ID: 914811214

View in Genome Browser
Species Human (GRCh38)
Location 1:151029661-151029683
Sequence CTCAAACTTTCCAGCTCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914811214_914811222 19 Left 914811214 1:151029661-151029683 CCAGCCGAGCTGGAAAGTTTGAG 0: 1
1: 0
2: 1
3: 7
4: 83
Right 914811222 1:151029703-151029725 GCAAGACCTCATCTCTGTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 160
914811214_914811220 17 Left 914811214 1:151029661-151029683 CCAGCCGAGCTGGAAAGTTTGAG 0: 1
1: 0
2: 1
3: 7
4: 83
Right 914811220 1:151029701-151029723 TAGCAAGACCTCATCTCTGTTGG 0: 1
1: 2
2: 9
3: 51
4: 256
914811214_914811221 18 Left 914811214 1:151029661-151029683 CCAGCCGAGCTGGAAAGTTTGAG 0: 1
1: 0
2: 1
3: 7
4: 83
Right 914811221 1:151029702-151029724 AGCAAGACCTCATCTCTGTTGGG 0: 1
1: 0
2: 8
3: 34
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914811214 Original CRISPR CTCAAACTTTCCAGCTCGGC TGG (reversed) Intronic
900740277 1:4326921-4326943 CTGACACTGTCCAGCTCTGCTGG - Intergenic
901130775 1:6961754-6961776 TTCAAACATTCAAGCTGGGCTGG - Intronic
903512566 1:23887260-23887282 CTGAAAGTTTCCAGCTCAGGGGG + Intronic
907488826 1:54795782-54795804 CTCAAACTTCCCAGCTAAGTGGG + Intronic
912469728 1:109898226-109898248 CTCACCCCTTCCAGCTCTGCTGG + Intergenic
912771107 1:112464989-112465011 CTCAAACATAACAGCTCTGCTGG + Intergenic
914811214 1:151029661-151029683 CTCAAACTTTCCAGCTCGGCTGG - Intronic
914823604 1:151124528-151124550 ATCAAATTTTCCAGCTCTGGAGG - Exonic
915169231 1:153966347-153966369 CTTAAACTTGTCAGCTCGGACGG + Intronic
918587878 1:186208601-186208623 CTAAAACATTGCAGCTTGGCTGG + Intergenic
919861356 1:201740988-201741010 CTCCAACTTCCCAGGTCTGCGGG - Intronic
921775031 1:219088053-219088075 CTCAAACCTTCCACATTGGCTGG + Intergenic
924504932 1:244673167-244673189 CTCAATCTTTACAACTGGGCAGG - Intronic
1067108635 10:43382877-43382899 CTCAAACTCCTCAGCTTGGCCGG + Intergenic
1090587798 11:128233286-128233308 CACAACCTCTCCAGCTCTGCAGG + Intergenic
1092650908 12:10633961-10633983 CTCAAACTTTGGGGCTGGGCAGG - Intronic
1093856630 12:24112190-24112212 CTCAAACTTTCCAGTTTCACTGG - Intergenic
1107651499 13:42549697-42549719 CACAGGCTTTCCAGCTGGGCAGG + Intergenic
1117511230 14:56453395-56453417 CTCCAGCTTTCCAGCTCTGAGGG - Intergenic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1122363186 14:101179602-101179624 CTCAACCTTTCCAGCTAGCAGGG + Intergenic
1125484649 15:40103681-40103703 CTGACACTTTCCAGCTGGGGAGG - Intronic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1130651614 15:85765136-85765158 CTCACACTGCCCAGCCCGGCTGG + Intronic
1139458901 16:67106827-67106849 CTCAAACTCCCAAGCTCGGCCGG + Intergenic
1140933635 16:79651266-79651288 CTCAAGATTTCCAGATGGGCAGG + Intergenic
1143200016 17:5106299-5106321 CTGAAACTTTCCTCCTGGGCAGG + Exonic
1148462025 17:47844391-47844413 CTCATACTTTCCAGCTGGGCAGG + Intergenic
1150676062 17:67246159-67246181 CCCACACTTTCCAGCGCAGCGGG - Intergenic
1151277808 17:73049163-73049185 CTCAAAGTTTCAAGCAGGGCAGG + Intronic
1151939157 17:77281834-77281856 CGCTGACTTTCCAGGTCGGCCGG + Intronic
1152756187 17:82088034-82088056 CTCCAACTCTCCCGCTCTGCAGG - Exonic
1154205070 18:12329305-12329327 CTCAACCTTTCCAGCACGTCTGG + Exonic
1162585684 19:11556935-11556957 ATCAAATTTTCCAGCTCCACTGG + Intronic
1163405563 19:17119942-17119964 CTCAAACTCCCGAGCTTGGCCGG - Intronic
1163944423 19:20522422-20522444 ATCAGACTGTCCAGCTCGCCTGG - Intergenic
1165176063 19:33930732-33930754 CTCAAACTCCTGAGCTCGGCTGG + Intergenic
1166380949 19:42354984-42355006 CTCACTCTTTCCAGCTAGGCAGG + Intronic
1167434525 19:49471619-49471641 CTCAATCCTCCCACCTCGGCCGG + Intronic
936691172 2:114890882-114890904 CTCAAATTTTCCAGAACTGCTGG - Intronic
937390255 2:121479861-121479883 ATAAAAATTTCCAGCTTGGCTGG + Intronic
942526216 2:176855922-176855944 CTCACAATTCCCAGCTAGGCAGG + Intergenic
946075082 2:217067100-217067122 CTCAGCCTTTCCAGCTCCTCTGG - Intergenic
946409472 2:219509028-219509050 CTCAGCCTTTCCCCCTCGGCTGG - Intergenic
946885219 2:224216204-224216226 GTCAAACTTTACAGATCGGGGGG - Intergenic
1175864416 20:62167337-62167359 CTCAAACTCCTGAGCTCGGCCGG - Intronic
1182821384 22:33219613-33219635 CCCAAACTTTCCATCTCTTCTGG + Intronic
1184828031 22:46966223-46966245 CTCATGCTTTCCAGCCCGGTCGG + Intronic
950387056 3:12668348-12668370 TTCAAACTTTTCAGCTCACCTGG + Intergenic
951630525 3:24715194-24715216 CTCAGACTTACCAGCATGGCAGG + Intergenic
954650175 3:52156447-52156469 CTCAAACTTTCCTTCTCTGTTGG - Intergenic
961170167 3:124791914-124791936 CTCAAACCTTACAGCTCAGGAGG - Intronic
969411446 4:7031085-7031107 CTCGAACTTTCCACCTCCGCAGG - Exonic
973822614 4:54676250-54676272 CTCAGAGTTTCCAACTCAGCAGG - Intronic
975394350 4:73857402-73857424 ATTTAACTTTCCAGCTGGGCTGG - Intergenic
977557000 4:98496833-98496855 CTTAAACTTTACACCTAGGCTGG - Intronic
980998234 4:139802122-139802144 CTCTAACTCTCCAGCTCCACTGG + Intronic
983841825 4:172466449-172466471 CTCAAGATTTGCAGCTAGGCTGG + Intronic
984496311 4:180502401-180502423 ATCAAACATTCAAGCTAGGCAGG + Intergenic
997295773 5:132767332-132767354 CTCAGAGTTACCAGCTGGGCTGG - Intronic
997637194 5:135421023-135421045 CTCAAACTTTACAGGTCAGGAGG - Intergenic
1001158614 5:169294569-169294591 CTCAAACCTTCCAGCTGGATAGG + Intronic
1002081451 5:176739953-176739975 CTCAAACTGGCCTTCTCGGCTGG - Intergenic
1002374819 5:178781078-178781100 CTCCAAATTCCCAGGTCGGCTGG - Intergenic
1005425695 6:25700490-25700512 CCACAACTTTCCAGCTTGGCAGG + Intronic
1013229624 6:108150170-108150192 CTCAAACCTTCCATCTGGGAAGG - Intronic
1017036791 6:150274244-150274266 CTCGAGCTGTCCAGCTTGGCAGG + Intergenic
1019271943 7:154362-154384 CTCCAAGCTTCCACCTCGGCAGG - Intergenic
1025118471 7:56278718-56278740 CTCATCCTTTCCAACTCTGCAGG + Intergenic
1025264382 7:57442938-57442960 CACAAACATTCCAGCTGGGCAGG - Intergenic
1025634830 7:63313169-63313191 CACAAATATTCCAGCTGGGCAGG + Intergenic
1025647865 7:63435001-63435023 CACAAATATTCCAGCTGGGCAGG - Intergenic
1031752109 7:125588945-125588967 CTCAAACTTTTCAGAGAGGCAGG - Intergenic
1033986706 7:147235242-147235264 CTCCAGCTTTCCAGCTCACCTGG + Intronic
1038153096 8:24959766-24959788 CTGAAACTTTCAGGCTCTGCTGG - Intergenic
1040303694 8:46201249-46201271 CTGAAACTTTACAGCACGCCTGG - Intergenic
1041903603 8:63008345-63008367 CTCAAATTTGCCAGCTTGGAAGG - Intergenic
1042529567 8:69801033-69801055 CCCAAACTTTGCTGCTCTGCAGG + Intronic
1048457791 8:134593476-134593498 CTCAGACTCTCCATCTCTGCTGG - Intronic
1053085574 9:35217822-35217844 CTCAAACTTTCAAGCTCAAGTGG - Intronic
1058248093 9:102655742-102655764 CTCAAAATTTATAGCTCTGCAGG + Intergenic
1059436442 9:114279417-114279439 CTCAAAGTCTCCAGCTCCTCCGG - Intronic
1060226222 9:121792689-121792711 ATCAGACTTCCCAGCTCGCCTGG + Intergenic
1061385888 9:130289196-130289218 CTCACACGTTCCAGCACGGCTGG + Intronic
1062560099 9:137137808-137137830 CTCCAAACTTCCACCTCGGCAGG - Intergenic
1062578370 9:137218873-137218895 CACAGACTTTCCTGCTGGGCTGG - Intergenic
1187387320 X:18860561-18860583 CTCAAACTCCCAACCTCGGCCGG - Intergenic
1190689776 X:52903859-52903881 CTCACACTTTGCAGCTGGGAGGG - Intronic
1190696207 X:52951933-52951955 CTCACACTTTGCAGCTGGGAGGG + Intronic
1190776826 X:53559343-53559365 CACAAACTTGCCTGCTTGGCTGG + Exonic
1191655361 X:63591188-63591210 CACAAACTTGCCAGCTCTGCTGG + Intergenic
1197312213 X:124918474-124918496 CTCAAATTTTCAGCCTCGGCTGG - Intronic