergenic
910507451 1:87966307-87966329 CTTAAAAAGAAGGGGGCGGGTGG - Intergenic
910678713 1:89841394-89841416 CACAAAAAAAAGGGGGGGGGTGG - Intronic
910745660 1:90571455-90571477 GAGAAAAAGAAGGGTGAAGTTGG + Intergenic
911319627 1:96396674-96396696 CAGAAACTGAAGTGGGATGCAGG + Intergenic
911706442 1:101018802-101018824 GGGATAAAGAAGTGGGAGGCAGG + Intronic
911720544 1:101186760-101186782 GAGAAAAAGAGGAGGGAGGGAGG - Intergenic
911806464 1:102214702-102214724 CAGAAAGCAAAGGGGGAAGCAGG - Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912471497 1:109910280-109910302 CAGAGGAAGAAGGGGGCTGCCGG + Intronic
912497041 1:110098425-110098447 GATAAAAAGAATGGGGAGGAGGG - Intergenic
912853873 1:113149943-113149965 AAAAAAAACAAGGTGGAGGCCGG + Intergenic
912960109 1:114188563-114188585 CAGACACAGCAGGGGCAGGCTGG + Intergenic
913046442 1:115077213-115077235 CAGAAAAGGAATGATGAGGCTGG - Intronic
913384187 1:118241713-118241735 GAGAAAAAGAGGGAGGAGTCAGG - Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
914196799 1:145451941-145451963 GAGAAACAGAAGAGGGAGGCGGG + Intergenic
914787409 1:150847133-150847155 CAGAAAAAGAAGGGGGAGGCTGG + Intronic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
916525238 1:165603214-165603236 CAAAAATAGTAGGGGGAGGAGGG + Intergenic
916807959 1:168278654-168278676 CGCAAAAATAAGAGGGAGGCAGG - Intergenic
917219835 1:172717026-172717048 TAGAAAAACAAGCTGGAGGCCGG + Intergenic
917450274 1:175142239-175142261 CAGAAAAAGCAGGAGGATTCTGG - Intronic
917491704 1:175503805-175503827 AAGAGGAAGATGGGGGAGGCAGG + Intronic
917505344 1:175622385-175622407 CAGAAAAAGAAGGAGGGACCAGG - Intronic
917505479 1:175623502-175623524 CAGAAAAAGAAGGAGGGACCAGG - Intronic
917816282 1:178713191-178713213 AAGAGAAAGAGGGGGGAGGAAGG + Intergenic
918094523 1:181323813-181323835 CAAAAAAAGAAGGCGGAAGTTGG - Intergenic
918229570 1:182515543-182515565 AAAAAAAAAAAGGGGGGGGCGGG + Intronic
918237629 1:182595962-182595984 CAGAAAAAGAAATGGAAGGCTGG - Intergenic
918446585 1:184623012-184623034 CAGAAAAACAGGGATGAGGCTGG - Exonic
918604048 1:186400284-186400306 AATAATAAGAATGGGGAGGCCGG - Intronic
918637595 1:186796879-186796901 TAGAAAAAAAAGGCAGAGGCAGG - Intergenic
918758363 1:188367831-188367853 CAGCAAAAGGAGGGGCAGGAAGG - Intergenic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
919108103 1:193180318-193180340 CAGCAAAAGAAAAGGCAGGCAGG - Exonic
919267300 1:195286333-195286355 AAGAAGAAGAAGGGGGAAGAAGG - Intergenic
919590631 1:199497779-199497801 CAGAAAAAGAAGAACTAGGCCGG + Intergenic
919742742 1:200990547-200990569 ATGGAAGAGAAGGGGGAGGCAGG + Intronic
919820969 1:201471737-201471759 CAGATAAAGATGGGGGTGGGGGG + Intergenic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920212928 1:204341425-204341447 CAGATAAAGAACTGGGAGTCTGG + Intronic
920456392 1:206104872-206104894 TAGAAAAAAAGGGCGGAGGCCGG + Intergenic
920647860 1:207816404-207816426 CAGGAAGAGAAAGCGGAGGCAGG + Intergenic
920988554 1:210913946-210913968 AAGAAAAGGAAGGGGAAAGCTGG - Intronic
921052011 1:211517535-211517557 GAGAGAAAGAAGAGTGAGGCTGG - Intergenic
921400208 1:214713699-214713721 TAAAAAAAGAAAGTGGAGGCTGG - Intergenic
921866100 1:220089118-220089140 AAAAAAAAGAAGGAGGAGGAAGG + Intronic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922518972 1:226229848-226229870 CAGATAAAGAAGTGGGGGGGGGG + Intergenic
922543641 1:226437470-226437492 CAAGAAAAGAAGGGGAAGGGAGG - Intergenic
922555790 1:226531081-226531103 CAGAAACAGAAGGGGACTGCAGG - Intergenic
922922377 1:229317208-229317230 CAGAAAAAGATGGACCAGGCCGG - Intergenic
922923764 1:229330544-229330566 CAGAAAAAGAAAGTGCAGGCCGG + Intronic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923154672 1:231268004-231268026 CAGAAAGAGAAAGGACAGGCCGG + Intronic
923160722 1:231312427-231312449 AAGAAAAAGAAGAGGGAGAGTGG + Intergenic
923488193 1:234457036-234457058 TACAAAAAGAGGGAGGAGGCTGG + Intronic
923549725 1:234953958-234953980 CAGAAAAAGGAGGCCGAGGCAGG - Intergenic
924390006 1:243544257-243544279 AAAAAAAAGCAGGGGGAGGGGGG + Intronic
924602291 1:245502230-245502252 TTGAAAAAGAAGAGGCAGGCTGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063057225 10:2518967-2518989 AAGAAGAAGAAGGGGGGGGGAGG + Intergenic
1063290730 10:4744246-4744268 CAGCAAAAGCTGGGTGAGGCAGG + Intergenic
1063391979 10:5655784-5655806 TTGAAAAAGAAGAGGAAGGCAGG + Intronic
1063661693 10:8038518-8038540 GGGAAACAAAAGGGGGAGGCTGG + Intergenic
1063876479 10:10484193-10484215 CAGAGAGAGGAGGGGGAGGGAGG - Intergenic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1063930660 10:11025507-11025529 CAGAAAGGGAAGGGGAAGCCAGG - Intronic
1064429283 10:15257322-15257344 CTGAAAGACAAGGGGGAGCCGGG + Intronic
1064559149 10:16578675-16578697 CAGAATAACATGGAGGAGGCAGG - Intergenic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065189495 10:23196851-23196873 CAGAAATTGAAGAGGGAGGGAGG - Intergenic
1065384827 10:25124567-25124589 AAGAAATAGAAAGGGGAGGTGGG - Intergenic
1065476191 10:26140385-26140407 ATGAAAAACAAGGGAGAGGCTGG + Intronic
1065487776 10:26251192-26251214 TAGAAAAAGAAAGATGAGGCTGG - Intronic
1065643164 10:27805547-27805569 CAGCAAGACAAGGAGGAGGCAGG + Intergenic
1065824440 10:29557063-29557085 AAGAAAGGGAAGGGGAAGGCAGG - Intronic
1066018843 10:31276365-31276387 CAGGATAAGAAGGCGGAAGCAGG + Intergenic
1066263462 10:33752002-33752024 TAGAAATACAAGGTGGAGGCTGG + Intergenic
1066288867 10:33995753-33995775 CAAAAACAGAATGGGAAGGCAGG + Intergenic
1066330004 10:34411143-34411165 CAGACAGAGATGGGGGAGGAGGG + Intronic
1066360597 10:34726766-34726788 AAAAAAAAGTGGGGGGAGGCGGG + Intronic
1066410617 10:35165219-35165241 CAGCAGGAGAAGGGGGAGCCAGG + Intronic
1067429341 10:46232808-46232830 CAGACACAGAGGGGAGAGGCTGG + Intergenic
1067432404 10:46252955-46252977 GAGAGAAAGATGGGGAAGGCAGG + Intergenic
1067444396 10:46331598-46331620 CAGACACAGAGGGGAGAGGCTGG - Intergenic
1068717147 10:60200909-60200931 GTGAAAAAGTAGGGGGAGGGTGG - Intronic
1068832148 10:61507589-61507611 CAGAAGAGGTAGTGGGAGGCAGG + Intergenic
1068836817 10:61564457-61564479 AAAAAAAAGAAGGGGGACGGAGG + Intergenic
1068896357 10:62207674-62207696 CAGAAATATGGGGGGGAGGCAGG - Intronic
1069917066 10:71793700-71793722 AGGAGAAAGAAGGGGGAAGCAGG - Intronic
1070030979 10:72677147-72677169 TAGAAAATGAAAAGGGAGGCTGG - Intergenic
1070131399 10:73657915-73657937 AAAAAAAAAAAGGGGGTGGCCGG - Intronic
1070166902 10:73905707-73905729 CAGAATAAGAAAGGAGAGGGTGG + Intergenic
1070223513 10:74475809-74475831 GAGAAAAAGGAGGGAGAGGGAGG + Intronic
1070957830 10:80475879-80475901 TATAAAAAGGATGGGGAGGCCGG - Intronic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071420314 10:85489906-85489928 CAGAAAAAGAGGTTGGAGGAAGG + Intergenic
1071786700 10:88908848-88908870 GAGAAAGAGAAAGGGGAGGAAGG - Intronic
1071957940 10:90779446-90779468 AACAAAAAGCAGGTGGAGGCAGG - Intronic
1072223124 10:93344574-93344596 AAGAAAAAGAAGGGAAAGGAGGG + Intronic
1072250550 10:93578992-93579014 GAGAAAAAGATGGGGGTGGGTGG - Intronic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072605164 10:96975218-96975240 CAGAAAAAAAAGTAGGAAGCTGG + Intronic
1072696731 10:97609451-97609473 CACAGAATGAAGGGTGAGGCAGG - Intronic
1072872910 10:99139280-99139302 CAGAAGCAGAAGGGGGAGAAAGG + Intronic
1073438988 10:103541305-103541327 AAGAAAAATAAGGAGGAAGCTGG + Intronic
1073513888 10:104060363-104060385 AAGAAAGAGAAGGAGGAGGGAGG + Intronic
1073652525 10:105376791-105376813 CAGAAAAAAAATGGGGACACTGG - Intergenic
1073978782 10:109130499-109130521 TGGAAAAAAAAGGGGAAGGCAGG - Intergenic
1074405577 10:113177870-113177892 AAAAACAAGAAGGGAGAGGCCGG - Intergenic
1074535824 10:114328187-114328209 CAGCAATAGAAGGGGCAGCCAGG - Intronic
1074561349 10:114538382-114538404 CAGATAAAGACAGGGGAGGGTGG + Intronic
1075396315 10:122130294-122130316 CAGATGAAGAAGGGGGAGTCTGG - Intronic
1076428322 10:130383138-130383160 CAGCAACAGAAGGGAGAAGCAGG - Intergenic
1076797389 10:132804926-132804948 CTGCCAAAGAAGGGAGAGGCGGG + Intergenic
1077277105 11:1717238-1717260 GAATAAAAGAAGGGGTAGGCCGG - Intergenic
1077459410 11:2701067-2701089 CACAGGAGGAAGGGGGAGGCTGG + Intronic
1077866016 11:6222613-6222635 CACAAAAAGAAGGGAAAGTCTGG + Intronic
1077878831 11:6331477-6331499 TAGAAATAAAAGGTGGAGGCCGG + Intergenic
1077908291 11:6551941-6551963 CAAAAAAAAAAAGGGGAGCCAGG + Intronic
1078016786 11:7621772-7621794 CAGACACAGTAGGGGAAGGCAGG - Intronic
1078163401 11:8862018-8862040 GAGACACAGAAGGGGGAGGAAGG + Intronic
1078248118 11:9594933-9594955 CTGAAAGAGAAGGGGAAGGGAGG + Intergenic
1078569219 11:12443155-12443177 AAAAAAAAGAAGGGGGGCGCCGG - Intronic
1078692689 11:13597782-13597804 AAGAAAGAGAAGGGAGAGGCCGG + Intergenic
1078725032 11:13922821-13922843 CCGACAGAGATGGGGGAGGCAGG - Intergenic
1078767182 11:14309779-14309801 CAGAAAATTAACAGGGAGGCAGG + Intronic
1078966283 11:16348001-16348023 AAGAGAAAGAAGAGGGAGGGAGG + Intronic
1079094008 11:17499608-17499630 CAGAAGAAGAAGGTGGGGCCTGG + Intronic
1079333176 11:19549974-19549996 CAGCAGAAGCCGGGGGAGGCTGG - Intronic
1079451853 11:20604908-20604930 CAGAAGAAGGCGGGGGTGGCAGG - Intronic
1079591790 11:22191882-22191904 GAAAAAAAGAAGAGGGAGGAAGG - Intergenic
1080411888 11:32032944-32032966 AAAAAAAAGAAGGTGGAGGGAGG - Intronic
1080412702 11:32040897-32040919 TAGAAAAAGGAGGGTGAGGAGGG - Intronic
1080775764 11:35385213-35385235 CATAAAAAGGAGGGGAGGGCAGG - Intronic
1081282575 11:41227853-41227875 CAGAAAAAGGAAGGGAAGACAGG - Intronic
1081628163 11:44667895-44667917 CAGACAAACAAGGGGGAGCGTGG + Intergenic
1081674483 11:44960522-44960544 GAGAAAGAAAAAGGGGAGGCGGG - Intergenic
1081762626 11:45587210-45587232 CAGATGAAGTAGGGGGAGGGTGG - Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082745295 11:56954612-56954634 CAGAAAACAAAGGGGAAGGGAGG + Intergenic
1082880219 11:58029832-58029854 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1083209017 11:61171080-61171102 CAGAAAAACTAGAGGGAAGCAGG + Intergenic
1083425819 11:62585116-62585138 TAAAAAAAGAAGGGTGTGGCCGG - Intronic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083646877 11:64176810-64176832 CAGAAAAAAAAGGGGTGGGGGGG + Intergenic
1083671332 11:64301390-64301412 AAAAAAAAAAAGTGGGAGGCGGG - Intronic
1083924845 11:65799756-65799778 AAAAAAAAAAAGGGGGAGCCGGG - Intergenic
1084201006 11:67558328-67558350 CAGAGAGAGCAGGGGGAGCCTGG - Intergenic
1084219919 11:67671534-67671556 AAAAAAAAGGGGGGGGAGGCAGG - Intronic
1084364026 11:68686014-68686036 GAGAAAGGGAAGAGGGAGGCAGG - Intronic
1084596946 11:70122624-70122646 GAGAGAGAGAAGGGGGAGGGAGG - Intronic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1084837873 11:71817306-71817328 AGGAACCAGAAGGGGGAGGCAGG - Intergenic
1085101813 11:73807164-73807186 GAGAAAAACAATGGGGAGCCTGG - Intronic
1085332984 11:75668386-75668408 CACAAGAAGAAAGAGGAGGCCGG - Exonic
1085480310 11:76816734-76816756 CAGAAAAAGAATTCTGAGGCTGG - Intergenic
1085539843 11:77256784-77256806 CAGAAGATGAAGGGGGAGCAAGG - Intronic
1085559474 11:77457568-77457590 CAGAGAACAAAGGGAGAGGCAGG + Intronic
1085604570 11:77885520-77885542 TAGAAAATGAAGGGGAGGGCCGG + Intronic
1085758921 11:79224950-79224972 TAAAAAAAAAAGGGGGAGGGGGG + Intronic
1086035949 11:82414610-82414632 CAGAAACAAAGGTGGGAGGCAGG + Intergenic
1086571632 11:88291504-88291526 CAAGAAAAGAAGAGGGAGGGAGG + Intergenic
1086578698 11:88371022-88371044 AAGAAAAAGAACTTGGAGGCAGG - Intergenic
1086781319 11:90909949-90909971 CAGAATGTGAAGGGGGAGGCAGG + Intergenic
1086950882 11:92889158-92889180 CAGGAAAAGAAGTCGGAGGTAGG - Intronic
1087151537 11:94864651-94864673 CAGACACAGAATGGAGAGGCTGG - Intronic
1087761770 11:102110509-102110531 AATAAAGAGAAAGGGGAGGCGGG + Exonic
1087785809 11:102352725-102352747 CAGAAATAGAATGGTGCGGCAGG - Intronic
1088202976 11:107360106-107360128 CAGAAGAATAAGGGGGTGGGAGG - Intronic
1088288402 11:108210457-108210479 CAGAAGGTGAAGGGGGAAGCTGG - Intronic
1088500261 11:110475940-110475962 AAGAAAAAGTTGGGGGAGGGAGG - Intergenic
1088552073 11:111023251-111023273 CTGAAAAGCAAAGGGGAGGCTGG + Intergenic
1088553954 11:111042824-111042846 TAGAAAAAGGAGGAAGAGGCTGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088763369 11:112952853-112952875 TAGAAAAAGCAAGGGGAGGAGGG - Intergenic
1089014718 11:115156653-115156675 CAGCAAATGAAGGGGGAGAGGGG - Intergenic
1089270747 11:117300030-117300052 CAGGAGAGGAAGGGGGAGGCAGG - Intronic
1089499544 11:118924364-118924386 CAGAAAGAGAAGGGAGAGAGGGG + Intronic
1089535163 11:119156535-119156557 CAGAAAGAGAAGGGTAAGGAAGG - Intronic
1089572454 11:119419524-119419546 CAGAAAGAGAAGGGGGCCGGGGG + Intronic
1089679272 11:120110329-120110351 AAGAGAGAGAAGGGGGAGACAGG - Intergenic
1089702327 11:120252970-120252992 GGGAAAAAGGAGGGGGAGCCTGG + Intronic
1089782360 11:120882551-120882573 CAGAAAAAGAGATGGGTGGCTGG + Intronic
1089890083 11:121872134-121872156 CAGAAAAAGAAGAGGAGGCCGGG + Intergenic
1090244957 11:125209656-125209678 CAGTAATAGATGGGGCAGGCTGG + Intronic
1090283941 11:125482520-125482542 CAAAAAAAGAGGAGGGAGGTTGG + Intronic
1090838728 11:130472115-130472137 TAGAAGAAGAGGGGGTAGGCAGG + Intronic
1090900779 11:131028930-131028952 GAGAAAGGGAAGGGGGAAGCAGG + Intergenic
1090911315 11:131122010-131122032 CAGAAACAGCAGGGGAAGGATGG + Intergenic
1091009179 11:131982613-131982635 CATAAAATGAAAGGGGGGGCAGG + Intronic
1091087816 11:132740099-132740121 CAGAAAGAAAAGGGAGAAGCAGG + Intronic
1091094759 11:132810143-132810165 CAGAAGACGGAGGGAGAGGCTGG - Intronic
1091143758 11:133259109-133259131 AATAAAATGAAGGGGGAGGTAGG - Intronic
1091183034 11:133624595-133624617 CAGAAAAAGATGGTGGAGTCTGG - Intergenic
1091294557 11:134464492-134464514 GTGAAAAGGAATGGGGAGGCAGG - Intergenic
1091416730 12:293778-293800 CAAAAAAAAAAGGGGGGGGGGGG + Intronic
1091445428 12:542115-542137 CAGAAACAGAAGTGGGAGACTGG - Intronic
1091488231 12:910117-910139 CATAAAGAGAAGGGGGTGGGGGG + Exonic
1091639118 12:2221149-2221171 CAGAAACAGAAGAGCAAGGCTGG + Intronic
1091673217 12:2467579-2467601 CAGAGACAGCAGGGGGTGGCGGG + Intronic
1091691889 12:2602884-2602906 CACAAAACGATGGGGGAGACGGG + Intronic
1091786106 12:3244294-3244316 CAGAAAAAGAAGGGAAGTGCAGG - Intronic
1092173858 12:6390028-6390050 GAGAGAAAGAAGAGGGAGGGAGG + Intronic
1092232517 12:6784157-6784179 CAAAAAAAGAAGGTCCAGGCGGG - Intergenic
1092355165 12:7788804-7788826 CAAAAAAAAAAGGGGGGGGTGGG - Intronic
1092367526 12:7889531-7889553 CAAAAAAAAAAGGGGGAACCAGG - Intronic
1092400828 12:8176767-8176789 AGGAACCAGAAGGGGGAGGCAGG + Intronic
1092762873 12:11825305-11825327 GAGAAACACAAGGGGGAAGCAGG + Intronic
1093381756 12:18501308-18501330 CAGGAAAAAAAGGGGGAGAATGG + Intronic
1093838620 12:23868108-23868130 AAGAAAAAAAAGTGGAAGGCAGG - Intronic
1093987793 12:25556527-25556549 CAGAAAAAGCAGGATGAAGCTGG - Intronic
1094023586 12:25940256-25940278 CAAAAACAGAAGGGGGTGGCAGG - Intergenic
1094046668 12:26174815-26174837 TAGAAATGGTAGGGGGAGGCCGG - Intronic
1094147508 12:27245154-27245176 TATAAAAAGAAGTGGGAGGTGGG + Intronic
1094349611 12:29509377-29509399 CAGAAAGAGATGGGGGAGAGAGG - Intronic
1094478883 12:30864246-30864268 CAGAAAAAGAAGCTGAGGGCAGG - Intergenic
1094489494 12:30950097-30950119 AAGAAAGAGAAGGGGGTGGGGGG - Intronic
1094538145 12:31340121-31340143 AAGAAAAAGAAAGGCCAGGCTGG - Intergenic
1094549505 12:31437135-31437157 AAAAAAAAAAAGGGGGGGGCAGG - Intronic
1094824966 12:34262905-34262927 CAAAAAAAGAAAGATGAGGCCGG - Intergenic
1095086037 12:38058077-38058099 CAAAAAAAGAAAGATGAGGCCGG + Intergenic
1095691390 12:45093307-45093329 CAGACAACGAAGGAGGAGCCAGG - Intergenic
1096173386 12:49492797-49492819 AAGAAAAAGAAAGATGAGGCCGG + Intronic
1096205684 12:49719694-49719716 AAGAAAAAGAAAGGGGAGGGAGG + Intronic
1096380934 12:51157588-51157610 CAGAAATGGAAAGGGTAGGCTGG - Intronic
1096757081 12:53808657-53808679 AACAAAAAAAAGAGGGAGGCTGG - Intergenic
1096824367 12:54263437-54263459 CAGAAAAACAAGAGGTAGGCCGG + Intronic
1096865757 12:54561653-54561675 GAGAAGAGGAAGGGGGAGGAGGG + Intronic
1097097784 12:56563456-56563478 CAGATAAAGAAGGTGGAGATAGG + Intronic
1097625797 12:61998783-61998805 AAGAAAAACAAGGGAGGGGCTGG + Intronic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1097744092 12:63280576-63280598 GATAAAGAGAAGGAGGAGGCAGG + Intergenic
1097855767 12:64460527-64460549 AAGAAATAAAAGGGGGCGGCCGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098277083 12:68823625-68823647 AAGAAAAAGAGGGCAGAGGCAGG - Intronic
1098516326 12:71380469-71380491 CATAAAAAGAAGAGAGAGGTTGG - Intronic
1098707939 12:73715491-73715513 CAAAAAAAAAAGGGGGGGGTGGG - Intergenic
1099048464 12:77753650-77753672 TAGAAAAAGGAGGGGGAAGTAGG + Intergenic
1099055311 12:77833111-77833133 CAGAAAAAGAATTGGGAAGGAGG - Intronic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099472006 12:83062020-83062042 TAGAAAAAGAAGCTTGAGGCCGG - Intronic
1099644407 12:85333676-85333698 AAGAAGAAGAAAGGGGATGCAGG - Intergenic
1100133440 12:91524189-91524211 CAGAAGAAAAAGTGGGAGACAGG + Intergenic
1100523748 12:95400819-95400841 CAGAAAGAGAAGGCAGAGGGTGG - Intergenic
1100672054 12:96824186-96824208 GAGATGAAGAAGGGGAAGGCAGG - Intronic
1100716755 12:97314010-97314032 CACAAAAAGGGAGGGGAGGCTGG + Intergenic
1101141143 12:101797326-101797348 CAGAAACAGAAGGGACAGGCCGG + Intronic
1101378258 12:104189670-104189692 TAAAAAAAGATAGGGGAGGCTGG - Intergenic
1101662494 12:106778181-106778203 TAGAAAAAGAAGGGGAAGAATGG - Intronic
1101693011 12:107098350-107098372 AAGAAAAAGAAGGGGGAGGGAGG + Intergenic
1101853859 12:108425884-108425906 CACAAAAAGAAGTGGGAAGTGGG + Intergenic
1102153287 12:110703681-110703703 CAAAAAAAAAAGAGAGAGGCGGG - Intronic
1102343956 12:112146363-112146385 CCAAAAAAAAAGGGGGGGGCAGG + Intronic
1102418384 12:112784319-112784341 CTGAATAAGAGGGGAGAGGCTGG - Intronic
1102520873 12:113476907-113476929 AAGAAAGGGAAGGGGGAGGGAGG - Intergenic
1102768839 12:115455656-115455678 CAGAAAAGCAGGGGGGTGGCAGG - Intergenic
1102777677 12:115534823-115534845 AAGAAAAAGGAGGAGTAGGCAGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102913651 12:116737488-116737510 AAGAAAGGGAAGGGGGAGGAAGG + Intronic
1102917306 12:116763778-116763800 CAAAAAAAAAAGGGGGCGGGGGG + Intronic
1103024282 12:117560870-117560892 CAGAAGGAGAAGGGGGAGCAGGG - Intronic
1103270607 12:119669869-119669891 AAAAAAAAGCAGGGTGAGGCCGG - Intronic
1103425656 12:120831041-120831063 CAGAACAAAAAGGCGGAGGAAGG + Intronic
1103586671 12:121961316-121961338 GAGAGAAAGAAGGGAGGGGCGGG - Intronic
1103610330 12:122120196-122120218 AAGAAAGAGAAGGGGAAGGAAGG - Intronic
1104120587 12:125795466-125795488 AAGAAACAGAAGGAGGGGGCCGG - Intergenic
1104192283 12:126493607-126493629 CAGAAAAACAGGGTGGAGGAGGG + Intergenic
1104383958 12:128332755-128332777 GAGGAAAAGAAGGGAGAGCCAGG - Intronic
1104503020 12:129303950-129303972 CAGAACACAAAGGTGGAGGCAGG - Intronic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1104726715 12:131082154-131082176 CAGAAACAAAAGGTGGAGGAAGG - Intronic
1104806492 12:131592556-131592578 CAGAAGAAAAAGGGGTTGGCTGG - Intergenic
1105657054 13:22453117-22453139 CAGAAAAAGGAGGCTGAGCCTGG + Intergenic
1106190882 13:27451160-27451182 AAGAAAAAGAGGGGGGACACGGG - Intergenic
1106534048 13:30623299-30623321 CAGAAAAATAATGGGGGAGCTGG + Intronic
1106591973 13:31105695-31105717 AAGAAAAAGAAAGGGGTAGCGGG - Intergenic
1106828842 13:33556249-33556271 AAGGAAAAGAAAAGGGAGGCGGG - Intergenic
1107109265 13:36678038-36678060 CAGAAAAAGAGGGGAGAAGGAGG + Intronic
1107473562 13:40713308-40713330 TAAAAGAAGAAGGGGGTGGCTGG - Intergenic
1107614331 13:42148930-42148952 AAAAAAAAGAAGGGGCGGGCGGG - Intronic
1107659808 13:42627102-42627124 CAAAAAAAGAAGGGGAAGGAAGG - Intergenic
1107733841 13:43375244-43375266 GAGAAAAAGAACGGGGCGGGGGG + Intronic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1109913831 13:68953606-68953628 GAGAAAAAGATGGTGGTGGCTGG + Intergenic
1110520694 13:76472536-76472558 CAGAAAAGGAGGCGGGGGGCAGG + Intergenic
1110544121 13:76737404-76737426 TAGAAAAAGAGAGTGGAGGCTGG - Intergenic
1111480557 13:88819911-88819933 CAGACAAAGAAGGGAGGGGTGGG + Intergenic
1111586425 13:90289312-90289334 CAGAGAAAGAAGGGAGATGCAGG + Intergenic
1112722466 13:102260131-102260153 GAAAAAAAGAAGCGGGAGGAGGG + Intronic
1112927728 13:104697116-104697138 CAGAAAAATATGGGGGTGGGAGG - Intergenic
1113110144 13:106814205-106814227 CAGAAAGAAAAGAGGGAGGGAGG + Intergenic
1113755015 13:112804462-112804484 CAGGAAAAGGAGGGGAAGGAGGG - Intronic
1114261449 14:21039526-21039548 CAGAAAAAGATGGAGGAAGGGGG - Intronic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114562198 14:23601430-23601452 CAGAAAAAGAGCTGGGTGGCTGG - Intergenic
1114573908 14:23695320-23695342 TGGAAAAAGAGGGGGGAGGGGGG + Intergenic
1114590450 14:23859995-23860017 CAGAAAATGGAGGGGGAGCCTGG - Intergenic
1114652706 14:24296395-24296417 AAGAAAGAGATGGGGGAGGCCGG + Intronic
1114654631 14:24308804-24308826 CAGAAAAAAAGTGGGGAAGCTGG - Exonic
1114740150 14:25088596-25088618 CAAAAAAAGAAAGGGGGGGTGGG - Intergenic
1114753969 14:25237667-25237689 CAGGAAAAGAATGAGGAAGCAGG - Intergenic
1114899346 14:27037421-27037443 AAGAAACAGAAGGGGGAGTATGG - Intergenic
1115735199 14:36320393-36320415 GAGAAAAAGAATGGCGAGGAGGG + Intronic
1115807432 14:37067115-37067137 AAGAAAAATAATGGGGAAGCAGG + Intronic
1115826667 14:37285886-37285908 TAGAAAAAGACTGGAGAGGCCGG - Intronic
1116755582 14:48943982-48944004 CAGAAAAGGAAAGTGGAGGAGGG - Intergenic
1117393111 14:55281543-55281565 CAGAAAATGAAGAGGAAGGGTGG - Intronic
1117548782 14:56813264-56813286 CAGACAAGGAAGGGGGGGGGGGG + Intergenic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1118119833 14:62828496-62828518 CAGAAAGGGAAGGGGAAGGAAGG + Intronic
1118378520 14:65198495-65198517 CAGGCAAAGGAGGGGGATGCTGG + Intergenic
1118631396 14:67706933-67706955 CAGAGAAATTAGGGGGAGGAAGG + Intronic
1118676321 14:68188388-68188410 GAGAAAGGGAAGGGGGAGGAGGG - Intronic
1118750614 14:68805580-68805602 TAGAAACAGAAGGGGGAAGAAGG + Intergenic
1119081925 14:71702776-71702798 CAAATAAACAAGGGGGAGGAAGG - Intronic
1119522052 14:75293927-75293949 AAGAAAAAGAAGGGACAGGAGGG + Intergenic
1119812739 14:77536919-77536941 CAAAAAAAGAAGTGGGGGGGTGG - Intronic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120995791 14:90417845-90417867 TAAAAAAACAAGGGAGAGGCTGG - Intergenic
1121328313 14:93034486-93034508 CAAGAATAGAATGGGGAGGCGGG + Intronic
1121356215 14:93217351-93217373 GAGGAAATGAAGGGAGAGGCAGG - Intronic
1121406379 14:93721572-93721594 AAGGCAAAGGAGGGGGAGGCAGG + Intronic
1121540501 14:94722484-94722506 TAAAGAAAGAAAGGGGAGGCTGG + Intergenic
1121659462 14:95624213-95624235 GAGATAAAGAATGGGAAGGCAGG + Intergenic
1121674846 14:95744099-95744121 CAGAACAAGAAGGTAGAGGAAGG + Intergenic
1122009688 14:98735858-98735880 CAGAGAAACAACGGGGTGGCAGG + Intergenic
1122353909 14:101112329-101112351 GAGAAAGAGAAGGGTGAGGCTGG - Intergenic
1123019909 14:105392833-105392855 AAGAACAAGAAGGGTGAGGTGGG + Exonic
1123880954 15:24677052-24677074 GGGAGAAAGAAGGGGCAGGCTGG - Exonic
1123996454 15:25721140-25721162 CAGATAAGGAAGGGAGAGGTGGG + Intronic
1123999428 15:25742464-25742486 CAGAAAAGGCAAGGGGAGGCTGG - Intronic
1124051078 15:26198057-26198079 CAGAAAGTGAAGGGGGGAGCAGG + Intergenic
1124051284 15:26199343-26199365 CAGCAGAGGAAGGGGGAGGCAGG - Intergenic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124633715 15:31352011-31352033 CAAAAAAAAAAAAGGGAGGCGGG + Intronic
1124996124 15:34724495-34724517 CAGATAATGAAGGGGCAGGATGG - Intergenic
1125054926 15:35347446-35347468 AAAAAAAAAAAGGAGGAGGCTGG - Intronic
1125121160 15:36160123-36160145 CAGAAGAAGAAAGGGCAGGAAGG + Intergenic
1125241031 15:37575969-37575991 TAAAAATAGAAGGAGGAGGCCGG - Intergenic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1125809728 15:42527780-42527802 CAGAATAAGAAGGCTGATGCTGG - Intronic
1125923058 15:43537969-43537991 CAGAAACAGAAGAGGGAGAAGGG + Intronic
1126404998 15:48314536-48314558 CATAAAAAAAAGAGTGAGGCTGG - Intergenic
1126458136 15:48886865-48886887 CAGAAAGAGAAGGCTGAGGATGG + Intronic
1126540051 15:49812544-49812566 GAGAAAAAGAAGGAAGAGGAGGG - Intergenic
1127137562 15:55940506-55940528 GAGAGAGAGAAGGGGGAGGAGGG - Intronic
1127626423 15:60784541-60784563 CAGAAACAGAAGGGTGAATCAGG - Intronic
1127879553 15:63144595-63144617 CGGAAAGAGAAGGGGGAGCCCGG - Intronic
1127907576 15:63387646-63387668 CAGAGAGGGAAGGGGGAGGAAGG + Intergenic
1128042551 15:64588130-64588152 CTTAAAAAGAAGGGGAAGGCCGG + Intronic
1128610643 15:69070431-69070453 GAGAGAAAGAAAAGGGAGGCAGG + Intergenic
1128768173 15:70263758-70263780 CAGAAAAGGCAGGGAGAAGCGGG - Intergenic
1128933698 15:71727769-71727791 CAAAAAAAAAAGGGGAGGGCTGG + Intronic
1128964039 15:72039830-72039852 AAGAAAAAAAAGGGGGTGGGTGG + Intronic
1129154210 15:73707667-73707689 CAAAAAAAGATGGGGGAAGGCGG - Intronic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1129803872 15:78438277-78438299 CGGGGGAAGAAGGGGGAGGCCGG - Exonic
1129935925 15:79450202-79450224 CATAAAATGAAGGGTTAGGCTGG + Intronic
1130169232 15:81494771-81494793 TAACAAATGAAGGGGGAGGCAGG - Intergenic
1130224163 15:82045282-82045304 CAGACAAAGAAAGTGCAGGCAGG - Intronic
1130384112 15:83396353-83396375 CTGCCAAAGAAGGGGGAGGTGGG + Intergenic
1130661355 15:85833719-85833741 CAGAACAGGAAGGGGAAGGAGGG + Intergenic
1130702602 15:86200551-86200573 CAAAAAAAAAAGGGGGGGGGGGG - Intronic
1131081512 15:89540325-89540347 CAAAAAAAGAATGGTGAGGAGGG + Intergenic
1131211589 15:90502456-90502478 CATAAAAAGAAGGGTGTTGCGGG + Intergenic
1131259145 15:90879645-90879667 CAAAGAAGGAAGGGAGAGGCTGG - Intronic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131424628 15:92335422-92335444 CAGAAAAAGAAGAGAGAGGGAGG - Intergenic
1131608464 15:93935221-93935243 GATCAAAAGAAGGAGGAGGCCGG + Intergenic
1131635001 15:94223325-94223347 TAGAAAAAGCAGGGTGAGGTGGG + Intergenic
1131714086 15:95089717-95089739 TAGAAAAAGAAGGGGGAGGAGGG + Intergenic
1131839427 15:96419897-96419919 GAGAAAGAGAAAGGGTAGGCTGG + Intergenic
1131901056 15:97088472-97088494 AAGAAAAACAAGAGGGAGGCAGG - Intergenic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1132283760 15:100643787-100643809 AAAAAAAAGAAGGGGCTGGCTGG - Intronic
1132737128 16:1392427-1392449 CAAAAAAAGAGGGGGGAAGAGGG - Intronic
1133024801 16:2983904-2983926 CACAAAAGGAAAGGCGAGGCCGG + Intergenic
1133130074 16:3671514-3671536 CAGAAGAAGGTGGGGGTGGCTGG - Intronic
1133194435 16:4158970-4158992 GAGAAAAAGAAGGTGGAGTTGGG + Intergenic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133470344 16:6069100-6069122 GAGAAAAAGAAGGGAGAGGCCGG + Intronic
1133544156 16:6788769-6788791 CAGAAAAATCAGTGGGGGGCCGG - Intronic
1133544834 16:6795872-6795894 CATAAAAGGAAAGGGAAGGCAGG - Intronic
1133627221 16:7582028-7582050 CACAAAAAAAAGGGGGGGGGGGG - Intronic
1134329395 16:13236625-13236647 CAGAAAAAGAAGAGGAAGGAAGG - Exonic
1134375236 16:13665981-13666003 GAGAAAAACGAGGGGGAGGAAGG + Intergenic
1134509554 16:14834933-14834955 GAGAAAACGAAGGAAGAGGCTGG + Intronic
1134697259 16:16233749-16233771 GAGAAAACGAAGGAAGAGGCTGG + Intronic
1134903775 16:17961755-17961777 CAAAGAAAGAAGGGAGAGGGAGG + Intergenic
1134914163 16:18055541-18055563 CTGAAAAAGAAAGGGAAGGAAGG + Intergenic
1134974587 16:18560925-18560947 GAGAAAACGAAGGAAGAGGCTGG - Intronic
1135052799 16:19206022-19206044 GAAAAAAAGAAGGCGTAGGCAGG + Intronic
1135985778 16:27182882-27182904 CAGAAAGAAAAGGGGGACACAGG + Intergenic
1136477499 16:30522661-30522683 CAGAAAAAGAGGGGCTGGGCTGG + Exonic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136518271 16:30780861-30780883 CACAAAAATTAGGGGGAAGCAGG - Exonic
1136617180 16:31405279-31405301 AAGAAAGAGAAGGAAGAGGCTGG - Intronic
1137239872 16:46647111-46647133 CAGACAAGGAAGGGGCAGGCGGG - Intergenic
1137310007 16:47245820-47245842 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1137387951 16:48058279-48058301 CAAAAAAAAAGGGGGGGGGCGGG - Intergenic
1137465260 16:48702700-48702722 GAGAGAAAGAAGGGGGAGGGAGG - Intergenic
1137466426 16:48713971-48713993 CAGAGAAAGAAGGGGGAGGGAGG - Intergenic
1137544944 16:49396243-49396265 CAAAAAAAGAAAGGGGAGAAGGG + Intronic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137928412 16:52563700-52563722 AAGAAAATGGTGGGGGAGGCTGG + Intergenic
1138351285 16:56347542-56347564 CTGTCAAAGAAGGGGCAGGCTGG + Exonic
1138488974 16:57365096-57365118 TAGGAAAAAAAGGGGGAGGCTGG - Exonic
1138613452 16:58145814-58145836 AAAAGAAAAAAGGGGGAGGCCGG - Intergenic
1138695429 16:58808553-58808575 AAAAAAAAAAAGGGGGGGGCAGG - Intergenic
1138788424 16:59873079-59873101 CAGACCAAGAATTGGGAGGCCGG - Intergenic
1139437923 16:66947626-66947648 CAAAAAAAAAAGGGGGAGCAGGG - Intergenic
1139524267 16:67503995-67504017 AAGAAAAAGAAGAGCGTGGCTGG - Intergenic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1140127591 16:72131158-72131180 TAGAAAAAGAAGTGGGAGGAAGG + Intronic
1140237350 16:73171483-73171505 CAGAAAATGGCGGGGGGGGCGGG + Intergenic
1140299653 16:73744457-73744479 CAGAAATACCAGGGTGAGGCAGG - Intergenic
1140309557 16:73835765-73835787 GGGAAAAAGAAAGTGGAGGCCGG - Intergenic
1140316079 16:73898764-73898786 CACAAAAAAAAGTGGTAGGCAGG + Intergenic
1140501343 16:75436069-75436091 CAGAAGAGGAAGAGGGTGGCAGG - Intronic
1140622404 16:76751436-76751458 CAGAAGGAGAAGGGGCAGGAGGG + Intergenic
1140764278 16:78141416-78141438 AAAAAAAAGAAGGGGGATGGTGG - Intronic
1140887397 16:79256880-79256902 CATAAACAGAAGGGAGGGGCTGG + Intergenic
1141019305 16:80479975-80479997 AAGAAAAAGAAGAGGGAGATTGG + Intergenic
1141138428 16:81481869-81481891 AAAAAAAAAAAGAGGGAGGCGGG - Intronic
1141505674 16:84476656-84476678 CATAAAGACAAGAGGGAGGCAGG + Exonic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1142872726 17:2831371-2831393 AAGAAAAAGAAATAGGAGGCTGG - Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143138731 17:4728016-4728038 CAAAATAAAAAGGGGGAGGTGGG - Intergenic
1143231994 17:5364231-5364253 CAGAAAAAGAAGTGGGAAAAGGG + Intronic
1143349705 17:6278260-6278282 CATAAAAATAAGCTGGAGGCCGG - Intergenic
1143361204 17:6372771-6372793 GAGAAAAAAAAGAAGGAGGCAGG + Intergenic
1143387461 17:6540171-6540193 CAGAAAAGGAAGGGGCTGGTAGG + Intronic
1143458940 17:7087721-7087743 AAGAAAAGAAAGGGGGAGGCTGG - Intergenic
1143701118 17:8660913-8660935 AAGAGAAAGAAGAGGGAGGAAGG - Intergenic
1143740818 17:8952828-8952850 CAGGAAAGGTAGGGGGAGGAGGG + Intronic
1144034517 17:11353460-11353482 AAAAAAAAAAAGGGTGAGGCGGG + Intronic
1144140051 17:12339548-12339570 CATAAAGAGATGGAGGAGGCCGG - Intergenic
1144218925 17:13082627-13082649 CATATAAAGAAGGAGGAGGAGGG + Intergenic
1144712220 17:17409332-17409354 AAAAAAAAGAAGGAGGAGTCAGG - Intergenic
1145775768 17:27527394-27527416 AAGAAAAAAAAGGGGGGGGGGGG - Intronic
1145962213 17:28893397-28893419 AAAAAAAAGAAGGTGGAGGAAGG - Intronic
1146261570 17:31425614-31425636 CAGAAATAGAAGGGGAAGCCTGG + Intronic
1146441444 17:32898729-32898751 AAGATAAAGTAGGGGGAGGAAGG + Intergenic
1146990770 17:37269993-37270015 CAGAAAGAGAAAAGGGAGACAGG - Intronic
1147044912 17:37744895-37744917 CGGAAAAAGAAGGGGGTGAGGGG + Exonic
1147059773 17:37865860-37865882 GAAAAAAATAAGGGGGAGACAGG + Intergenic
1147133637 17:38422935-38422957 CAGAGAAAGGAGGGAGAGGGTGG - Intergenic
1147193117 17:38748497-38748519 CGGGAAGAGGAGGGGGAGGCTGG + Intronic
1147411841 17:40258711-40258733 CAGAAAGAGAGGAGGGAGGGAGG + Intronic
1147752697 17:42745939-42745961 CTTAAAAAGAAGAGGGAGGCCGG - Intergenic
1147864475 17:43543645-43543667 CAGAAGAAGGATGGGGAGACGGG + Intronic
1147948610 17:44094339-44094361 AAAAACAAAAAGGGGGAGGCCGG + Intronic
1148409042 17:47448355-47448377 GAAAAAAATAAGGGGGAGACAGG + Intergenic
1148567932 17:48644806-48644828 AAAAAAAAGAAGTTGGAGGCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148780770 17:50120338-50120360 AAGAAAAAGAGGGGAGAGGATGG + Intronic
1148796151 17:50197823-50197845 GAAAAAAAGAAGGGGAAGGCTGG + Intronic
1148874814 17:50680675-50680697 AAGAAAGAGAAGGGCAAGGCAGG - Intronic
1149394080 17:56221074-56221096 CAGAAGGTGAAGGGGGAAGCAGG + Intronic
1149479129 17:56987456-56987478 AAAAAAAAAAAGGGAGAGGCAGG - Intronic
1149635830 17:58168501-58168523 CAGAAGAAGATGGAGGAGCCGGG - Intergenic
1149672740 17:58429931-58429953 GACAAAAAGAAGGGGAAAGCAGG + Intronic
1150656958 17:67045510-67045532 AAAAAAAAGAAGGTGGGGGCAGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150778905 17:68102786-68102808 CGAAAAAGGAAGGGGGAGGGTGG - Intergenic
1151160813 17:72164062-72164084 TAGGAAAAGAAGGGGCAGGATGG - Intergenic
1151292914 17:73163472-73163494 CAGGAAAAGAAGGAAGAGCCAGG - Intergenic
1151305661 17:73261359-73261381 TAGAGAAGGAAGGGGGAGGGAGG + Intronic
1151331341 17:73411046-73411068 CAGAGGAAGGAAGGGGAGGCCGG - Intronic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151439165 17:74117032-74117054 CAGGAAGAGGAGTGGGAGGCAGG + Intergenic
1151536884 17:74744247-74744269 CAGAAGAAGAAAGGGGCAGCAGG + Intronic
1151740557 17:75979213-75979235 CGGAGAAAGAAGGGGCGGGCCGG - Exonic
1152080087 17:78181755-78181777 CAAAAAAAAAAGGGGGAGGTGGG - Intronic
1152087605 17:78230244-78230266 AAAAAAAAGAAAGGAGAGGCTGG + Intergenic
1152176293 17:78789827-78789849 CAGAAAAACAAAGGGGGTGCGGG + Intronic
1152179537 17:78810113-78810135 AAAAAAAAGAAGAGGGGGGCCGG - Intronic
1152435508 17:80273914-80273936 AAGAAAAGGAAGGTGGAGGCCGG - Intronic
1152509590 17:80776940-80776962 CAGGAAGTGAAGGGGGAGGCCGG + Intronic
1152999070 18:436515-436537 CAAAAAAAAAAGGGGGGGGGGGG + Intronic
1153046797 18:863307-863329 AAAAAAAAAAAGGGTGAGGCCGG - Intergenic
1153118368 18:1688872-1688894 CAGAAAAAGAAATAGGAGACAGG - Intergenic
1153505724 18:5796101-5796123 TAGAAAGAGAAGTGAGAGGCTGG + Intergenic
1153714002 18:7827290-7827312 AAGAAAAATAAGGGGCAGACAGG - Intronic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1153909629 18:9695590-9695612 AAAAAAAAAAAGGGGGAGGGTGG - Intergenic
1154335520 18:13461908-13461930 CAGAAAAAGTGGGAGGGGGCAGG + Intronic
1155043601 18:22085292-22085314 GAAAAAAAGAAGGGGGAGAAAGG - Intergenic
1155092299 18:22523758-22523780 AAGAAAAGGAAGGGGAAGGAAGG + Intergenic
1155237790 18:23838894-23838916 CAGAACATGAACGGGGAGACAGG - Intronic
1155680852 18:28483698-28483720 CAGGGAAAGAAGTGGGAGGCAGG + Intergenic
1155868140 18:30992165-30992187 CAAAAAAAAAAGGGGGGGGGGGG + Exonic
1155908526 18:31481962-31481984 GAGAAAAAGAGGGAGGATGCGGG - Intergenic
1157117396 18:44874938-44874960 CAGAAAAGGAAGGCTGAAGCAGG + Intronic
1157420197 18:47541370-47541392 CAGAAATATCAGGTGGAGGCTGG + Intergenic
1157850956 18:51050361-51050383 AAAAAAAAGTGGGGGGAGGCTGG + Intronic
1157876126 18:51275259-51275281 CAGGATAGGAAGGGGGCGGCAGG - Intergenic
1157943735 18:51956151-51956173 AAAAAAAAAAAGGTGGAGGCAGG + Intergenic
1158035741 18:53027738-53027760 CTGTAAAAGAAGTTGGAGGCTGG - Intronic
1158075550 18:53523902-53523924 GAAAAAAAGAAGGGGGAGGCAGG + Intronic
1158499059 18:57983547-57983569 AAGAAAAAGAAGGGAGAGGGAGG + Intergenic
1159169709 18:64749998-64750020 CAGAAAAAGAAGGTAAAGGGAGG - Intergenic
1159799066 18:72874324-72874346 CAGAAAAAAAAAGGGGTGGTAGG + Intergenic
1159971909 18:74665784-74665806 AAGAAAAAGAAAGGTGAGTCTGG - Intronic
1160235720 18:77084938-77084960 CACATTAAGAAGGGGGAGGGGGG + Intronic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160411564 18:78678541-78678563 CAGCAGAAGATGGAGGAGGCAGG - Intergenic
1160443156 18:78907956-78907978 AAAAAAAAGCGGGGGGAGGCTGG + Intergenic
1160470627 18:79129499-79129521 GAGAAAAAGGAGGGGCAGGGGGG - Intronic
1160755021 19:752523-752545 CAAAAAAAAAAGCGGGGGGCGGG + Intronic
1160925361 19:1542280-1542302 AAGAAAAAGAAGGAGAAGGAAGG - Intergenic
1160951566 19:1670010-1670032 GAGAGAGAGAAGGGGGAGGGAGG - Intergenic
1160999108 19:1900394-1900416 ATGTAAAAGAAAGGGGAGGCCGG + Intergenic
1160999177 19:1900858-1900880 AAGAAAAAGAAGGGAAAGGAGGG + Intergenic
1161236268 19:3199678-3199700 AAAAAAAAAAAGGAGGAGGCAGG - Intronic
1161302978 19:3551830-3551852 CAGAGAGAGAAGGGGGAGAGAGG - Intronic
1161819295 19:6519585-6519607 AATAAAAACAAGGGGCAGGCAGG - Intergenic
1161908412 19:7174754-7174776 GAGAAAGAGAAAGGGGAGGGGGG + Intronic
1162157794 19:8691439-8691461 CAGAAAGGGAAGAGGGAGGGAGG - Intergenic
1162251908 19:9452079-9452101 CAAAAAAAAAAGTGGGGGGCAGG + Intergenic
1162406731 19:10479357-10479379 CAGGAAAAGAAGGACGACGCTGG - Intergenic
1162717461 19:12642932-12642954 TAGAAAAATTAGGGAGAGGCTGG + Intergenic
1162924289 19:13922296-13922318 GTGAAAGAGAAGGGGCAGGCCGG - Intronic
1162959353 19:14117191-14117213 CAGGAAAGGAGGGGGTAGGCTGG + Intronic
1162984639 19:14261746-14261768 GAGAAAGACAAGAGGGAGGCTGG - Intergenic
1163063446 19:14776275-14776297 GAGAGAAAGAAGGGAGAAGCTGG + Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163126170 19:15245384-15245406 GAGAAAAAAAAGGAGCAGGCTGG + Intronic
1163501598 19:17679719-17679741 GAGAAATAGAACGGGGAGGAGGG - Intronic
1163531482 19:17851966-17851988 AAGAAAAAGCAGGCTGAGGCAGG + Intergenic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164320429 19:24139318-24139340 AAGAAAAAGAATGGGTAGCCTGG + Intergenic
1164664781 19:30021240-30021262 GAGACCCAGAAGGGGGAGGCCGG - Intergenic
1164858638 19:31544969-31544991 GAGAAAGAGAAGGAGGAGGAGGG - Intergenic
1164918320 19:32069886-32069908 GAGAAAAAGATTGGGGAGGGCGG - Intergenic
1165074225 19:33272001-33272023 CAGAAAAACAGAGAGGAGGCGGG - Intergenic
1165168660 19:33875154-33875176 CAGAGAAAGAAGGCCGAGGCAGG - Intergenic
1165375053 19:35435977-35435999 CAGAAAAACAGGGGGCAGGGAGG - Intergenic
1165409651 19:35651424-35651446 CAGAATAAAAGGGAGGAGGCTGG - Intronic
1165463532 19:35958804-35958826 CAGAAAAAGAAAAGGAAGGAAGG + Intergenic
1165941820 19:39418280-39418302 AAGAAAAAAAAGGAGAAGGCTGG + Intronic
1166109647 19:40614221-40614243 GAGAGTCAGAAGGGGGAGGCCGG - Intronic
1166140368 19:40802161-40802183 GAGAAGCAGAAGGGGGAGGGTGG + Intronic
1166256611 19:41610617-41610639 CAGTCAAAGAGTGGGGAGGCAGG - Intronic
1166309141 19:41952577-41952599 CTCAAAAAGAAGGCGGGGGCGGG - Intergenic
1166328376 19:42065097-42065119 AACACAAAGAAGGGGGAGGATGG + Intronic
1166344030 19:42154186-42154208 CAGGAAAAAAAGGGGGGGACAGG + Intronic
1166500927 19:43340690-43340712 CAGAAACAGAAAGAAGAGGCTGG - Intergenic
1166509170 19:43392760-43392782 CAGAAACAGAAAGAAGAGGCTGG + Intergenic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1166799628 19:45448549-45448571 GAAAAAAAGAAGAGAGAGGCTGG + Intronic
1166966023 19:46529646-46529668 CAGAATAAGAAGGGGAGGGAGGG + Intronic
1166979220 19:46622948-46622970 AAGAAAAAGAAAGGCGAGGCAGG - Intronic
1167108322 19:47444187-47444209 CAGATAAAGAAGGGCGGGCCAGG - Intronic
1167308942 19:48725283-48725305 AAGAAAAAGAATGGAGAGTCAGG + Intronic
1167448948 19:49556100-49556122 TTGAAAAGGAAGGAGGAGGCGGG + Intronic
1167474888 19:49694328-49694350 CAGTTAAATAAGGGGGTGGCAGG + Intronic
1168197059 19:54782768-54782790 CAGAAAAAGCAGGAGAAAGCTGG + Intronic
1168236745 19:55068537-55068559 CAAAAAAAGAAAGAGGAGGCCGG + Intronic
1202672033 1_KI270709v1_random:63990-64012 AAGAAAAGGAGGGGGGAGGGCGG + Intergenic
925058975 2:876457-876479 CAGAAGATGAAGGGGGTGTCTGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925553457 2:5101991-5102013 TAGAAGGAGAAGGGGGAGGAGGG + Intergenic
925579939 2:5400189-5400211 TAGAAAAAAAAGGTGGAGGAAGG - Intergenic
925799457 2:7583496-7583518 AGGAAAAAGAAGGGAAAGGCAGG + Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926156345 2:10456099-10456121 CATAAAAAGATGGGGGACGATGG + Intergenic
926511189 2:13781529-13781551 CAGGGAGAGAAAGGGGAGGCAGG - Intergenic
926670053 2:15568647-15568669 AAAAAAAAAAAGGGGGAGGTTGG - Intergenic
926948583 2:18216492-18216514 AAAAAAAAGGAGTGGGAGGCGGG + Intronic
927095474 2:19744836-19744858 CAGAAAGGGAAGGGCGAGCCAGG + Intergenic
927278027 2:21278412-21278434 CAGAAATGGAGGGGAGAGGCTGG - Intergenic
927488384 2:23504662-23504684 CAGAAAAAGAAGCTGGAGCAAGG + Intronic
927534679 2:23846038-23846060 CAGACACAGGAGGGTGAGGCGGG + Intronic
927534746 2:23846580-23846602 CAGACACAGGAGGGTGAGGCGGG + Intronic
927534813 2:23847122-23847144 CAGACACAGGAGGGTGAGGCGGG + Intronic
927562196 2:24081989-24082011 AAGAAAAAGAAAGAGTAGGCTGG - Intronic
927584105 2:24282964-24282986 GAGAAAAGAAAGGAGGAGGCAGG - Intronic
927659517 2:24981048-24981070 GAGAAGAAGGAGGGGGAGGGGGG + Intergenic
927802969 2:26118312-26118334 CTCAAAAAAAAGGGGGAGGAGGG - Intronic
927821412 2:26268848-26268870 TAGAAAAAGCAGGGGAAGGCTGG + Intronic
928496399 2:31837524-31837546 AAAAAAAAAAAGGGGGAGGGAGG - Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929258512 2:39839394-39839416 CAGGAAGAGAATAGGGAGGCTGG - Intergenic
929584601 2:43105897-43105919 CAGACAAGAAAGGGGGAGGTGGG - Intergenic
929720640 2:44363674-44363696 AAAAAAAAGAAGGGGGTTGCCGG - Intronic
929862969 2:45694959-45694981 CTGAAGGAGAAGGGAGAGGCAGG - Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930941049 2:57014557-57014579 CAGAAAGATAAAGGGGAAGCAGG - Intergenic
931037540 2:58260261-58260283 CAGAAAAAAAAGGGGGTGGGTGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931634303 2:64328022-64328044 GGGGAAAAGAACGGGGAGGCTGG + Intergenic
932327416 2:70872278-70872300 CAGGAAAAGGAGGGTGGGGCAGG + Intergenic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
932929026 2:76011749-76011771 AGGAACAAAAAGGGGGAGGCAGG + Intergenic
933200573 2:79443389-79443411 CAGAAAAAAAAAGTGGAGGAAGG - Intronic
933236645 2:79871556-79871578 CAGAACAAAAAGGTGGAGGAAGG - Intronic
933281085 2:80333604-80333626 AAGAAAAAAAAGGTGGTGGCTGG - Intronic
933369303 2:81395065-81395087 AAAATAAAGAAGGGGGAGGGAGG + Intergenic
933912239 2:86951850-86951872 CAGGAAATTAAGAGGGAGGCAGG + Intronic
934010755 2:87818047-87818069 CAGGAAATTAAGAGGGAGGCAGG - Intronic
934033087 2:88065280-88065302 CAGAAAAAAAAGAGGGAAGGGGG - Intergenic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
934704898 2:96470638-96470660 CAGAAGAAGACTGGGGAGGCAGG + Intergenic
934727363 2:96632351-96632373 CAGAAACTGAAGTGGGAGGATGG + Intronic
934890478 2:98064166-98064188 CTGACAAAAAAGGGGGGGGCAGG - Intergenic
934904528 2:98187168-98187190 CAGAGAAAGAGGGGAGAGACCGG - Intronic
935505604 2:103898381-103898403 AAGAGAAAGAAGGAGGAGTCTGG + Intergenic
935681763 2:105644405-105644427 GAGAAATTGGAGGGGGAGGCAGG + Intergenic
935756348 2:106278837-106278859 GAGAAGCATAAGGGGGAGGCAGG - Intergenic
935774323 2:106458748-106458770 CAGGAAATTAAGAGGGAGGCAGG - Intronic
935801396 2:106700312-106700334 AAAAAAAAAAAGGGGGAGGAAGG + Intergenic
935905745 2:107837165-107837187 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936071732 2:109375732-109375754 CAGAAAGAGAGGGGGGCTGCAGG - Intronic
936113132 2:109681640-109681662 GAGAAGCATAAGGGGGAGGCAGG + Intergenic
936127542 2:109802346-109802368 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936133679 2:109870194-109870216 AAGAAAAAAAAGGGGGGGCCAGG + Intergenic
936211018 2:110501291-110501313 AAGAAAAAAAAGGGGGGGCCAGG - Intergenic
936217155 2:110569139-110569161 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936256640 2:110921389-110921411 CAAAAAAAAAAGGGGGGGGGGGG - Intronic
936426295 2:112423722-112423744 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936697265 2:114965680-114965702 CAGAAAGATAAAGAGGAGGCCGG + Intronic
937098110 2:119248711-119248733 CTGAACAAGGAGGGGGTGGCAGG + Intronic
937221417 2:120344937-120344959 CAGAAAAAAGGGGGGGAGGGAGG - Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937569537 2:123339070-123339092 CTGAAAAAGATGGGGAAGGTTGG + Intergenic
937619608 2:123970675-123970697 AAGAAAAAGAAGGGAAAGGAAGG + Intergenic
937837937 2:126492857-126492879 AAAAAAAAGAAATGGGAGGCCGG + Intergenic
937868711 2:126772499-126772521 CAGAAGGAGAAGGGGGAGCCAGG + Intergenic
938070108 2:128303942-128303964 CAGAACAGGAAGGTGGAGGAAGG + Intronic
938126833 2:128680341-128680363 AAGAAAGAGAGGGGGGAGGGAGG - Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
938610129 2:132938758-132938780 TAGAGAAAGAAGGGGGAGAGAGG + Intronic
938657418 2:133448253-133448275 AAAAAAAAAAAGAGGGAGGCGGG + Intronic
938839644 2:135147613-135147635 CAAAAAAAAAAGGGGGGGGGAGG - Intronic
939113863 2:138038786-138038808 CAGAATTAGAAGGGGGAAGTGGG - Intergenic
939429467 2:142084276-142084298 ATGAAAAAGAAGAGTGAGGCTGG - Intronic
939501263 2:142987949-142987971 CAGAGGGTGAAGGGGGAGGCAGG - Intronic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
940127917 2:150347690-150347712 GAGAAAAAGAAGGGGGGTGGGGG + Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940221756 2:151359993-151360015 CTGAAAAAGAAGGGAAAGGAAGG + Intronic
940339692 2:152567278-152567300 GAGCAAATGAAAGGGGAGGCTGG - Intronic
940727371 2:157349696-157349718 TTGAAAAAGAAATGGGAGGCAGG - Intergenic
940742955 2:157532821-157532843 CAGAAAAGGAAGAGGAAGGAAGG - Exonic
940832875 2:158487794-158487816 AAGAGAGAGAAGGGGGAGGGAGG + Intronic
940881171 2:158948052-158948074 AAAAAAAAAAAGGGAGAGGCAGG + Intergenic
940881907 2:158955062-158955084 TAAAAAAAAAAGAGGGAGGCTGG - Intergenic
941101802 2:161304825-161304847 CAGTAACAGAAGGGAGAGGAAGG - Intergenic
941697899 2:168573011-168573033 GAGAAGAGGAAGGAGGAGGCAGG + Intronic
941726139 2:168862745-168862767 CACATAAAGAAGGTTGAGGCTGG - Intronic
942045108 2:172095476-172095498 CAGGAAAAGAAAGTGCAGGCAGG - Intergenic
942074309 2:172342560-172342582 TATAAAAAGGAGGGGGAGGGAGG - Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942465441 2:176202985-176203007 CACAAAATGAAGCGGCAGGCTGG + Intergenic
942544928 2:177053687-177053709 CTTAAAAAGAAGCAGGAGGCCGG - Intergenic
943867314 2:192942981-192943003 CAGAAAGAAAAGGGGGGGGGGGG - Intergenic
943953760 2:194160891-194160913 CAGAGAAAGAAGGGAAATGCTGG - Intergenic
944022499 2:195123863-195123885 CAGAAAAGGAAGGGAGATGCAGG + Intergenic
944399381 2:199307899-199307921 AAGAAAAAGAAAGTTGAGGCAGG - Intronic
944653400 2:201854834-201854856 AAGAAAAAGAAAGGTGAGGTGGG - Intronic
944674515 2:202023913-202023935 TAGAATAATAAGGGGGAGGCAGG + Intergenic
944740697 2:202609369-202609391 CAGAATAAGAAGGGGAAGTTTGG + Intergenic
944747396 2:202672206-202672228 AACAAAAAGGAGGGGGAGGCAGG - Intronic
945070125 2:205981077-205981099 CAGAGAAAGAAATGGAAGGCCGG + Intergenic
945326614 2:208489478-208489500 AAGTAAAAGAAGGTGAAGGCAGG + Intronic
945461448 2:210113981-210114003 CAGAAAAAGAAGAGAAAGACAGG + Intronic
945892960 2:215449681-215449703 CACAAAAACAAAGGGTAGGCTGG - Intergenic
945963860 2:216164669-216164691 TAGAAGAAGAGGGGAGAGGCAGG + Intronic
946168173 2:217877973-217877995 CTGAAATAGAAGAGGTAGGCAGG + Intronic
946173527 2:217909148-217909170 CTGGAAAAGAAGGGAGAGGCTGG - Intronic
946320796 2:218953359-218953381 CAGCCACAGAAGGGGCAGGCTGG + Intergenic
946725764 2:222659835-222659857 GAGAATAAAAAGGGGGAGGAAGG - Intergenic
947147020 2:227077703-227077725 AAAAAAAAGAAGGAGGAGGGAGG + Intronic
947318786 2:228894567-228894589 AAGAAGAATAAGGGAGAGGCCGG - Intronic
947400324 2:229725178-229725200 GAGAGAAAGAAGGGAGAGGAAGG + Intergenic
947435593 2:230069326-230069348 CAGAAAGAGCAGGGAGAGGTGGG - Intergenic
947530868 2:230907938-230907960 CAGAGAAAGAAGTGGGAGGAGGG + Exonic
947951997 2:234156205-234156227 AAGAAAGAGGAGGGGGAGGAGGG - Intergenic
947972381 2:234335015-234335037 CAGAGAAGGAAAGGGCAGGCTGG + Intergenic
948025781 2:234775092-234775114 GAGGAAGAGAAGGGGGAGGAGGG + Intergenic
948158135 2:235801103-235801125 TAGCAAAAGCAAGGGGAGGCTGG - Intronic
948199884 2:236121950-236121972 CCCAAAAAGAAGGGGGTGGGGGG - Intronic
948497908 2:238366081-238366103 CAGAAATACAAAGGGGTGGCAGG + Intronic
948838298 2:240636793-240636815 CAGGAACAGAAGGGGGAGGGTGG - Intergenic
948930414 2:241128312-241128334 CCGAAAAAGAGAGAGGAGGCTGG + Intronic
948999835 2:241606984-241607006 GAGAAAATGAAAGGGGATGCAGG + Intronic
949007876 2:241660330-241660352 AAGAAACAGAATGGAGAGGCAGG - Intronic
1168840677 20:908109-908131 CAGACAAAGATGGTGGAAGCTGG + Intronic
1169009847 20:2241368-2241390 AAGAAAAAGAGGGAGGAGGGAGG - Intergenic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1169506463 20:6216541-6216563 GAGGAAGAGAAGAGGGAGGCAGG + Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1170564468 20:17589205-17589227 AAAAAAAAGTAGGGGGAGGGAGG - Intronic
1170577894 20:17678401-17678423 AAGAAAAAGGAGTGGGAGGGGGG - Intronic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170819712 20:19746566-19746588 TAGAGAAAGAAGAGGGAGGCTGG + Intergenic
1170841127 20:19925033-19925055 CACAAAGAGGTGGGGGAGGCCGG - Intronic
1170915883 20:20625033-20625055 CAGAAAAGCAAGAGGGAGGGAGG - Intronic
1170939013 20:20833309-20833331 GAGAATATGCAGGGGGAGGCGGG - Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171388870 20:24788185-24788207 GAGACTCAGAAGGGGGAGGCTGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172139707 20:32713817-32713839 GGGTATAAGAAGGGGGAGGCTGG + Intronic
1172254501 20:33505485-33505507 TAGAAATAGAAGGGGTCGGCCGG + Intronic
1172259689 20:33551909-33551931 CAGAAAAAAAAAGGGCAGGGAGG - Intronic
1172403297 20:34668473-34668495 AAAAAAAAAAAGGGGGGGGCGGG + Intronic
1172442609 20:34976741-34976763 CAGAAAGAGGATGGGGAGGGAGG + Intronic
1172733882 20:37111206-37111228 CAAGAATAGGAGGGGGAGGCTGG + Intronic
1172766876 20:37355755-37355777 AAAAAAAAGAAGGGTGAGGGTGG + Intronic
1172920848 20:38480732-38480754 AAAAAAAAAAAGGGGGGGGCGGG - Intronic
1173111960 20:40199424-40199446 CAGAAATATAAGGAGGAGACAGG - Intergenic
1173348184 20:42220413-42220435 CCAAAAAAGAACAGGGAGGCAGG + Intronic
1173482684 20:43415920-43415942 CAGATCCAGATGGGGGAGGCGGG - Intergenic
1173852358 20:46227281-46227303 CAGAAAAGGAATGGGGTGGGGGG - Intronic
1173919125 20:46730868-46730890 CAGAAACAGAATGGGCAGTCAGG - Intronic
1174813315 20:53665829-53665851 CAAAAAAAAAAGGAAGAGGCCGG - Intergenic
1174833987 20:53839041-53839063 TAAAAAAAAAAGGGGGGGGCCGG + Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175141644 20:56865060-56865082 ATGGAAAAGCAGGGGGAGGCTGG + Intergenic
1175170767 20:57079892-57079914 CAGGGAAGGAAGGGGGAGGCAGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175446154 20:59021144-59021166 CACACAGAGAAGTGGGAGGCAGG + Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175780018 20:61676406-61676428 CTGAAAAAGAAGGTGGATGGGGG + Intronic
1176235106 20:64050287-64050309 CACAAAGAGAAGGGGGAGCAGGG + Intronic
1176383375 21:6124978-6125000 CAGAGACAGAAGGGGGAGTGGGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177668564 21:24194723-24194745 AATAAAAAGAAGGGGAAGCCAGG + Intergenic
1177923339 21:27182610-27182632 CAGAACAAAAAGGTGGAGGGAGG - Intergenic
1177927653 21:27238536-27238558 AAGAAAGAAAAGGGGAAGGCAGG - Intergenic
1178168545 21:30010777-30010799 GGGATAAAGAAGTGGGAGGCTGG - Intergenic
1178285347 21:31321131-31321153 CACAGAAAGAAGGGGGCGGGGGG + Intronic
1178426046 21:32479122-32479144 CAGAAACAGAAGGTGCAGGCTGG + Intronic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1178900118 21:36591787-36591809 CAGCAAAAAAAGGGGGTGGGAGG + Intergenic
1179095172 21:38307896-38307918 CAGAAAAAGAGAGATGAGGCTGG - Intergenic
1179370654 21:40803548-40803570 ACGAAAGAGAAGGGGGAGTCTGG - Intronic
1179488606 21:41726580-41726602 AAGAAGAAGAAGGGGGGGGGAGG - Intergenic
1179740093 21:43413261-43413283 CAGAGACAGAAGGGGGAGTGGGG - Intergenic
1179779105 21:43688085-43688107 CAGAAAAAGAAGGCAGGGCCCGG + Exonic
1180060009 21:45379935-45379957 CAGATAAACACGGGAGAGGCTGG - Intergenic
1180188004 21:46150000-46150022 AATAAAATGAAGGGGGAGGAGGG + Intronic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181268942 22:21647571-21647593 AAGAAAAAAAAGGGGGGGGGGGG + Intergenic
1181562842 22:23715631-23715653 CAGAAAAAGAGGATGTAGGCTGG + Intergenic
1182047223 22:27284830-27284852 CAGACAACAAAGGTGGAGGCAGG - Intergenic
1182453061 22:30432623-30432645 CAGGGAAATAAGGGGGGGGCGGG - Intergenic
1182550931 22:31100417-31100439 CAGAAAGAGAAGGGGAAAGAAGG - Intronic
1182578489 22:31289928-31289950 CAGATAAAGACGTGGGAGGTAGG - Intronic
1182768674 22:32777372-32777394 AAAAAAAAGAAGGAGCAGGCTGG - Intronic
1183032275 22:35115168-35115190 TAGAAAAGGAAGGTGGTGGCTGG + Intergenic
1183036737 22:35146288-35146310 AAGAAAGAAAAGGGAGAGGCAGG + Intergenic
1183221264 22:36514975-36514997 GAGAAAGAGAGGGGGGAGGTTGG - Intronic
1183346736 22:37312271-37312293 CAGAAACAGGAGGGAGAGACTGG - Intronic
1183385432 22:37511457-37511479 GAGAAGGAGAAGGAGGAGGCGGG + Intronic
1183593973 22:38798553-38798575 AAGAAGAAGATGGGGGAGCCCGG - Intergenic
1183949107 22:41342874-41342896 TAGAAAAAGGATGGGTAGGCCGG + Intronic
1184357799 22:43994256-43994278 CAGGAACAGAAGGGGGAGTGGGG + Intronic
1184553084 22:45215877-45215899 AAGAAAGGGAACGGGGAGGCGGG + Intronic
1184995619 22:48205472-48205494 CATAAATAGAAGGGGAAGGAGGG + Intergenic
1185006033 22:48277460-48277482 CAGAAGAAGGTGGGAGAGGCTGG + Intergenic
1185009111 22:48303254-48303276 CAGCAAATGTAGGCGGAGGCTGG - Intergenic
1185191394 22:49438703-49438725 CAGAAGATGAAGGGCGAGGGAGG - Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949502323 3:4692822-4692844 CATAAAAATAAGATGGAGGCAGG + Intronic
950058727 3:10051082-10051104 CAAAAAAAAAAGAGTGAGGCCGG + Intronic
950317246 3:12013953-12013975 AAGAAAAGGAAAGGGGAGGAAGG - Intronic
950395659 3:12732018-12732040 AAAAAAAAGAAGTGAGAGGCTGG - Intergenic
950419389 3:12888885-12888907 CATAAAAAGCATTGGGAGGCAGG + Intergenic
950699037 3:14727409-14727431 CACAAAAAGAAGGGAGGAGCAGG - Intronic
950735553 3:15005047-15005069 CATAATAAGAAAGGGGTGGCTGG - Intronic
950798465 3:15530510-15530532 CAGAAGAAGACAGGGGAGGGTGG - Intergenic
951367913 3:21806980-21807002 CAGAAAAATAAGAGGGAAGTTGG - Intronic
951449238 3:22818251-22818273 CAGAAAACAAAGGGGGAGTGAGG + Intergenic
951523402 3:23630449-23630471 AAGAAAAAGAAGTGGAAGGAAGG + Intergenic
951542178 3:23792317-23792339 TTGAAACAGAAGGGGAAGGCAGG + Intergenic
951661313 3:25069697-25069719 CTGAAAGCGGAGGGGGAGGCAGG + Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952210742 3:31226765-31226787 CAGCAAGAGAAGGAGCAGGCAGG + Intergenic
952405019 3:32997724-32997746 CAGAAAAGTCAGGGAGAGGCTGG - Intronic
952749614 3:36814728-36814750 GAGAAAAAAGAGGGGAAGGCTGG - Intergenic
952803099 3:37316176-37316198 CAGAAAAAAATGGGTGAGGAAGG - Intronic
952882100 3:37991514-37991536 AAGAAGAACCAGGGGGAGGCAGG + Intronic
952949922 3:38514764-38514786 AAAAAAAAGCAGGGGGAGGGGGG - Intronic
953127491 3:40105763-40105785 CAGAGAGAGAAGAGTGAGGCAGG + Intronic
953306127 3:41831314-41831336 CATAAAAAGAAGAGGGAGCAGGG + Intronic
953410173 3:42686426-42686448 AAGAAAAAGAAGGGGAAGGATGG + Exonic
953559642 3:43976691-43976713 CAGAAAAAGGTGGGGCAGGCCGG - Intergenic
953914336 3:46909019-46909041 TAGATACAGAAGGGGCAGGCTGG + Intergenic
954015594 3:47687382-47687404 CAGAAAAAACAGGAAGAGGCTGG + Intronic
954095435 3:48322630-48322652 CAGAAACAGAAAGTAGAGGCTGG - Intronic
954259542 3:49428729-49428751 AAAAAAAAAAATGGGGAGGCAGG + Intronic
954319642 3:49822990-49823012 AAAAAAAAGGAGGGGGAGCCAGG + Intergenic
954322949 3:49844367-49844389 CAGAAAAAGAGAGGGAAGGGAGG - Intronic
954562109 3:51565825-51565847 CAAAAAAAAAAGGGGGGGGTGGG - Intronic
954631223 3:52048590-52048612 CAGACAATGAAGGGCGAGTCAGG + Intergenic
954912745 3:54122542-54122564 CAGAAAAAGGAGCGGGTGGGGGG - Intronic
955002778 3:54942591-54942613 AAGAAAAAGAAGCAGGAGCCAGG + Intronic
955160286 3:56458736-56458758 GAAACAAAGAAGGGGGAGGAGGG + Intronic
955301056 3:57780139-57780161 AAAAAAAAGAAGGGAGGGGCAGG - Intronic
955318602 3:57958844-57958866 CAGAAAAAGAATGAGGAAGGAGG - Intergenic
955358349 3:58250556-58250578 CAGAAACAGGAGGGAGAGGAAGG + Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955534719 3:59910645-59910667 AAGAAAAAATAGGGGGAGGAAGG + Intronic
955555706 3:60134966-60134988 CAGGAAAAAAGGGGGGAGGGAGG + Intronic
955602699 3:60664430-60664452 AAGAGGAAGAAGGGGGAGGGAGG - Intronic
955875922 3:63490295-63490317 CTGAAAAAGGAGGCAGAGGCTGG + Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956296037 3:67714610-67714632 AAGCAAAAAAAGTGGGAGGCAGG + Intergenic
956304227 3:67806089-67806111 CAGAAAAAGAAGGAAGAGAAAGG - Intergenic
956603606 3:71049629-71049651 CAGGAAAAAAAGGGGGTGGGGGG + Intronic
956753933 3:72367181-72367203 AAGAAAGAGAAGGGGAAGGAAGG + Intergenic
956837136 3:73104513-73104535 CAGAAACAGAGGAGGGAGACTGG - Intergenic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
957443912 3:80290956-80290978 CAGAAGGAGAAGGGGGAGCAAGG + Intergenic
957883084 3:86247995-86248017 AAAAAAAAAAAGGAGGAGGCCGG + Intergenic
958481670 3:94652108-94652130 CATAAAAACAAGTGGGAGGTAGG + Intergenic
959166965 3:102792512-102792534 AAGAAAAAGAAGGAGGAGTGAGG + Intergenic
959221681 3:103529507-103529529 TAGAACAAAAAGGGGGAGGAAGG - Intergenic
959814313 3:110657796-110657818 CAGAAAAAGAAGATTGATGCTGG + Intergenic
959849035 3:111066864-111066886 GTGTAAAAGAAGTGGGAGGCTGG + Intergenic
960362575 3:116731817-116731839 GAGAAAGAGAGAGGGGAGGCGGG + Intronic
960418603 3:117415600-117415622 GGGAAGAAGAAGGGGGAGGAAGG - Intergenic
960496371 3:118380352-118380374 AGGAAAAGGAAGGGGGAGGCAGG + Intergenic
960508792 3:118524201-118524223 GAGAAAAAGATGAGTGAGGCCGG - Intergenic
960582825 3:119295028-119295050 AACAAAAAGAAGGTGGGGGCGGG - Intronic
960982500 3:123243534-123243556 AAGATAAAGTAGGGGGAGGGTGG - Intronic
961115169 3:124323217-124323239 ATGAAAAAGGATGGGGAGGCTGG - Intronic
961561277 3:127732093-127732115 AAAAAAGGGAAGGGGGAGGCTGG - Intronic
961699331 3:128729946-128729968 CAAAAAATAAGGGGGGAGGCGGG - Intronic
961930894 3:130531591-130531613 CAGAAGCTCAAGGGGGAGGCAGG - Intergenic
962210894 3:133476683-133476705 CAGAAAACAAAGTGGGTGGCTGG + Intergenic
962257143 3:133880300-133880322 TAGGAAAAGAAGGCTGAGGCAGG + Intronic
962390649 3:134969385-134969407 AAGGAAAAGAAGGGGAAGGAAGG + Intronic
962390953 3:134972208-134972230 AAGGAAAAGAAGGGGAAGGAAGG - Intronic
962468913 3:135687679-135687701 CAGAAGAAGAAGGGTATGGCAGG + Intergenic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
963168918 3:142231730-142231752 AAGAAAAGGAAGGGGAAGGAAGG + Intergenic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
964436903 3:156663229-156663251 CAAAAAAAAAAGGGAGAGGGAGG - Intergenic
964564320 3:158033118-158033140 AAGAAAAAGAAGGGTGGGGGAGG + Intergenic
964736183 3:159920974-159920996 CAAAAATAGAAGGAGGAGGAAGG + Intergenic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965232270 3:166070007-166070029 TAGAAATAGAAGGTAGAGGCTGG + Intergenic
965380450 3:167981678-167981700 AAGAAGAAGAAGAGGGAGACAGG - Intergenic
965616554 3:170599414-170599436 CAGAAAAAGAAGTTGAAGGCAGG - Intronic
965722846 3:171680528-171680550 TAGAAAAAGACAGGAGAGGCCGG - Intronic
965961270 3:174431088-174431110 CAGACAAACAAGGGGAAGTCAGG + Intergenic
965986117 3:174755211-174755233 CAGAAGATGAAGGGGAAGCCAGG - Intronic
966430834 3:179830283-179830305 CATAAAAAAAAGGGGGGGGGCGG - Intronic
966770409 3:183498981-183499003 CAGAAAAAGAAGAGGGAAAGTGG - Intronic
966888649 3:184390403-184390425 TAGACAAAGAAGGTAGAGGCTGG - Intronic
967032001 3:185616483-185616505 AAAAAAAAGAAGGGCCAGGCTGG + Intronic
967326443 3:188245106-188245128 AAGAAAAAAAAGGCGGGGGCAGG - Intronic
967418207 3:189243187-189243209 CAGAAAACAAAGGGGGAGTGAGG + Intronic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
968020068 3:195378045-195378067 GTGAAAAAGAAGAGGGAGGGAGG + Intronic
968037021 3:195556067-195556089 CAAAAATTGAAGGGGGAGGCCGG - Intergenic
968167567 3:196479595-196479617 CAAAAAAAAAAGCGTGAGGCTGG - Intronic
968177509 3:196563866-196563888 GACTAAAAGTAGGGGGAGGCTGG - Intronic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968282827 3:197490058-197490080 CAGAAAAAGTAGAGGGAGCTGGG - Intergenic
968441702 4:627693-627715 CAGAAAAGGAGGGAGGAGGGTGG - Intronic
968488929 4:879759-879781 CAGAAAGGGAAGAGGGAAGCGGG - Intronic
968782746 4:2595343-2595365 CAGAAAAAGAAACTGAAGGCTGG - Intronic
969190703 4:5516400-5516422 AAGAAAAAAAAGGGGGAAACAGG - Intergenic
969261188 4:6035152-6035174 GGAAAAAAGAAGGGGGATGCGGG - Intronic
969362189 4:6672016-6672038 GGAAAAAAGTAGGGGGAGGCTGG + Intergenic
969651214 4:8469378-8469400 CAGAGGAAGAAGGCTGAGGCTGG + Intronic
969779292 4:9384808-9384830 AGGAACCAGAAGGGGGAGGCAGG - Intronic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
971439173 4:26661320-26661342 AGGAAAAAGAAGGTGGAGGGTGG - Intronic
971881169 4:32375261-32375283 AAGATGAAGAAGGGGGAGGAGGG - Intergenic
972037176 4:34539618-34539640 CACAAAGAGAAGGAGGAGGTGGG - Intergenic
973113781 4:46428993-46429015 CAGAAAAAAATGGGAGAGCCTGG - Intronic
973284122 4:48396262-48396284 AAGGTAAAGAAGGGGGAGGAGGG + Intronic
973314978 4:48750162-48750184 AAGAAAAAAAAGGAAGAGGCTGG + Intronic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973723242 4:53746481-53746503 TAGGAAAAAAAGTGGGAGGCAGG + Intronic
973765367 4:54157165-54157187 AAGAAAAAGGGGGGGGAGGAAGG + Intronic
973765386 4:54157210-54157232 AAGAAAAAGGGGGGGGAGGAAGG + Intronic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974499247 4:62677506-62677528 GAGAGAAACAAGAGGGAGGCTGG - Intergenic
975067759 4:70089362-70089384 AGGAAAAAAAAGAGGGAGGCTGG + Intergenic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
975870018 4:78769633-78769655 AAAAAAAAGAAGAGGGAGGGCGG + Intergenic
976542116 4:86290225-86290247 CAGCAAAAGAAGAGGAAAGCTGG + Intronic
976838991 4:89408855-89408877 AAGAAATAGCACGGGGAGGCTGG - Intergenic
977091031 4:92676159-92676181 CAAAAAAAAAAGGGGGGGGGGGG - Intronic
978185135 4:105848578-105848600 CAAAAATAGAATGGGGAGCCGGG + Intronic
978386910 4:108185727-108185749 GAGAAAGAGAAGGGTGAGGATGG - Intergenic
978408499 4:108404793-108404815 CAGAAGGTGAAGGGGGAGCCAGG + Intergenic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
978719518 4:111890911-111890933 CAGAAAAAAAAGGGGGGGAGGGG + Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979277969 4:118835020-118835042 CTGAAAAAGAGGAGAGAGGCAGG + Intronic
979809451 4:125017383-125017405 CAGAAAGAGAGGGGGGCTGCTGG - Intergenic
980071465 4:128246818-128246840 AAGAAAAAGTAGGGGGAGGAAGG + Intergenic
980387687 4:132107592-132107614 CAAAAAAAGTAGGAGGTGGCGGG + Intergenic
980620381 4:135293975-135293997 CAGAAACAAAAGGGGAAGGCAGG - Intergenic
980717355 4:136644373-136644395 CAGGAAGAAAAGGGGGAGGTTGG - Intergenic
980962701 4:139492139-139492161 CAAAACAAGCAGGGTGAGGCTGG - Intergenic
981077826 4:140608317-140608339 CAGAAATAGAATGTGTAGGCTGG + Intergenic
981120041 4:141039344-141039366 TAGAGAAAGAAAGGGGAGGAAGG + Intronic
981120048 4:141039370-141039392 TAGAGAAAGAAAGGGGAGGGAGG + Intronic
981189866 4:141849935-141849957 CACAACAAAAAGTGGGAGGCAGG + Intergenic
981205901 4:142040095-142040117 AAGAAAAAGAAGGGAGAAGTGGG + Intronic
981900681 4:149858287-149858309 CAGAGACAAAAGGGGGAGGTGGG + Intergenic
982711296 4:158760954-158760976 CAAAAAGAGAAGGGGGAGTGGGG - Intergenic
982890363 4:160841330-160841352 CAGAAAAAGAAGGGGAAAAGTGG + Intergenic
983499689 4:168484585-168484607 AAGAAAAAGAAAGGAGAGGCTGG - Intronic
983538863 4:168887443-168887465 ATGAAAAAGAAAGGGGAGACAGG - Intronic
983731785 4:171003360-171003382 CAAAAAAGGAAAGGGTAGGCAGG - Intergenic
983935439 4:173499794-173499816 GAGAAAAAAAAGTGGGGGGCAGG + Intergenic
985196214 4:187432486-187432508 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985196228 4:187432555-187432577 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985276852 4:188245698-188245720 GAGAAAGAGCAGTGGGAGGCAGG + Intergenic
985323795 4:188744365-188744387 CAGAAAACTAAGGGGGAGGGTGG - Intergenic
985644213 5:1077501-1077523 CAGAGAAAGATGTGGCAGGCAGG + Intronic
985645169 5:1081540-1081562 AAGAAAGAGAAGGGGAAGCCTGG + Intronic
986248304 5:6031301-6031323 CAGAAAGTGAAGGGGGAGCAGGG - Intergenic
986310575 5:6547827-6547849 AAGAAAAGGAAGAGGGAGGCAGG + Intergenic
987197059 5:15537064-15537086 CAGAAAATGAAGGGGAAGCAAGG - Intronic
987508951 5:18810981-18811003 AAAAAAAAAAAGGGGGAGGGGGG - Intergenic
987590348 5:19917339-19917361 AAGAAAAAAAAGGGGGCGGGGGG - Intronic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988338709 5:29940603-29940625 CAGACATAGAAGGGATAGGCAGG + Intergenic
988474050 5:31566999-31567021 CAGTAAAAGACTGGGGAGGAAGG + Intergenic
988574883 5:32411988-32412010 CAAAAAAAGAAGTGGAAGGAGGG + Intronic
989087878 5:37695160-37695182 GAGTAAGAGAAGGGGGAGGGAGG + Intronic
989398643 5:40985370-40985392 GAGAAAAGAAAAGGGGAGGCAGG + Intergenic
989444364 5:41510356-41510378 CAGATAAAGCAGGGCGGGGCAGG + Intronic
990485644 5:56257296-56257318 AAGAAAGAGAGGGGGGAGGAAGG - Intergenic
990592581 5:57281418-57281440 TAGAAGCAGAAGAGGGAGGCAGG + Intergenic
990756210 5:59073488-59073510 CAGAAAATAAAGTGGGGGGCGGG + Intronic
991068295 5:62448009-62448031 CAGAAAACAAAGTGTGAGGCTGG - Intronic
991600567 5:68348049-68348071 CAGAAAAACAAGGGAGAGATTGG + Intergenic
991727860 5:69554228-69554250 CAGAAAAAAAATAGGGAGGCTGG - Exonic
991867097 5:71073648-71073670 CAGAAAAAAAATAGGGAGGCTGG + Intergenic
991927115 5:71716652-71716674 CAGATATAGAAAAGGGAGGCAGG - Intergenic
992008940 5:72508214-72508236 CGAAAAAAGATAGGGGAGGCAGG + Intergenic
992234921 5:74699264-74699286 AAGAAAAAAAAGGGGGTGGGGGG - Intronic
992313013 5:75522054-75522076 CAGAGACAGATGGGGAAGGCAGG - Intronic
992461295 5:76962626-76962648 AAAAAAAAAAAGGGGGAAGCAGG + Intronic
992530058 5:77644996-77645018 GAGAAAAAAAAGGGGGAGGAAGG - Intergenic
992660365 5:78954166-78954188 CAGAAAAAATAGGGGAAGGTGGG + Intronic
993100855 5:83538170-83538192 AAGAAAAGGAAGGAGGAGGAGGG + Exonic
993631726 5:90293936-90293958 AAGAAAAAGAAGTTTGAGGCTGG - Intergenic
994130836 5:96225884-96225906 GAGAAGAAGAATGGTGAGGCGGG - Intergenic
994457128 5:100025146-100025168 CAGAGACAGAAGGGGGATCCAGG + Intergenic
994520234 5:100824652-100824674 CTGAAAAAAAAGGTGGAGGGGGG + Intronic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995288680 5:110423155-110423177 CAGAATTAGAAGTGGGAGGATGG - Intronic
995917269 5:117262873-117262895 CAGAAAATGAAGGGGATGGGAGG + Intergenic
996165488 5:120217091-120217113 CAGAAAAAGAAAGAGATGGCAGG - Intergenic
996746773 5:126852885-126852907 CAAAAAGAGATGGGAGAGGCAGG + Intergenic
996780992 5:127186530-127186552 AAGAGAAAGAAGGGGTGGGCAGG + Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
997327812 5:133036534-133036556 CAGAGAAAGAAGGCTGAGGCAGG + Intergenic
997396879 5:133568052-133568074 CAGACAAAAATGGGGGAGGGAGG + Intronic
997413547 5:133708113-133708135 GAGAAAGAGAAGGGGGAGGGAGG + Intergenic
997623867 5:135318690-135318712 AAAAAAAAAAAGGGGGGGGCGGG + Intronic
997710145 5:135997120-135997142 CAGAAAAAGAACAGAGAGGATGG - Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
998062659 5:139131593-139131615 CAAAAAAAGAGGGGGGGAGCTGG - Intronic
998140408 5:139696875-139696897 CAGGAGCAGAACGGGGAGGCTGG + Intergenic
998142637 5:139708989-139709011 CAGAAAAAGGAAGCTGAGGCTGG - Intergenic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
998407852 5:141883892-141883914 CAGAGAAAGATGGGGAACGCGGG - Intergenic
998960384 5:147480221-147480243 CGCAAAAAGAAGCTGGAGGCCGG - Intronic
999135014 5:149312828-149312850 GAGAAAGAGAAGGAGTAGGCCGG + Intronic
999151498 5:149429249-149429271 CAGAAAGAGAAAGCAGAGGCAGG - Intergenic
999355880 5:150930136-150930158 TAGACAAACAAGGGGGAGGGAGG - Intergenic
999399839 5:151256032-151256054 CAGATAAAGATGGGGGTGGGGGG + Intronic
999674780 5:153987986-153988008 AAGAAAAGGAAGGAGGAGGCAGG - Intergenic
1000337531 5:160252960-160252982 CTGAAAAAGGAGGGGCAGCCTGG - Exonic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1000567484 5:162867711-162867733 CAGTAGATGAAGGGGGAAGCAGG - Intergenic
1000625168 5:163529942-163529964 AAAAAAAAGGAGGGGGAGGGAGG + Intergenic
1000856451 5:166404035-166404057 AAGAAGAAGAGGGGGGAGGGAGG - Intergenic
1001274453 5:170340261-170340283 TAGAAAGAGGAGAGGGAGGCTGG - Intergenic
1001445140 5:171777041-171777063 AAAAAAAAGGAGGGGGAAGCTGG - Intergenic
1001526544 5:172432915-172432937 CAAAAAAAAAAGGGGGGGGGGGG + Intronic
1001582164 5:172806289-172806311 CAGGAAGGGAAGGGGTAGGCAGG - Intergenic
1001690777 5:173631218-173631240 GAGAAAAAGAAGGGGGCAGTGGG - Intergenic
1001719974 5:173848796-173848818 AAGAAGAAGAAGCTGGAGGCAGG - Intergenic
1002201603 5:177531750-177531772 CAGAAAAACAAGTTGGAGCCCGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002286015 5:178163211-178163233 AAGAAAAAGAAGAGTGAGCCTGG + Intergenic
1002455033 5:179341223-179341245 CAGAAAAGGAAAGAAGAGGCCGG + Intronic
1002572428 5:180149970-180149992 CAGAAAAAGAAGGGAGAGAAAGG - Intronic
1002582809 5:180220359-180220381 CAGAAAAGGAAAGGGGAAGATGG + Intergenic
1002682929 5:180982155-180982177 CGGAAAGTGAAGGGAGAGGCTGG + Intergenic
1002942317 6:1728825-1728847 CAGAAAAAGAAAGAGGAGAAAGG - Intronic
1002976740 6:2086285-2086307 GAAAAGAAGAAAGGGGAGGCAGG - Intronic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003127364 6:3366032-3366054 CAGAAAGAGAAGGGTATGGCTGG + Intronic
1003514171 6:6804538-6804560 CAAAAGAAGAAGGGAGAGGGAGG - Intergenic
1003597900 6:7490837-7490859 CAGAAAAAAAAGGCGGATGGGGG - Intergenic
1003767100 6:9250667-9250689 TAGGAAAAGAAGGGAGAGGAAGG - Intergenic
1004166021 6:13257136-13257158 CAGAAAACAAAGGGGGAGTGAGG + Intronic
1004575921 6:16894740-16894762 TAGAAAAAGAAAAGGAAGGCCGG + Intergenic
1004801435 6:19152880-19152902 CAAAAAAAAAAGGGGGGGGGGGG + Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1005319792 6:24642013-24642035 CAGAAAGAGAAGGGGAGGGGAGG + Intronic
1005459438 6:26054528-26054550 AAGAAAGAGAAAGGGGAGGGAGG - Intergenic
1005487968 6:26319286-26319308 GAGAAAAATAAGGGAGTGGCTGG + Intergenic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006038178 6:31230489-31230511 CAGAAAAAGAAGGTTGATCCAGG + Intergenic
1006112158 6:31754020-31754042 AAAAAAAAAAAGAGGGAGGCCGG - Intronic
1006118720 6:31791213-31791235 TAGAAAAAGAAGGGAGAGACTGG + Intronic
1006201222 6:32293327-32293349 CAAGAAAAGAAGAGTGAGGCAGG - Exonic
1006315669 6:33290063-33290085 CAGAAAAGGATGGGGGCAGCGGG - Intronic
1006399171 6:33806206-33806228 TATAAAAAGAAGTGGCAGGCCGG - Intergenic
1006854561 6:37124039-37124061 AAGAAAAGGATGGGGGAGGAGGG + Intergenic
1006885372 6:37377371-37377393 GAGAATAAGAAGGGGTCGGCTGG - Intronic
1006924625 6:37647703-37647725 AAGAAAGAGAAGGGAGAGGAGGG + Intronic
1007081434 6:39107891-39107913 CAGATAAAGTAGGGCCAGGCAGG + Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007502118 6:42306300-42306322 CATCAAAAGAAGGGGGAGATTGG - Intronic
1007930884 6:45689756-45689778 CAAAAAAAGAAGAGGAAGGAAGG - Intergenic
1008038639 6:46774018-46774040 CAGAAAACTAAAAGGGAGGCTGG + Intergenic
1008383183 6:50856790-50856812 GACAAGAAGACGGGGGAGGCAGG - Intergenic
1008464319 6:51813864-51813886 AACAAAGAGAAGGGGAAGGCTGG - Intronic
1008935378 6:56986690-56986712 CAAGAAAAGAAGGTGGAGGAGGG - Intronic
1008979288 6:57464569-57464591 CAGAAATACAAAAGGGAGGCCGG - Intronic
1009323483 6:62320047-62320069 CAGAATAAAAAAGGTGAGGCAGG - Intergenic
1009440147 6:63668336-63668358 CTCAAAAAAAAGGGGGAGGGAGG - Intronic
1009679972 6:66880140-66880162 CAGAAAGCAAAAGGGGAGGCAGG + Intergenic
1009820930 6:68800215-68800237 CAGAAAAAGAAGAGGCAAGGAGG + Intronic
1010680009 6:78787842-78787864 AAAAAAAAAAAGGGGGAGGCGGG + Intergenic
1010808064 6:80262096-80262118 CAGAAAAACAAGTGGAAAGCTGG - Intronic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011050926 6:83149019-83149041 GAAAAAAAAAAGTGGGAGGCAGG + Intronic
1011085624 6:83537432-83537454 GAGAAAAAGAAAAGGGAGGGAGG - Intergenic
1011398539 6:86936348-86936370 CAGAAAGAAAAGTGTGAGGCAGG + Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012045479 6:94267110-94267132 CAGAAAGAATATGGGGAGGCAGG - Intergenic
1012257976 6:97056072-97056094 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
1012490433 6:99777740-99777762 AAAAAAAAAAAGGCGGAGGCAGG - Intergenic
1012637937 6:101570470-101570492 CAGGGGGAGAAGGGGGAGGCTGG - Intronic
1013300920 6:108804294-108804316 GAGAAACAGAAGGTGGAGGTAGG + Intergenic
1013516182 6:110888311-110888333 CAGAAAAAAAAAGGGGGGGAGGG - Intronic
1013639141 6:112056428-112056450 CATCAAAAGAAGGAGGAGGAGGG - Intronic
1013751386 6:113410746-113410768 GAGAAAAAGAAAGTGGAGGAGGG + Intergenic
1014190328 6:118488581-118488603 CAAAAAAGGAAGGGGGAGAAAGG + Intronic
1014453630 6:121611479-121611501 GAGAACAAGAAGGGGGAAGCAGG - Intergenic
1014677789 6:124389255-124389277 TAGAAAAAGTAGTGGGAGGTGGG - Intronic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1014925515 6:127266430-127266452 AAGAAAAAAAATGGGGAGGGGGG - Intergenic
1015141067 6:129932385-129932407 GAGAAAAAGAAAGAGGAGGGAGG + Intergenic
1015234114 6:130951255-130951277 AAAAAAAAGGAGGGGGAGGGGGG + Intronic
1015255305 6:131172622-131172644 TAGAAAAAGAAAGGAGGGGCTGG - Intronic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1015426909 6:133081655-133081677 TGGAAATAGAAAGGGGAGGCTGG - Intergenic
1015681854 6:135817560-135817582 CACAAAAAGCAGGGAGAGGGAGG - Intergenic
1016305293 6:142677823-142677845 CATAAAAAGGAGAGGCAGGCAGG - Intergenic
1016691987 6:146948744-146948766 TATAAATAGAAGAGGGAGGCAGG - Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017233498 6:152096741-152096763 AAGAAAAAGACAGGGGAGACTGG - Intronic
1017400219 6:154052604-154052626 CACAGAAAGAAGTGGTAGGCTGG + Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017875564 6:158521520-158521542 CAGAAAAAGAAGAGGAGGGGAGG + Intergenic
1018171382 6:161146013-161146035 CAGAACAAGTAGGGGGACCCTGG + Intronic
1018278273 6:162156580-162156602 CAGAAAATGAAAGAGCAGGCTGG - Intronic
1018285923 6:162237607-162237629 CACAAAAAGAAGGTGGAGAAAGG + Intronic
1018392517 6:163351235-163351257 GAGAAACGGAAAGGGGAGGCTGG - Intergenic
1018461690 6:164004773-164004795 AAGAAAAAGAAGAGGGAGGGAGG + Intergenic
1019224711 6:170500398-170500420 CAGAAACAGCAGGGGCAGGGGGG - Intergenic
1019227113 6:170522452-170522474 GAGAAAAAGAAGGCGGGGGACGG + Intergenic
1019404821 7:877705-877727 GAGAACAGGGAGGGGGAGGCCGG - Intronic
1019650729 7:2156519-2156541 CATAAATAGAGAGGGGAGGCTGG + Intronic
1020103806 7:5411239-5411261 AAGAAAAGGAAGGGGGAGGTGGG + Intronic
1020755911 7:12202833-12202855 CAAAATCTGAAGGGGGAGGCTGG - Intergenic
1020886822 7:13828535-13828557 TAGAAATAAAAGGGGAAGGCCGG - Intergenic
1020999490 7:15310963-15310985 TAGAAATGGAAGAGGGAGGCGGG - Intronic
1021165441 7:17333951-17333973 CAGAAAAAGAAAGGGAAAGATGG + Exonic
1021225822 7:18025099-18025121 AAGAAAAAGAAGGTGGAGCAGGG - Intergenic
1021786041 7:24153652-24153674 CAAAAAAAAAAGGGGGGGGGTGG - Intergenic
1021987782 7:26113930-26113952 CAAAAAAAAAAGGGGGGGTCTGG + Intergenic
1022636600 7:32142181-32142203 CAGAAGGAGAAGGGGGAAGGAGG + Intronic
1022721897 7:32948921-32948943 GAGAGAAAGACGGGGGATGCTGG + Intergenic
1022742711 7:33138339-33138361 CTGAAAAAGAAGGGGAAAACTGG + Intronic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1022857507 7:34329852-34329874 AAGAAAGAGAAGGCGGATGCAGG + Intergenic
1023147080 7:37161996-37162018 CACAAAAAAAAAGGGGAGGAGGG + Intronic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1023640386 7:42251173-42251195 CAGAAAAGGTTGGGGGCGGCTGG - Intergenic
1023795523 7:43788933-43788955 CTTAAAGAAAAGGGGGAGGCTGG - Intronic
1023866530 7:44241069-44241091 CAGGAAAAGAAGGGGCTGTCAGG - Intronic
1024365862 7:48519691-48519713 CATACATAGAAGGGGGATGCAGG - Intronic
1024667285 7:51559519-51559541 CAGAAAAAGAAATGTGGGGCTGG + Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1026201141 7:68215534-68215556 CAGCAAAAGATGGGGCATGCAGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026306449 7:69146340-69146362 GAAAAAAAGAAGAGGGAGGAAGG - Intergenic
1026738744 7:72965408-72965430 AAGAAAAAGAAAGGGGGGGCGGG + Intronic
1026907293 7:74069612-74069634 CACAAAAAGATGGGCGGGGCAGG - Intronic
1026963608 7:74425358-74425380 AAGAAAAAAAAGAGGGAGGGAGG + Intergenic
1026977007 7:74505179-74505201 CAGAAAATGAAGGCAGAGGCCGG - Intronic
1026979306 7:74517319-74517341 GAGAAAAAGATGGGAGAGGCTGG - Intronic
1027104990 7:75399661-75399683 AAGAAAAAGAAAGGGGGGGCGGG - Intronic
1027500907 7:78950080-78950102 GAGGAAAAGAGAGGGGAGGCAGG - Intronic
1027604615 7:80285351-80285373 GAGAAAAAGTAAGGGGAGGCAGG - Intergenic
1027853481 7:83479207-83479229 CAGAGAAAGCAGGGGTAGGAAGG - Intronic
1028326581 7:89534307-89534329 TAGAAAAATGAGGAGGAGGCAGG + Intergenic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028632994 7:92956134-92956156 CAAAAAAAGACTGGGGAAGCTGG - Intergenic
1029013646 7:97290568-97290590 AGGAAGAAGAAGGGGGAGGATGG + Intergenic
1029273547 7:99391340-99391362 AAGAAAAAAAGGAGGGAGGCAGG - Intronic
1029410095 7:100403964-100403986 GAGAAACAGAATGGGGAGGGAGG - Intronic
1029422082 7:100477099-100477121 CAGAAAATGAAGTAGGAGGAAGG + Intronic
1029506885 7:100968186-100968208 CAGGAAGAGAAGGGGGAGGAGGG - Exonic
1029733877 7:102454877-102454899 CAGAAACACATGGGGCAGGCTGG + Exonic
1030506323 7:110427956-110427978 CAGCAATAAAAGGGGTAGGCAGG + Intergenic
1030574437 7:111268323-111268345 CAGAGATAGAAAAGGGAGGCAGG + Intronic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1030999236 7:116395716-116395738 AAAAAAAAGGAGGGGGAGGAAGG - Intronic
1031667492 7:124503060-124503082 GAGAAGAAGAAGGGGGAGAAAGG + Intergenic
1031697673 7:124878329-124878351 CAAAAAAAGCAGGGGGTGGGGGG + Intronic
1031715309 7:125101924-125101946 CAGAAGGTGAAGGGGGAAGCAGG - Intergenic
1031803885 7:126283669-126283691 AAGGAAATGAAGGGGGAGGCAGG - Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1032282177 7:130512919-130512941 GAGAAAGAGAAGATGGAGGCTGG + Intronic
1032534948 7:132655407-132655429 CAGAGAAAGAAGGGGGTGGAGGG - Intronic
1032982086 7:137295901-137295923 CAGAAAAAGAGGTGGGAGCAGGG - Intronic
1033062048 7:138118845-138118867 AAGAAAAAGAAGGAGGGAGCCGG + Intergenic
1033223727 7:139544881-139544903 AAGGCAAAGAAGGGGGATGCAGG - Exonic
1033351998 7:140569441-140569463 CAGGACAAGGATGGGGAGGCAGG + Intronic
1033454331 7:141488950-141488972 GAGAAAGAGAAGGAGGAGGGAGG + Intergenic
1033480708 7:141737713-141737735 CAGAAAAAGAAAGGGGAGCCAGG - Intergenic
1033785216 7:144721962-144721984 CAGGAAAAAAAGGGGAAGGAGGG - Intronic
1034059096 7:148069464-148069486 ATCAAAAAGAAGGGCGAGGCCGG + Intronic
1034096752 7:148415721-148415743 CAGCACAAGTTGGGGGAGGCAGG + Exonic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034496117 7:151423668-151423690 CAAAAAAAAAAAGGGGGGGCGGG - Intergenic
1034575696 7:151995051-151995073 GAGAAAGAAATGGGGGAGGCCGG - Intronic
1035110791 7:156479921-156479943 GAGAGAGAGAAGGGGGAGGTTGG + Intergenic
1035116141 7:156525855-156525877 CAGAAAAAGAATTATGAGGCTGG + Intergenic
1035348866 7:158228890-158228912 CAGAGATAAAAGGGGGAGGTGGG + Intronic
1035476744 7:159149268-159149290 CAGAAGCAGAAGGGAGAGGCTGG - Intergenic
1036078778 8:5529693-5529715 GAGAAAAAGAAGGTGGGGGAAGG + Intergenic
1036276728 8:7358770-7358792 AGGAACCAGAAGGGGGAGGCAGG - Intronic
1036344605 8:7951575-7951597 AGGAACCAGAAGGGGGAGGCAGG + Intronic
1036588258 8:10144999-10145021 AAGGAAAAGCAGGGAGAGGCGGG - Intronic
1036698179 8:10993021-10993043 GAGAAAGAGAAGTGGGAGGTGGG + Intronic
1036839946 8:12112342-12112364 AGGAACCAGAAGGGGGAGGCAGG + Intronic
1036861737 8:12358581-12358603 AGGAACCAGAAGGGGGAGGCAGG + Intergenic
1037005327 8:13771687-13771709 AATAAAAAGAAGGGAGAAGCAGG + Intergenic
1037524779 8:19714048-19714070 CAAAAGAAGAAGGGTGAAGCTGG - Intronic
1037545965 8:19922774-19922796 CAGAGAAAGAAAGCAGAGGCCGG + Intronic
1037549950 8:19960831-19960853 GAGAAAAAAAAGTGGGGGGCAGG + Intronic
1037783226 8:21885721-21885743 CAGGAAAGGAATGGAGAGGCAGG - Intergenic
1037988791 8:23306191-23306213 CAGAGAAAGATGGGAGAAGCAGG + Intronic
1038047470 8:23777936-23777958 GGGAAGAAGAAGGGGGAGACAGG + Intergenic
1038068021 8:23983756-23983778 CAGAAAAAAAAGGGGAAGTGGGG - Intergenic
1038270301 8:26069470-26069492 CAGAAAAGGAAGGGCAGGGCAGG + Intergenic
1038421457 8:27436612-27436634 GAGAATACAAAGGGGGAGGCGGG + Intronic
1038665590 8:29534755-29534777 CAGAAAAAAAAAGGGGAGGGAGG + Intergenic
1038667662 8:29554253-29554275 AAGAAAAAGAAGGGGAGGGAGGG - Intergenic
1038882201 8:31627561-31627583 GAGAAAAAGAAGGAGGGGGAGGG - Intergenic
1038981601 8:32765556-32765578 AAGAAAAATAAGGGGGAGAAAGG - Intergenic
1039634399 8:39147623-39147645 CAGAGGAAGAAGGTGGATGCTGG - Intronic
1039897457 8:41726129-41726151 CAGAGAAAGGAAGTGGAGGCAGG - Intronic
1040570240 8:48602144-48602166 AAGACAGAGAAGGAGGAGGCGGG - Intergenic
1040702660 8:50086311-50086333 CAGAGGAAGAAGTTGGAGGCAGG + Intronic
1040770551 8:50970132-50970154 CAGAATGAGAAGGGGGAAGGGGG + Intergenic
1040875954 8:52152341-52152363 CACAAAAAGGAGGGAGGGGCTGG + Intronic
1041044485 8:53878102-53878124 AAAAAAATGAAGGTGGAGGCGGG - Intronic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041332474 8:56741592-56741614 CAGAAAAAGAAGAGGCAAGGAGG + Intergenic
1041453375 8:58031864-58031886 ATGAAAAGGAAGGGGGAGGAAGG - Intronic
1041639098 8:60177679-60177701 GACTACAAGAAGGGGGAGGCAGG - Intergenic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1042072669 8:64953807-64953829 CAGAATTGGAAGGGGAAGGCTGG + Intergenic
1042421072 8:68589907-68589929 AAGAAAAAGATGGGGGAGGGAGG + Intronic
1042807664 8:72789509-72789531 CAGGTAGAGAAGGGGGAGGCAGG + Intronic
1042834686 8:73068807-73068829 GACACAAAGAAGGGGTAGGCCGG - Intronic
1043772262 8:84219338-84219360 CAGAAGAAGAAGGGGAAGCAAGG - Intronic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1044878996 8:96702763-96702785 CAGAAGGAGAAAGGGGAGGGAGG - Intronic
1044930148 8:97244503-97244525 CAAAAAAAAAATGGGGAGGGAGG + Intergenic
1044985527 8:97753315-97753337 GAGAAGAAGAAGGAGGAGGTCGG + Intergenic
1045452666 8:102343851-102343873 CAAAAAAAAAAGGGGGGGGTGGG + Intronic
1045871780 8:106935231-106935253 CAAAAAAAGAGGGGGCAGGTGGG - Intergenic
1045973176 8:108102647-108102669 CATGAAAAGAAGCTGGAGGCTGG + Intergenic
1046035841 8:108840369-108840391 CAGAACAAAAAGGTGGAGGAAGG - Intergenic
1046237692 8:111447942-111447964 AAGAAAAAGAACTGAGAGGCTGG + Intergenic
1046749022 8:117907292-117907314 CAGAAAAGTAAGGGTGAGGGTGG - Intronic
1046926381 8:119793901-119793923 CAGAAAAAAAAAGGGGGGGTTGG + Intronic
1047394925 8:124488445-124488467 GAGAAAAAGAAGGGGAATGGTGG + Intergenic
1047463206 8:125088426-125088448 AAAAAAAAAAAGGGGGAGGGGGG + Intronic
1048171083 8:132107094-132107116 CAGAAGAAGAAGGGGGAAAGAGG - Intronic
1048651972 8:136487869-136487891 CAGAACATGAAGTGGGAGGTGGG + Intergenic
1048682026 8:136853719-136853741 AAAAAAAAGAAGGGAGGGGCAGG + Intergenic
1048887483 8:138919933-138919955 CAGAAAAAGAAAAGAGAAGCTGG - Intergenic
1048901100 8:139038434-139038456 CAGAAAGAGAAGGGGAAGGAAGG + Intergenic
1048920452 8:139225105-139225127 CAGAGAAAGAAATGGCAGGCAGG + Intergenic
1049120280 8:140730954-140730976 CAAAAAAAAAAGGGGGGGGGGGG - Intronic
1049326299 8:142023245-142023267 CAGACAAAGAAGGAGGCTGCTGG - Intergenic
1049381558 8:142318960-142318982 CAGCAAGAGACGGGGGAGACGGG + Intronic
1049381566 8:142318991-142319013 CAGCAAGAGACGGGGGAGACGGG + Intronic
1049524161 8:143112543-143112565 TAGAAAAAGAAGGGGAGGGGAGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049990180 9:982801-982823 AAGAGAAAGAAAGAGGAGGCGGG - Intronic
1050444497 9:5704506-5704528 ATTAAAAAGAAGGGAGAGGCAGG - Intronic
1050744397 9:8858754-8858776 CGGATAAAGGAGGGGCAGGCAGG + Intronic
1051078340 9:13266834-13266856 GAGAAAGAGAAGGAGGAGGAAGG + Intronic
1051079515 9:13279044-13279066 GAGCAAAAGAAAGGGGTGGCGGG + Intronic
1051141951 9:13987666-13987688 CAGAGAATGAAGGGGAAGACAGG + Intergenic
1051504748 9:17814584-17814606 CTGAAAAGGAAGAGGGAGGCAGG + Intergenic
1052375437 9:27713409-27713431 CAGAAACAGAATGGAGAGGCAGG + Intergenic
1052523998 9:29589020-29589042 GAGAGAGAGAAGGGGGAGGAAGG - Intergenic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054738828 9:68783964-68783986 CAGAAAACGAGGGGGGAGGAGGG - Exonic
1054922529 9:70556348-70556370 GAGTAAAAGGTGGGGGAGGCTGG - Intronic
1054973738 9:71118801-71118823 AAGAGAGAGAAGGGGGAGGAAGG + Intronic
1055173824 9:73292894-73292916 GAAAAAAAAAAGGGGGGGGCGGG - Intergenic
1055188797 9:73492127-73492149 GAGAAGATGAAAGGGGAGGCAGG + Intergenic
1055538502 9:77275800-77275822 TAAAAAAAAAAGGGGGGGGCGGG - Intronic
1055750665 9:79501176-79501198 CAGAGAGAAAAGGGGGAGGGTGG + Intergenic
1055778063 9:79787932-79787954 GAGCAAGAGAAGGGGGAGGTGGG - Intergenic
1056060719 9:82883144-82883166 AAGATAAAGATGGAGGAGGCTGG - Intergenic
1056651879 9:88472094-88472116 CTGAAAAAGAAAGGAGGGGCCGG - Intronic
1056835641 9:89953143-89953165 GAGAAAAAGAGAGGGGAGGGAGG - Intergenic
1056958657 9:91102515-91102537 CAGAAAAAGATGCTGGAGGGTGG + Intergenic
1056962508 9:91138640-91138662 AAGAGAAAGGAAGGGGAGGCAGG - Intergenic
1057336943 9:94163140-94163162 CAGACAAATAAGGCTGAGGCAGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058276495 9:103048042-103048064 GAGAATCAGAAGGGGGAGGGTGG + Intergenic
1058730746 9:107847396-107847418 CTGAATAAGTTGGGGGAGGCTGG + Intergenic
1058750810 9:108036771-108036793 CAGAAAAAGAACTGGCAGGGAGG + Intergenic
1058896466 9:109404955-109404977 CTGAGAAAGAAAGGGGAGTCGGG - Intronic
1059139887 9:111843013-111843035 CATTAAAAGAATGGTGAGGCTGG - Intergenic
1059150254 9:111943062-111943084 GAGCAGAAGAAGGGTGAGGCTGG - Intergenic
1059225866 9:112672396-112672418 CAAAAAAAAAAGAGGGAGTCCGG + Intergenic
1059847889 9:118301873-118301895 CAGACAAAGATGGAGAAGGCAGG - Intergenic
1060192968 9:121604509-121604531 CAGAGAAAGAAGAGGCAGGGAGG - Intronic
1060728368 9:126021268-126021290 AAGAAAAAGAAAGGGAAGGAAGG - Intergenic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1061053222 9:128208035-128208057 AAAAAAAAGAATGGGGAGGAAGG - Intronic
1061132540 9:128716008-128716030 AAAAAAAAGGAGGGGGAGGCTGG + Intronic
1061221872 9:129256828-129256850 AAGAAAAGGAAGGCTGAGGCTGG - Intergenic
1062605473 9:137346527-137346549 CGGAAATAGAAGTGGGATGCTGG - Intronic
1062605481 9:137346608-137346630 CAGAAATAGAGGTGGGATGCTGG - Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062682683 9:137790519-137790541 CAGACAAAGAAGGGGGAGGGAGG - Intronic
1062697933 9:137884901-137884923 GAGAAACAGAAGAGGGAGGCGGG - Intronic
1185509070 X:649332-649354 CAGAAAAAGAGAGAGGAGGCCGG - Intronic
1185840580 X:3386465-3386487 CAGAAAAAAAGGGGGGCTGCAGG + Intergenic
1185878018 X:3715076-3715098 CACAAAATGCAGGTGGAGGCTGG - Intergenic
1186045481 X:5532410-5532432 GAGAAGAAGAAGGGAGAGGAAGG + Intergenic
1186413231 X:9361793-9361815 CAGAAGGTGAAGGGGGAGGAGGG - Intergenic
1186673512 X:11791872-11791894 CAGAAAAACAGGTGGCAGGCAGG + Intergenic
1187029299 X:15469319-15469341 AAGAAAAAGAAAGGGGAGGGAGG - Intronic
1187176929 X:16904364-16904386 AAAAAAAAGTAGGGGGAGGGCGG + Intergenic
1187447630 X:19373014-19373036 GAGCAGAAGGAGGGGGAGGCGGG + Intronic
1187617693 X:21015706-21015728 TAGAAAGAGATGGGGGAAGCAGG + Intergenic
1187817355 X:23247205-23247227 AAGAGAAAGTAGGGGGAGGAAGG - Intergenic
1188315024 X:28662759-28662781 CAGAAAAGGAAGGGGGTGAGGGG + Intronic
1188577975 X:31675655-31675677 GAAAAAAAGAATGGTGAGGCCGG - Intronic
1188616665 X:32165946-32165968 CAGAAAATGAAGGGGAAGCGAGG - Intronic
1188755090 X:33952573-33952595 GTGAAAATGAAGGGGGAGGGGGG + Intergenic
1188780318 X:34275712-34275734 CATAAAGAGAATGGGAAGGCAGG - Intergenic
1189058778 X:37729256-37729278 CAGGCAAGGAATGGGGAGGCAGG - Exonic
1189268756 X:39735903-39735925 CAGAAAAGGGCGGGGGAGGTTGG - Intergenic
1189746582 X:44174641-44174663 CAAAAAAAAAAGGGGGGGGGAGG + Intronic
1190087122 X:47405089-47405111 CACAAGAAGAAGGGGGAGGCCGG + Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190815395 X:53924749-53924771 CAGAAAAGAAAGGGAAAGGCAGG - Intergenic
1190819282 X:53958409-53958431 AAAAAAAAGGAGGGGGAGGTAGG + Intronic
1191006240 X:55714188-55714210 CAGATAAAGAAGGGGAGGGGAGG - Intergenic
1191103890 X:56760343-56760365 CAGCAAAAGGAGGGAGAGGAAGG - Intergenic
1191141753 X:57121772-57121794 CAGACTAAGAAGGTGGAGGTGGG - Intergenic
1192244219 X:69359723-69359745 GAGACAAAGAAGGGGCAGGGAGG - Intergenic
1192579224 X:72267060-72267082 TAAAAAAAGAAAGGGGTGGCTGG - Intronic
1193071616 X:77312124-77312146 TAGAAAAATAAGAGGGAGGCTGG + Intergenic
1193216790 X:78874363-78874385 AAGAAAAAGCACGGGGAGCCAGG + Intergenic
1193459166 X:81769609-81769631 CAGAAGAGGAAGGGGGACGAGGG + Intergenic
1194375302 X:93125335-93125357 CAGAAGCAGAAGGGGGAGCAGGG - Intergenic
1195025060 X:100868512-100868534 CAAAAACAGAAGAGGGAGGGAGG - Intronic
1195044657 X:101045030-101045052 CAAAAAAAAAAGGGGGGGGTGGG + Intronic
1195479296 X:105324335-105324357 CAGAAAAAGCAGGGGAAGGCTGG - Intronic
1195933502 X:110103371-110103393 CAGAAAAAGCAGGGCAGGGCAGG + Intronic
1196758098 X:119175803-119175825 CAGGACAAGAAGGGAGAGGAGGG - Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1197088425 X:122507891-122507913 CAGAAAGAGAAGGTGGTGGTGGG - Intergenic
1197230556 X:123999432-123999454 CAGGGAGAGAAGGGGGAGGGAGG - Intronic
1197673427 X:129303652-129303674 CAGAAGGTGAAGGGGGAAGCAGG - Intergenic
1198094141 X:133361833-133361855 AAGAGAAAGAATGAGGAGGCAGG + Intronic
1198116465 X:133549626-133549648 GAGATAAAGAGGGGGGAGGGAGG - Intronic
1198459052 X:136846234-136846256 CAGAAAAAAAAAGGTGGGGCTGG - Intergenic
1198671221 X:139083167-139083189 GAGAAAAAGAAAGGGAAAGCAGG - Intronic
1199600859 X:149540368-149540390 GAGAATCAGCAGGGGGAGGCAGG - Intronic
1199800791 X:151248645-151248667 CAGAGCCAGAAGGGGGAAGCTGG + Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200787363 Y:7272718-7272740 CACAAAATGCAGGTGGAGGCTGG + Intergenic
1201623496 Y:15986781-15986803 CAGAAAACAAGTGGGGAGGCAGG + Intergenic
1202590760 Y:26480839-26480861 CAGGAGAAGAAAGGGGAGGAGGG + Intergenic