ID: 914806092

View in Genome Browser
Species Human (GRCh38)
Location 1:150992994-150993016
Sequence GGTAATGAGTCTAAATGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914806091_914806092 -10 Left 914806091 1:150992981-150993003 CCACTGACAATTAGGTAATGAGT 0: 1
1: 0
2: 0
3: 6
4: 105
Right 914806092 1:150992994-150993016 GGTAATGAGTCTAAATGAATTGG 0: 1
1: 0
2: 1
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914806092 Original CRISPR GGTAATGAGTCTAAATGAAT TGG Intronic
900194239 1:1366607-1366629 TGAAATGAGTGTAAATGAGTGGG + Intergenic
901082357 1:6590709-6590731 GGCAATGACTCCAAATGGATAGG + Exonic
902968398 1:20029041-20029063 GGTAAAGAGTCTAATTGAGCTGG - Intronic
908580983 1:65516846-65516868 GGTGATGAGTCTTTATGAAATGG - Intronic
908903018 1:68978042-68978064 GGTAAAGAATCTAAATGTGTGGG - Intergenic
909516144 1:76509484-76509506 GGTATTGAATCTACATGAAAGGG + Intronic
910477226 1:87620210-87620232 GGTAATGGGTCTAATTGAGCTGG + Intergenic
911316368 1:96361348-96361370 GGAACTGAGTTTTAATGAATAGG - Intergenic
912146713 1:106803143-106803165 GGTAGTTGGTGTAAATGAATGGG + Intergenic
913298621 1:117346584-117346606 GGTAATGAGTCAAAAGCACTGGG - Intergenic
914806092 1:150992994-150993016 GGTAATGAGTCTAAATGAATTGG + Intronic
916100370 1:161389007-161389029 GGCAATCAGTATAAATGATTTGG + Intergenic
916127470 1:161584087-161584109 GTTAATGAGGCTCAATGAGTAGG + Intronic
916137388 1:161665891-161665913 GTTAATGAGGCTCAATGAGTAGG + Intronic
917235087 1:172883328-172883350 GGTCATGAGAGAAAATGAATGGG + Intergenic
917740662 1:177959109-177959131 GGTAATGAGTCTATAGCTATAGG + Intronic
918899604 1:190397021-190397043 GGTGATGAGTCAAAATGCAATGG + Intronic
918923259 1:190744190-190744212 GGAAATGAATATAAATGAGTTGG - Intergenic
919349915 1:196437602-196437624 GTAAATGACTATAAATGAATTGG - Intronic
919551525 1:198995790-198995812 AGTAATGGATCTATATGAATTGG + Intergenic
919661518 1:200252268-200252290 GGTAATGTGGCTACATTAATTGG - Intergenic
920680229 1:208066578-208066600 GATAATGATGCTAAATGACTAGG + Intronic
923201773 1:231719268-231719290 GATAAAGAGTAAAAATGAATAGG - Intronic
924647821 1:245895548-245895570 GGTACTGAGTCTATTTGAAATGG - Intronic
1064160021 10:12937315-12937337 GGAAATGAGTGAAAATAAATAGG - Intronic
1064513202 10:16117512-16117534 AGTAATGAGACCAAATGAAATGG + Intergenic
1064531384 10:16313996-16314018 GGTATTGAGTCAACATGAATGGG - Intergenic
1070105288 10:73425711-73425733 TTTAATGAGACCAAATGAATGGG + Intronic
1071182783 10:83006331-83006353 TGTAGTGAATCTAAATGCATTGG + Intergenic
1075793429 10:125102290-125102312 GGTAATGATTCTAATTGCACAGG - Intronic
1078294209 11:10049705-10049727 GGTACTGAGACTAAAAGTATGGG + Intronic
1080416462 11:32073905-32073927 GGTAATAAGTCTAAATGAAAAGG + Intronic
1081437706 11:43045159-43045181 TTTAATGAGTATGAATGAATAGG - Intergenic
1082964679 11:58954896-58954918 GGTAACGAGTCTGAAGAAATGGG + Exonic
1083334176 11:61913262-61913284 CGTCATGAGTCTCACTGAATTGG + Intronic
1086909607 11:92457287-92457309 GGTAATAAGTAAAAATGAATAGG + Intronic
1087614598 11:100473294-100473316 AATAATGAGTCTACATGGATTGG + Intergenic
1088070425 11:105777529-105777551 GGTCATGTGTTAAAATGAATGGG - Intronic
1090804247 11:130192754-130192776 GGTAATGAGACTGAATGCACGGG - Intronic
1090922675 11:131220601-131220623 GGTAATAAGTATAAAGAAATAGG + Intergenic
1097957639 12:65502564-65502586 GGCAATGATTCTCATTGAATTGG + Intergenic
1106066493 13:26357278-26357300 CGTAATCAGTGTAAATGTATGGG + Intronic
1108889104 13:55230519-55230541 AGCAATTAGTCTAAATGTATGGG + Intergenic
1109144298 13:58758378-58758400 GGTGATAAGTTTAAATGACTGGG - Intergenic
1109733986 13:66456703-66456725 GGGAAAGAGTCAAACTGAATAGG - Intronic
1109960063 13:69617971-69617993 GGTAATAAGTAGAAATGAAGTGG - Intergenic
1110179583 13:72599372-72599394 GGTAATAAATGTAAATGATTTGG + Intergenic
1111108636 13:83677472-83677494 GGTAATGGGTCTAAATTATTAGG - Intergenic
1114803876 14:25811374-25811396 AGTAATGTGTCTTAATGAAATGG + Intergenic
1115026004 14:28747040-28747062 GGTGATGATTAAAAATGAATGGG - Intergenic
1116044469 14:39727332-39727354 AGTAGTGATTCTAAATCAATGGG + Intergenic
1119312758 14:73663583-73663605 GGTCATGAGCCTAAATTAATAGG - Intronic
1125128777 15:36256847-36256869 TGGAATGAATCTAAATGAACAGG - Intergenic
1126046721 15:44648594-44648616 GCTAATGAGACTAAATGAAGTGG - Intronic
1128236177 15:66068856-66068878 GGTAATGAGGCACAATGTATGGG + Intronic
1128937079 15:71756027-71756049 GGAAATTAGTCTAGAAGAATTGG + Intronic
1130880098 15:88047564-88047586 GGTGAGGAGTTTTAATGAATTGG - Intronic
1140099117 16:71899272-71899294 TGTAATGCTTCTAAAGGAATTGG + Intronic
1143418458 17:6769209-6769231 GGTATTGAACCTAAATGGATGGG - Intronic
1148571049 17:48669407-48669429 GGTCATGAGCCTTCATGAATGGG + Intergenic
1148665806 17:49373804-49373826 GGCTATGATTCTAAAGGAATAGG - Intronic
1148696230 17:49560708-49560730 AATAATGTGTCTAAAGGAATAGG - Intergenic
1203198337 17_KI270729v1_random:252720-252742 GGTAATGAAACCAAATGAAATGG + Intergenic
1203207942 17_KI270730v1_random:53479-53501 GGTAATGAAACCAAATGAAATGG + Intergenic
1153457806 18:5298118-5298140 GGGGATGAGTCTAAATTAAAGGG + Intergenic
1155314750 18:24560460-24560482 CATAGTGAGTCTAATTGAATTGG + Intergenic
1155755193 18:29485224-29485246 GGAAAAGAGTGTTAATGAATAGG - Intergenic
1160373479 18:78392851-78392873 GCTGATGAGTTTAATTGAATTGG + Intergenic
1164693056 19:30225403-30225425 GGTGATGAGTATCAATGAACGGG + Intergenic
1167640948 19:50681086-50681108 GGAGAGGAGCCTAAATGAATGGG + Intronic
928126897 2:28622971-28622993 GGTAAGGAGGCTAAACAAATGGG + Intronic
929376704 2:41296163-41296185 GGTAATTAGGAGAAATGAATTGG - Intergenic
939510643 2:143100326-143100348 GGTAGTTGGTGTAAATGAATAGG + Intronic
939617530 2:144377838-144377860 AGTAATGAATCTAGAGGAATGGG + Intergenic
944297438 2:198082679-198082701 GATATTCAGTGTAAATGAATTGG + Intronic
944741367 2:202616029-202616051 GGTAGTTGGTATAAATGAATGGG - Intergenic
947082654 2:226416037-226416059 AATAATGAGTCAAAATGAAAGGG + Intergenic
948568633 2:238902245-238902267 GGTAAGGAGTTTGTATGAATTGG + Intronic
1169952362 20:11059294-11059316 GGTGAAGAATCTAAAAGAATGGG - Intergenic
1181837976 22:25626628-25626650 GGTTATAAGTTAAAATGAATTGG + Intronic
950733627 3:14986076-14986098 GGCACTGAGTCTGAAGGAATTGG - Intronic
951318962 3:21222135-21222157 TGTAATAAGCCTAAACGAATAGG - Intergenic
951705584 3:25541086-25541108 GACAATGAGTATAAATGAATAGG - Intronic
951996754 3:28738229-28738251 TGTACTGAGTCTATATGAGTGGG + Intergenic
956687332 3:71842230-71842252 AGAAATGAGTCTAATTTAATAGG - Intergenic
958118735 3:89256850-89256872 GGTAATGAATCTGAATCTATAGG + Intronic
959088991 3:101882144-101882166 GGTAATAAATATAAATCAATGGG - Intergenic
959755003 3:109887029-109887051 GGTAGTGGGACTCAATGAATTGG - Intergenic
961606938 3:128102687-128102709 GGGAATGACTGTAAATGAGTAGG + Intronic
962399592 3:135046992-135047014 TGTAATGAGTCTGACTGAGTTGG + Intronic
963385072 3:144582133-144582155 GATAATCAGACTAAATGAATAGG + Intergenic
963834791 3:150047390-150047412 GTTAATGAGGCTAAATGACATGG + Intronic
965074261 3:163956232-163956254 GGTAATGAGATTGAAAGAATAGG - Intergenic
965129765 3:164682257-164682279 GGTCATGTGTCTAAGTAAATGGG + Intergenic
965463459 3:168998065-168998087 GGTGATAACTCTACATGAATAGG + Intergenic
966233828 3:177678814-177678836 GGTGCTGAGTCTTAATGAAAAGG - Intergenic
969381949 4:6806877-6806899 TGTAATGAGACTAAATAAAAGGG - Intronic
971900477 4:32651545-32651567 GGTAATAATTGTAAATAAATTGG + Intergenic
974386267 4:61203739-61203761 TGTAATGATTCTAAATGATCTGG + Intronic
978501479 4:109414683-109414705 AGAAAAGAGTCTAAATAAATGGG + Intergenic
978883197 4:113732795-113732817 GCTATTAACTCTAAATGAATAGG - Intronic
978898601 4:113921887-113921909 GACAGTGAGTCTAAATAAATGGG + Intronic
979972829 4:127158806-127158828 GGTAATTAGTATATATGGATTGG - Intergenic
980579055 4:134725664-134725686 TAAATTGAGTCTAAATGAATGGG + Intergenic
980734309 4:136865254-136865276 GCTAATGTTTCTAAATGAAAGGG - Intergenic
984035573 4:174663793-174663815 GGTAATGACTCTGAATCCATGGG - Intronic
984836479 4:184026898-184026920 GGTAATAGGTCATAATGAATAGG - Intergenic
986200639 5:5575280-5575302 TTTAATTAGTCTGAATGAATGGG - Intergenic
986998695 5:13636965-13636987 GGTCATTAGTCTAATTGAAAAGG + Intergenic
989261013 5:39420516-39420538 GGTAAAAATTCTAAGTGAATGGG - Intronic
989967486 5:50482099-50482121 GGTAATGAGGGTGAATGAGTTGG + Intergenic
990557063 5:56947979-56948001 GGTTACGGGTCTAATTGAATTGG - Intronic
991534973 5:67659541-67659563 GGTAATGAGGCTTAATGTGTTGG + Intergenic
998828177 5:146127189-146127211 GGGAATGAATCTAAATGAAAAGG + Intronic
1002768587 6:267163-267185 GGTACTGAGTCTATATGCAATGG + Intergenic
1010562561 6:77368864-77368886 GGTAAAGAGTCTAATTGAGCTGG - Intergenic
1010853487 6:80807455-80807477 GGAAAGGAGTGAAAATGAATGGG + Intergenic
1015428400 6:133100224-133100246 GGTAAAGATATTAAATGAATAGG - Intergenic
1017832800 6:158146760-158146782 GGTAATGAGACTACCTGAACAGG - Exonic
1019792750 7:3027683-3027705 AGTAATGGGTGTTAATGAATGGG + Intronic
1020499249 7:8894963-8894985 TGTAGTGAGTCTAAATGATCTGG - Intergenic
1022173340 7:27850245-27850267 AGCAACAAGTCTAAATGAATTGG + Intronic
1023246751 7:38213208-38213230 AGTAATGAGACTAAATGGTTGGG + Intronic
1023739363 7:43264920-43264942 GATAATTAGTCTAGATGACTTGG + Intronic
1025306147 7:57858671-57858693 GGAAATGAGGCAAAATGAAATGG - Intergenic
1028301082 7:89201855-89201877 TATAATGGGTCTAAATTAATAGG - Intronic
1028992642 7:97065898-97065920 GGTACTAAGTGTAAATGAAATGG - Intergenic
1030862307 7:114649618-114649640 TGTAATAAGACTAAATAAATAGG - Intronic
1033129310 7:138731955-138731977 GATAATGAGGCTAAAAGAAATGG + Intronic
1036091860 8:5674414-5674436 GGTACTCATTTTAAATGAATTGG + Intergenic
1036775005 8:11605464-11605486 GGTCATGAGCCTAATTGAAAAGG + Intergenic
1040652610 8:49465607-49465629 GGTAAAGAGTCTAATTGAGCTGG + Intergenic
1041139026 8:54794786-54794808 GGCAATGAGTTGAAATGAAATGG + Intergenic
1042693336 8:71528156-71528178 GGCAATGAGTCTCAATGGTTAGG + Intronic
1043544654 8:81301598-81301620 GGTAATGAGACCATGTGAATGGG - Intergenic
1044846609 8:96388125-96388147 TGTAATGAGTCTTACAGAATTGG - Intergenic
1046562801 8:115860993-115861015 GGAAATAAGTCTTTATGAATAGG - Intergenic
1047083655 8:121492617-121492639 GGGAAAGAGTCCAAATGAAGAGG + Intergenic
1049955935 9:693026-693048 GGTAATGAATTTAAATCATTAGG + Intronic
1051360087 9:16274453-16274475 TGTAATGAGTCTGAATGATTGGG + Intronic
1053160898 9:35812740-35812762 AGGAATGAGCCTAAATGAGTAGG - Intergenic
1055417133 9:76095834-76095856 TGAAATGACTCTAAATGAAGAGG - Intronic
1058802237 9:108555741-108555763 GCTTATGTGTATAAATGAATAGG - Intergenic
1059571201 9:115438113-115438135 GGTACTGCGTCTTACTGAATAGG - Intergenic
1192893727 X:75418003-75418025 TGTACTGATTATAAATGAATGGG + Intronic
1197497836 X:127207707-127207729 GGTATTGATTGGAAATGAATGGG - Intergenic
1199663628 X:150079435-150079457 GTAAATGAGTCTAAATGAAGTGG - Intergenic
1201141932 Y:11035627-11035649 GGAATGGAGTCTAAAGGAATGGG - Intergenic