ID: 914790791 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:150876243-150876265 |
| Sequence | CGCCGACCGAGGAGTGAGGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 68 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 63} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914790786_914790791 | -6 | Left | 914790786 | 1:150876226-150876248 | CCACATCACAGACCAGACGCCGA | 0: 1 1: 1 2: 2 3: 4 4: 62 |
||
| Right | 914790791 | 1:150876243-150876265 | CGCCGACCGAGGAGTGAGGGCGG | 0: 1 1: 0 2: 0 3: 4 4: 63 |
||||
| 914790784_914790791 | 20 | Left | 914790784 | 1:150876200-150876222 | CCAGCGGGCAGAGGGTTAAAAGA | 0: 1 1: 0 2: 0 3: 6 4: 112 |
||
| Right | 914790791 | 1:150876243-150876265 | CGCCGACCGAGGAGTGAGGGCGG | 0: 1 1: 0 2: 0 3: 4 4: 63 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914790791 | Original CRISPR | CGCCGACCGAGGAGTGAGGG CGG | Intronic | ||