ID: 914797656

View in Genome Browser
Species Human (GRCh38)
Location 1:150934506-150934528
Sequence GAGTGAAAGTAGAAGTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914797656 Original CRISPR GAGTGAAAGTAGAAGTATGC TGG (reversed) Intronic
903246277 1:22017975-22017997 GAGTGAAAGAAGCAATTTGCAGG - Intergenic
906024514 1:42661870-42661892 AATGGAAAGTGGAAGTATGCTGG + Intronic
906381773 1:45337042-45337064 GAATGAATGTGGAAGTAAGCAGG - Intronic
907152301 1:52300151-52300173 GAGTGGCTGTGGAAGTATGCTGG - Intronic
908687642 1:66739815-66739837 GAGAGAAAGTAGAAGGCTACCGG + Intronic
909118853 1:71575074-71575096 GAGTGAAAGTGGCATAATGCAGG - Intronic
909772374 1:79440015-79440037 ATGTGAAAGTAGAACCATGCAGG - Intergenic
911094656 1:94045585-94045607 GAGAGAAAGCAGATGGATGCAGG + Intronic
911778451 1:101844344-101844366 GAGGGAAAGAAGAAGAATCCAGG + Intronic
913040933 1:115022534-115022556 GGGTGAAAGCAGAAATATGTGGG + Intergenic
914213231 1:145600981-145601003 GTGAGAAAGTAGAAGTGTCCTGG + Intergenic
914465169 1:147921422-147921444 GTGAGAAAGTAGAAGTGTCCTGG + Intergenic
914797656 1:150934506-150934528 GAGTGAAAGTAGAAGTATGCTGG - Intronic
916246969 1:162697935-162697957 GAGTGATAGTAGAAGTAGATGGG + Intronic
916310465 1:163393384-163393406 GGGTGAGAGAAGAAGTCTGCAGG + Intergenic
917988922 1:180352104-180352126 GACAGAAAGTAGAATTATGGTGG + Intronic
919154278 1:193742037-193742059 GAGTGAGACTAAAAGTGTGCAGG - Intergenic
919443113 1:197664539-197664561 TAGTGGAAGTAGAAGTGTGGGGG - Intronic
920439173 1:205967143-205967165 TAGAGAAGGTAGAAGTAGGCTGG - Intergenic
920750429 1:208669601-208669623 GAGGGAGAGGAGAAGTATGTAGG - Intergenic
922065775 1:222140712-222140734 GAGTGAAAGTAGTACTAAGAGGG + Intergenic
923969484 1:239183632-239183654 CAATGGAAGTAGAAGAATGCAGG + Intergenic
1063090180 10:2858467-2858489 CAGTTAAACTAGAAGTATCCAGG - Intergenic
1064984164 10:21193187-21193209 GAGAGAAGGTAGAAATATGGGGG + Intergenic
1066383740 10:34923325-34923347 GAAAGAAAGTAGAAATATGAAGG + Intergenic
1068321167 10:55418521-55418543 GAGTGTAAGAAAATGTATGCTGG + Intronic
1068734724 10:60399848-60399870 GATTTAAATTAGATGTATGCTGG - Intronic
1069206609 10:65696858-65696880 GACTGACAGTAAAAGAATGCAGG + Intergenic
1070002386 10:72389569-72389591 CAGTGTAAGTAGAATTGTGCAGG + Intronic
1074100675 10:110352576-110352598 GAGGGAAAGTACAAGTAGGTAGG + Intergenic
1081298264 11:41418915-41418937 AAGTGAAAGTAGAGGAAAGCTGG + Intronic
1085468954 11:76744560-76744582 GAGTACGAGTAGAAGTCTGCTGG - Intergenic
1086846332 11:91754485-91754507 GGGTGAAAGTAAAAAAATGCAGG - Intergenic
1088791955 11:113233994-113234016 GAGTGGAATTGGAAGTAGGCTGG + Intronic
1091731722 12:2885869-2885891 GAGTAAAAGTCAAAGTAGGCCGG - Intronic
1091731728 12:2885924-2885946 GAGTAAAAGTCAAAGTAGGCCGG - Intronic
1092029307 12:5270842-5270864 GAGAGAAAGTAGAAATAGGCAGG + Intergenic
1095227337 12:39693822-39693844 AAGTTAAAGGAGAAATATGCTGG + Intronic
1100603490 12:96132281-96132303 GAGTGAAATAAAAAGCATGCAGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107354697 13:39554554-39554576 ATGTGACTGTAGAAGTATGCAGG - Intronic
1107958723 13:45541179-45541201 GAGTGACCGTAGAAGCAGGCAGG + Intronic
1108088429 13:46819605-46819627 GAGTGAAGGAAGGAGTATGGAGG + Intergenic
1108140766 13:47418760-47418782 GAGTGGAAGTAGAAGTTTAGTGG - Intergenic
1112740449 13:102467182-102467204 GAGTGAAGCCAGAAGTAGGCTGG + Intergenic
1112835515 13:103509364-103509386 AAGTGAGAGGAGAAGTTTGCCGG + Intergenic
1112841518 13:103584998-103585020 GGGTGATAGTATTAGTATGCAGG - Intergenic
1114553608 14:23548742-23548764 GAGAGAAAGCAGAAATATCCAGG - Intronic
1119534144 14:75387157-75387179 CAGTGAAAGTAGAAATTTGAGGG + Intergenic
1120300196 14:82696134-82696156 GAGTAAGAGTAGAAGTATTTAGG + Intergenic
1202899704 14_GL000194v1_random:28063-28085 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1124664786 15:31583022-31583044 GAGTGAGAAAAGCAGTATGCTGG + Intronic
1125360037 15:38855374-38855396 GGGGGACAGTAGCAGTATGCAGG + Intergenic
1125695142 15:41629997-41630019 GAGAGAAAGTAGAAATCTTCAGG - Intronic
1125957212 15:43798900-43798922 GAGGGAAAGTAGACATAGGCTGG - Exonic
1131689237 15:94808823-94808845 GAGTGAGAGTAGCAGTATTTTGG + Intergenic
1133898204 16:9949275-9949297 CAGTGAAGGTATAAGTAAGCAGG + Intronic
1143969690 17:10786481-10786503 GAGTGAAAGCAAAAGTCTGGTGG - Intergenic
1146367681 17:32241962-32241984 CCCTGAAAGTAGAAGCATGCTGG - Intronic
1149528355 17:57375820-57375842 GAATGAAAGGAGAAGGATGGGGG - Intronic
1149930313 17:60746614-60746636 TATTGAAATTAGAAGTATCCTGG + Intronic
1153198275 18:2624544-2624566 GCTAGAAAATAGAAGTATGCAGG + Intergenic
1153198322 18:2624859-2624881 AAGAGAAAATAGAAGTATGTAGG + Intergenic
1155435733 18:25810966-25810988 AAGTGACAGTAGAAGTTAGCTGG + Intergenic
1156111429 18:33731904-33731926 AAGTCAAAGCAAAAGTATGCAGG - Intronic
1159795540 18:72838531-72838553 GGATGACAGTAGAAGTGTGCAGG - Intronic
1159995388 18:74959668-74959690 TAATTAAAGTAGAAGTGTGCTGG - Intronic
1160081597 18:75732398-75732420 GAGTGAAATTAGAAGCAGGCTGG + Intergenic
1164716772 19:30396963-30396985 GAGTGTAAGAAGAGGTTTGCAGG - Intronic
1167696332 19:51017467-51017489 GCGTGAAAGTGGAAGGAAGCTGG + Intronic
1168450501 19:56462758-56462780 GAGTTAAAGTGGAAGAGTGCCGG + Intronic
1202647752 1_KI270706v1_random:157565-157587 GAGTGGAAGTTGAAGTTTGTGGG + Intergenic
927408339 2:22797400-22797422 GAGTGAAAGAAGAGGCAAGCAGG + Intergenic
931814460 2:65887124-65887146 GAGTGAAAGTTAAAATATCCTGG + Intergenic
933168099 2:79096796-79096818 GAGTGAAGGAAAAAGTGTGCAGG + Intergenic
934803657 2:97195178-97195200 GAATTAAAGCAGAATTATGCTGG - Intronic
937109127 2:119349228-119349250 AAGTGAAAATACAAGTATACTGG - Intronic
937276708 2:120689384-120689406 GAGTCAAGGTAGAAGTCTGGAGG + Intergenic
937627913 2:124064536-124064558 GAGTGAAAATTGATGGATGCAGG - Intronic
941472477 2:165905434-165905456 AATTGAAAGTAAAAGAATGCAGG + Intronic
942147820 2:173043658-173043680 GAGTGAAAGTGGAACTTGGCTGG + Intronic
944359544 2:198836845-198836867 GACAGAAAGTAGCAGTATGTAGG + Intergenic
944483639 2:200181344-200181366 GAGGGAAAATAGAAGCAGGCAGG - Intergenic
944989285 2:205217109-205217131 GAATAAGAGTAGAAGTTTGCTGG - Intronic
948553101 2:238788061-238788083 GAGAAAAAGTAGAAGTTTGTTGG - Intergenic
1168965716 20:1896683-1896705 GGGTGGAAGGAGAAGTATGGGGG + Intronic
1170824911 20:19785120-19785142 GAGTGAGAGTTGATGTAGGCAGG - Intergenic
1170954254 20:20964006-20964028 AAGTGAAGGTAGAAGAATGGGGG + Intergenic
1171133012 20:22672706-22672728 GAGTGAATGAAGAAATATGGAGG - Intergenic
1173082920 20:39886923-39886945 GAGTGATTGTGGAAGTATGTTGG - Intergenic
1176604099 21:8815166-8815188 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1176619079 21:9042837-9042859 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1177674489 21:24278929-24278951 GAGCAAAAGGAGAAGTATTCTGG + Intergenic
1179082414 21:38184120-38184142 GAGTGAAAATACAAGTGTGTGGG + Intronic
1179296023 21:40063724-40063746 CAGTGAAAGTATACGTATGTGGG + Intronic
1180346383 22:11706744-11706766 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1180354155 22:11824897-11824919 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1180384090 22:12167429-12167451 GAGTGGAAGTTGAAGTTTGTGGG + Intergenic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1183092317 22:35531021-35531043 GAGTGAAAGCAGAAGCTTCCAGG + Intergenic
1185003875 22:48263748-48263770 CAGTGAAAGTGGAGGTCTGCTGG - Intergenic
951698123 3:25467140-25467162 CAGAGAAATTAGAAGTATCCAGG + Intronic
955213809 3:56966691-56966713 GAGTGAAAGCAGAGATAAGCTGG + Intronic
956469304 3:69549118-69549140 GAATGGAAGTAGAATTATGTTGG - Intergenic
958636422 3:96752550-96752572 GAGTGAAAATAGAAAGATACAGG + Intergenic
964515196 3:157499995-157500017 TGTTGAAAGTTGAAGTATGCGGG + Intronic
965280082 3:166739618-166739640 GAGTGAAAGTTTAAGTTTGGTGG + Intergenic
967574827 3:191077344-191077366 GAGAGAAATTAGAAGACTGCTGG - Intergenic
971869721 4:32219057-32219079 GAGTGAAAGCAGAAGCAGTCAGG + Intergenic
972235486 4:37128884-37128906 TAGTGAAAGTAGAGGCATGCAGG + Intergenic
973374016 4:49275754-49275776 GAGTGGAAGTTGAAGTTTGTGGG + Intergenic
973383396 4:49334485-49334507 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
973387003 4:49519499-49519521 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
975065821 4:70062222-70062244 AAATGAAAGTAAAAGCATGCTGG - Intergenic
976320326 4:83707185-83707207 GATTGAAAGTAGATTTATGAGGG + Intergenic
977531785 4:98208965-98208987 GAGTGGAAGTAGAAGTGAGACGG + Intergenic
977839958 4:101690748-101690770 GGCAGAAAGTAGAAGTATTCAGG - Intronic
979561096 4:122103049-122103071 GAGAGAAAGTGGAAGCACGCAGG + Intergenic
979712972 4:123802653-123802675 GAGAGCAAGGAGAAGTATGTAGG - Intergenic
981178352 4:141708752-141708774 GAGTGACTGAGGAAGTATGCTGG - Intronic
983490881 4:168387628-168387650 GAATGAAGGAAGAAGGATGCTGG + Intronic
984105567 4:175541271-175541293 GAGGAAAAGTAGATGGATGCTGG - Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
986164499 5:5261950-5261972 GATAGAAAGTAGAATGATGCTGG - Intronic
986905243 5:12487978-12488000 GAGTGACTGAAGATGTATGCTGG + Intergenic
989585735 5:43072818-43072840 GAGTGAAGGAAAAGGTATGCAGG + Intronic
990075996 5:51846668-51846690 AAGTGATAGTACAAGTATTCTGG + Intergenic
990924872 5:61009334-61009356 GAGGGAAAGTAGAGGTATAGGGG + Intronic
993447452 5:88031028-88031050 GAGAGTAAGTAGAAGTGTTCAGG - Intergenic
994764700 5:103901223-103901245 GAGTGAAAATAGATTTATACAGG + Intergenic
995431288 5:112081000-112081022 AATTGAAAGTAGAAATAGGCTGG + Intergenic
997474510 5:134134839-134134861 GAGTAAATGAAGAAGGATGCTGG + Intronic
998476615 5:142427516-142427538 CAGTAAAAGTAGCAGTATTCTGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003602717 6:7532779-7532801 TAAAGAAAGTAGAAGTATGCCGG + Intergenic
1004969824 6:20897347-20897369 GAGTGGAGGTAGAAAGATGCAGG + Intronic
1005479101 6:26238569-26238591 GACAGTAAGTAGAAGTATGCTGG + Intergenic
1006275704 6:33003999-33004021 GAGTGAAAGATCAAGAATGCAGG + Intergenic
1007166816 6:39834305-39834327 GAGTGAAAAAAGAAGGATGTAGG - Intronic
1009713593 6:67357459-67357481 TAGTAAAAGTAGAAGTATTAAGG - Intergenic
1013353269 6:109325079-109325101 GGGTGAAAGTAGAAAGAAGCTGG + Intergenic
1014816448 6:125940832-125940854 GGGTGAAAGTAAAAGAATGCTGG + Intergenic
1020489271 7:8759048-8759070 GATTGGAACAAGAAGTATGCAGG + Intergenic
1021524717 7:21574520-21574542 GAGGGAAAACAAAAGTATGCAGG - Intronic
1022003318 7:26245772-26245794 GAGTGAAGGAAAAAGTGTGCAGG - Intergenic
1023358950 7:39396490-39396512 GAGTTATTCTAGAAGTATGCTGG - Intronic
1024732297 7:52266528-52266550 GAATGGAAGTAGAGTTATGCTGG + Intergenic
1028277226 7:88871988-88872010 AAGTGAAAGTAGTAATATGTAGG + Intronic
1028962107 7:96761034-96761056 AAGTGAAGGGAGAAGTATTCAGG - Intergenic
1029710556 7:102296752-102296774 GAATGTAAGTAGAAGCGTGCAGG + Intronic
1034151416 7:148918408-148918430 GAGAGAAAGAGGAAGTATGAAGG - Intergenic
1037761145 8:21742582-21742604 GAGTGAAAGCAGAAATACTCAGG + Intronic
1039533790 8:38288968-38288990 TAGTGAAAGTAGAAATACCCAGG - Intronic
1039660414 8:39456021-39456043 GAGTCAAAGTAGAATAATGGTGG - Intergenic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1042242283 8:66676304-66676326 GGGTTAAAAAAGAAGTATGCAGG - Intronic
1044365213 8:91336822-91336844 TATTGAAAATGGAAGTATGCAGG - Intronic
1046126633 8:109918058-109918080 CAGGGAATGTAAAAGTATGCAGG + Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1050732070 9:8720316-8720338 GAGTGAAAGTAGAAGCTTCCAGG + Intronic
1050835961 9:10078949-10078971 GATTGAAAGTAGATTTAAGCTGG - Intronic
1051743037 9:20269509-20269531 GAGTGAAAGGAGGAGTGTTCTGG + Intergenic
1051836386 9:21342889-21342911 GAATGAAAGCAGAAGAAAGCAGG - Intergenic
1052913533 9:33905890-33905912 GAGTGGTAGTAACAGTATGCAGG + Intronic
1054350912 9:64016316-64016338 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1060598421 9:124861947-124861969 GAGGGAAAGAGGAAGTAGGCGGG + Exonic
1203697695 Un_GL000214v1:113666-113688 GAGTGGAAGTTGAAGTTTGTGGG + Intergenic
1203551510 Un_KI270743v1:167320-167342 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1191699072 X:64020208-64020230 CAGTGAAAGTTCAAGTACGCAGG + Intergenic
1194025351 X:88744855-88744877 GGTGGAAATTAGAAGTATGCTGG + Intergenic
1195072937 X:101298402-101298424 GACAGAAAGTAGAAGTTAGCAGG - Intergenic
1195619427 X:106938181-106938203 GAGACAAAGTATAAGTAGGCAGG + Intronic
1200147068 X:153931911-153931933 GAGTGAATGTGGAGGTATCCTGG + Intronic
1201152787 Y:11102928-11102950 GAGTGGAAGTTGAAGTTTGTGGG - Intergenic
1202186366 Y:22188213-22188235 CAGTGAAATTAAAATTATGCTGG - Intergenic
1202204993 Y:22398183-22398205 CAGTGAAATTAAAATTATGCTGG + Intronic