ID: 914792588

View in Genome Browser
Species Human (GRCh38)
Location 1:150891555-150891577
Sequence CATGTTTACAAGCTTTCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914792586_914792588 25 Left 914792586 1:150891507-150891529 CCGGCCTTATCTGATATTTCTAA No data
Right 914792588 1:150891555-150891577 CATGTTTACAAGCTTTCCAATGG No data
914792587_914792588 21 Left 914792587 1:150891511-150891533 CCTTATCTGATATTTCTAACACA No data
Right 914792588 1:150891555-150891577 CATGTTTACAAGCTTTCCAATGG No data
914792585_914792588 26 Left 914792585 1:150891506-150891528 CCCGGCCTTATCTGATATTTCTA No data
Right 914792588 1:150891555-150891577 CATGTTTACAAGCTTTCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914792588 Original CRISPR CATGTTTACAAGCTTTCCAA TGG Intergenic
No off target data available for this crispr