ID: 914800833

View in Genome Browser
Species Human (GRCh38)
Location 1:150961136-150961158
Sequence CTTGATGCCTAGTCCTGAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914800833_914800840 21 Left 914800833 1:150961136-150961158 CCACCTCAGGACTAGGCATCAAG 0: 1
1: 0
2: 0
3: 4
4: 107
Right 914800840 1:150961180-150961202 GCCAAGAAAGAGGTAAGCAGTGG 0: 1
1: 0
2: 0
3: 36
4: 395
914800833_914800838 -1 Left 914800833 1:150961136-150961158 CCACCTCAGGACTAGGCATCAAG 0: 1
1: 0
2: 0
3: 4
4: 107
Right 914800838 1:150961158-150961180 GGATGAGGGAGACATCAAACAGG 0: 1
1: 0
2: 1
3: 16
4: 196
914800833_914800839 11 Left 914800833 1:150961136-150961158 CCACCTCAGGACTAGGCATCAAG 0: 1
1: 0
2: 0
3: 4
4: 107
Right 914800839 1:150961170-150961192 CATCAAACAGGCCAAGAAAGAGG 0: 1
1: 0
2: 0
3: 13
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914800833 Original CRISPR CTTGATGCCTAGTCCTGAGG TGG (reversed) Exonic
903355356 1:22743212-22743234 CATGATGCCTAGTACAGAGTTGG - Intronic
905714137 1:40133456-40133478 CTTGATGCCCAGTCCCGCTGCGG - Intergenic
906719528 1:47995582-47995604 CTTTATGCCTAGCCCTGACTTGG - Intronic
908754360 1:67454546-67454568 CTTGATGCATAGGCACGAGGTGG - Intergenic
910842340 1:91572345-91572367 CTTGGCTCCGAGTCCTGAGGAGG + Intergenic
913178957 1:116300935-116300957 CTAGTTGCCTAGGGCTGAGGAGG - Intergenic
914800833 1:150961136-150961158 CTTGATGCCTAGTCCTGAGGTGG - Exonic
916615633 1:166436154-166436176 CTTGAGGCCTTGCCCTCAGGTGG + Intergenic
917588272 1:176450780-176450802 CCAGATTCCTAGTCTTGAGGAGG + Intergenic
918781482 1:188705253-188705275 CTTTCTGCAGAGTCCTGAGGTGG + Intergenic
920199132 1:204248767-204248789 CCTGCTGCCTAGTGCTGATGAGG + Intronic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922285548 1:224167756-224167778 CTTGAAGCCTAATCCTCAAGGGG + Intergenic
923804542 1:237243745-237243767 CTTGAGGCCTGCTCCTGGGGCGG + Intronic
1067276667 10:44841300-44841322 CTTGCTGCAGAGTCCTGAGATGG - Intergenic
1067858497 10:49819418-49819440 CTTGATGTCTGGTCCAGGGGTGG + Exonic
1069883433 10:71608503-71608525 CTTGGGGCCTAGTCCTGTGTTGG - Intronic
1074935491 10:118175460-118175482 CTTGATGCTTTGTCCTAAAGAGG - Intergenic
1075136137 10:119787857-119787879 CTTGAGGCCTGGTGCTCAGGTGG + Intronic
1076426515 10:130371114-130371136 CTTGCTGGCTACTCCTGTGGGGG + Intergenic
1077510663 11:2960147-2960169 CTTGACGCCTATTGGTGAGGAGG - Intronic
1081373008 11:42326925-42326947 ATTTATGCCTCTTCCTGAGGTGG + Intergenic
1081836922 11:46163354-46163376 CTAGACGCCTGGCCCTGAGGTGG - Intergenic
1083302532 11:61746468-61746490 CCTGATGGCTCGTCCTGGGGTGG - Exonic
1085765950 11:79281657-79281679 CTTGATGACAAGTCCCCAGGAGG + Intronic
1090914692 11:131152908-131152930 GCTGCTGCCTAGTCCTGAGATGG - Intergenic
1091794008 12:3287044-3287066 CTTGATGTCTCGGACTGAGGGGG + Intergenic
1092919520 12:13218686-13218708 TGTGAAGCCTACTCCTGAGGCGG + Exonic
1095205395 12:39434180-39434202 CTTGCTGCCTCATCCTAAGGCGG + Intronic
1102690490 12:114756689-114756711 CATGATGAGTAGTCCAGAGGTGG + Intergenic
1103128302 12:118444183-118444205 CTTGATGCGATGTACTGAGGTGG + Intergenic
1104966663 12:132511436-132511458 CTTGAGACCAGGTCCTGAGGGGG - Intronic
1107480241 13:40780131-40780153 CTTCATGCTAAGTCCTAAGGTGG + Intergenic
1107994763 13:45849178-45849200 CTGTGTGCCTAATCCTGAGGGGG + Intronic
1111566800 13:90027637-90027659 CATGGTACCAAGTCCTGAGGTGG - Intergenic
1112566164 13:100552884-100552906 CTTGACACCTGGTCCTGATGCGG - Intronic
1113365594 13:109672709-109672731 CTTGATGCCAATTCCTGGAGAGG + Intergenic
1113709238 13:112453047-112453069 CCTGCTTCCTAGTCCTGACGGGG - Intergenic
1114726810 14:24946591-24946613 CTTGATTCCTGCTCCTGATGAGG - Intronic
1119590283 14:75880767-75880789 TTTGGTTCCTTGTCCTGAGGAGG + Intronic
1132324935 15:100961137-100961159 CTGGCTGCAGAGTCCTGAGGTGG + Intronic
1134175951 16:12006585-12006607 GTTGATTCCTAGTCCTCAGAAGG + Intronic
1138418045 16:56882515-56882537 CTGGGTGCCTCCTCCTGAGGTGG - Intronic
1140892635 16:79298267-79298289 GTTGATTCCTAGAACTGAGGAGG - Intergenic
1142429929 16:90020390-90020412 GTTGATGCCGTGGCCTGAGGCGG + Intronic
1143409656 17:6701245-6701267 CTTGGTGGCTAGACCTCAGGAGG - Intronic
1149982672 17:61323748-61323770 CGTGGTGCCTAGTCCCCAGGAGG + Intronic
1153576485 18:6527018-6527040 CTTGATGTCTCAACCTGAGGAGG - Intronic
1162563947 19:11434952-11434974 GTCGAAGCCTGGTCCTGAGGAGG + Exonic
1168368502 19:55810898-55810920 CTTGATGCCAAGACATGAGAGGG - Intronic
925995188 2:9287147-9287169 CATGCTGCCTGGTGCTGAGGCGG + Intronic
927846452 2:26474868-26474890 CCTCATGTCTAGTCCTGAGCCGG - Intronic
928565340 2:32540734-32540756 GTTGATGCCTAAGCCTGTGGTGG + Intronic
931469979 2:62529668-62529690 CTTCATTCCTAGTCGTGGGGTGG + Intergenic
932549490 2:72753394-72753416 CTTGGTGACTAGTTATGAGGAGG - Intronic
932618250 2:73249807-73249829 CTTGCTCCCTAGGCCTGTGGAGG + Exonic
933261478 2:80136204-80136226 CTTGATGCATAGGCCTGCGGAGG + Intronic
933415752 2:81985044-81985066 GTGGATGCCTTGGCCTGAGGAGG - Intergenic
939354496 2:141083778-141083800 CTCGCTGCAGAGTCCTGAGGTGG - Intronic
940270807 2:151888125-151888147 GTAGATGCCTAGTCCCGAGCTGG - Intronic
940408984 2:153337746-153337768 CTTTCTGCTCAGTCCTGAGGAGG - Intergenic
946427159 2:219605519-219605541 GTTGAGGCCTAGTCCAGAAGAGG + Intronic
948547914 2:238745793-238745815 CGTGATGCCGCGTCCCGAGGAGG + Intergenic
1171423414 20:25034005-25034027 CTTGCTGCTGAGTCCAGAGGAGG + Intronic
1175552267 20:59825169-59825191 CTTGGTGCCTTGTCCTGGGTTGG + Intronic
1176615994 21:9028692-9028714 GTTGATGCCTGGTCCCCAGGTGG - Intergenic
1178274361 21:31223346-31223368 CTTGACGCTTAATCCTGAGCAGG - Intronic
1184407851 22:44310145-44310167 CCTGATGCCTAGCCCTGCAGCGG + Intronic
1184810718 22:46829931-46829953 CATGGTGCCTAGTACTGAGCTGG - Intronic
950246091 3:11419984-11420006 CATTATGCATAGTCCTGAGAAGG - Intronic
950517138 3:13474759-13474781 CCTGCTGCCTTCTCCTGAGGAGG - Intergenic
951883121 3:27498808-27498830 CTTGATGCATACTCCTGAATGGG + Intergenic
953736924 3:45502987-45503009 CATGATGCCTAGTTCTTTGGGGG + Intronic
954437758 3:50504906-50504928 CTTGCTGCCTAGTCCTGCCTTGG + Intergenic
957135001 3:76275403-76275425 CAGGATGCCTAGTCCAGAGCAGG + Intronic
962398366 3:135036882-135036904 CTTGATGAGCAGTCCTGATGTGG + Intronic
962744988 3:138390298-138390320 CTTGATCCCTTGTCCTCAAGTGG + Intronic
964138432 3:153370250-153370272 GTGGATGCCGAGGCCTGAGGAGG + Intergenic
965461902 3:168976192-168976214 CTAGTTGCTTAGTCTTGAGGTGG - Intergenic
966452841 3:180081765-180081787 CTTGGTGCCCATTCTTGAGGGGG - Intergenic
966695987 3:182791479-182791501 CTTGATTCCTAGTGCTCTGGTGG - Intergenic
967921981 3:194620563-194620585 GTTGCTGCCCGGTCCTGAGGTGG - Intronic
968299950 3:197604886-197604908 GGTGATGCCTACCCCTGAGGAGG + Intergenic
968947641 4:3673961-3673983 CTTCATGGCTGGGCCTGAGGTGG + Intergenic
975775318 4:77780040-77780062 GTTGATGCCGAGACCTGAGAGGG - Intronic
976390774 4:84501747-84501769 CTTGATCCCTGGTAGTGAGGGGG + Intergenic
978384395 4:108166558-108166580 TTTGAAGCCTAGTCCAGAGCTGG - Intronic
981549918 4:145933672-145933694 CCTGATGCCTATTCCCGAGGGGG - Intronic
982069580 4:151683497-151683519 CTTGACCCCTAGCCGTGAGGAGG + Intronic
984119365 4:175723261-175723283 TTTGCTTCCTAGTCCTGAGATGG - Intronic
992180783 5:74196291-74196313 CTCCATGCCTAGACCAGAGGTGG + Intergenic
992592526 5:78310039-78310061 CCTTATGCCTAGTCCTGAGCAGG - Intergenic
992620723 5:78589802-78589824 CCTGATGCCCAGTCCAGAGCAGG + Intronic
1000973923 5:167744241-167744263 CCTGATGCCTAGTCCAGACAGGG - Intronic
1001306990 5:170582300-170582322 CTTGTTGAGTAGTCCTGAGCAGG + Intronic
1003061968 6:2870572-2870594 GTGGATGCCGTGTCCTGAGGAGG + Intergenic
1008125504 6:47663922-47663944 CATGATTCGTAGGCCTGAGGAGG + Intronic
1011081060 6:83490417-83490439 CTTGCTCCCTGGACCTGAGGTGG + Intergenic
1013360576 6:109390508-109390530 CTTTATGCTAAGACCTGAGGTGG - Intronic
1019736773 7:2653972-2653994 CTTCATGTCCAGTCCTGGGGCGG - Intronic
1022893417 7:34724501-34724523 CCTGATTCCTAGATCTGAGGTGG + Intronic
1026375073 7:69741923-69741945 CTTCATGCCTAATACTTAGGAGG - Intronic
1036130093 8:6102093-6102115 CTCCATGCCTAGTGCTGTGGTGG + Intergenic
1041616597 8:59914830-59914852 CTTGAGGCCTAGTCAAGAAGAGG - Intergenic
1041876389 8:62692123-62692145 CTTGAAGCCTAGTCTTGAGCTGG + Intronic
1050360715 9:4828199-4828221 CATGATGCAAAGTACTGAGGTGG + Intronic
1059040337 9:110807854-110807876 CAGAAAGCCTAGTCCTGAGGAGG - Intergenic
1060221186 9:121764931-121764953 CTGTGTGCCCAGTCCTGAGGTGG - Intronic
1062629541 9:137457686-137457708 CCTGCTGCCCAGCCCTGAGGCGG - Exonic
1188404817 X:29795007-29795029 TTTGATTCCTACTCCTAAGGTGG - Intronic
1195981923 X:110588078-110588100 CTTTATGTTAAGTCCTGAGGTGG + Intergenic
1200153761 X:153964425-153964447 CTTGCTGCCTTCTTCTGAGGTGG + Intronic