ID: 914790791

View in Genome Browser
Species Human (GRCh38)
Location 1:150876243-150876265
Sequence CGCCGACCGAGGAGTGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914790786_914790791 -6 Left 914790786 1:150876226-150876248 CCACATCACAGACCAGACGCCGA 0: 1
1: 1
2: 2
3: 4
4: 62
Right 914790791 1:150876243-150876265 CGCCGACCGAGGAGTGAGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63
914790784_914790791 20 Left 914790784 1:150876200-150876222 CCAGCGGGCAGAGGGTTAAAAGA 0: 1
1: 0
2: 0
3: 6
4: 112
Right 914790791 1:150876243-150876265 CGCCGACCGAGGAGTGAGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914790791 Original CRISPR CGCCGACCGAGGAGTGAGGG CGG Intronic