ID: 914812272

View in Genome Browser
Species Human (GRCh38)
Location 1:151037671-151037693
Sequence GTGTGAGGGTGGCTGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1333
Summary {0: 1, 1: 0, 2: 13, 3: 161, 4: 1158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914812268_914812272 -10 Left 914812268 1:151037658-151037680 CCTAGGTGAGGACGTGTGAGGGT 0: 1
1: 0
2: 1
3: 9
4: 124
Right 914812272 1:151037671-151037693 GTGTGAGGGTGGCTGGGAGAAGG 0: 1
1: 0
2: 13
3: 161
4: 1158
914812266_914812272 -9 Left 914812266 1:151037657-151037679 CCCTAGGTGAGGACGTGTGAGGG 0: 1
1: 0
2: 1
3: 5
4: 90
Right 914812272 1:151037671-151037693 GTGTGAGGGTGGCTGGGAGAAGG 0: 1
1: 0
2: 13
3: 161
4: 1158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914812272 Original CRISPR GTGTGAGGGTGGCTGGGAGA AGG Intronic
900004171 1:33667-33689 GTGGGTGGGGGGCTGGGGGAGGG - Intergenic
900023898 1:204183-204205 GTGGGTGGGGGGCTGGGGGAGGG - Intergenic
900319655 1:2076272-2076294 ATGTGAGGGAGGTGGGGAGATGG - Intronic
900320845 1:2082870-2082892 GTGTGAGGGTGCAAGGGAGAGGG + Intronic
900339936 1:2183457-2183479 GTGAGAGGGTGAATGGGAGTGGG + Intronic
900339944 1:2183491-2183513 GTGAGAGGGTGAATGGGAGTGGG + Intronic
900383281 1:2396190-2396212 GGACGTGGGTGGCTGGGAGAGGG - Intronic
900480467 1:2895718-2895740 GAGTGAGGGAAGCTGGGAGCAGG + Intergenic
900679557 1:3909157-3909179 GTGTCATGGAGGGTGGGAGATGG - Intergenic
900680851 1:3915397-3915419 CTGTGGGGGTGGCTAGGGGAGGG - Intergenic
900891840 1:5455059-5455081 GTGTGAGGGTGGATGGGAGCTGG - Intergenic
900913957 1:5621363-5621385 GAGTGAGGGTGTCTGGAAAATGG + Intergenic
901018759 1:6245600-6245622 GGGCGGGGGTGGCTTGGAGAGGG + Intergenic
901430532 1:9211372-9211394 GTGGGAGGGAGGCTGAGAGCTGG - Intergenic
901513411 1:9729819-9729841 GTCTGAGTATGGCTGGGAGTCGG - Exonic
901678731 1:10901358-10901380 GTGTGTGGGTAGCTGGAAGGAGG + Intergenic
902113430 1:14101954-14101976 GTTTGAGGTTTGCTGGAAGAGGG - Intergenic
902183784 1:14710251-14710273 GGTTGATGGTGGCTGGAAGAAGG - Intronic
902192663 1:14774411-14774433 GGGTGAGTGTGGGTGTGAGAAGG - Intronic
902231768 1:15032095-15032117 GTGTGGGGGTGGATCGGGGAGGG - Intronic
902414590 1:16231399-16231421 CTGTGGGGGAGGCTGGGACATGG - Intergenic
902777641 1:18684852-18684874 GTGTGAGGGAGGCTGAGAGAAGG + Intronic
902990748 1:20185830-20185852 GGGGGAGAGTGTCTGGGAGAGGG - Intergenic
903321938 1:22548538-22548560 CTGGGAGGGTGGTTGGGAGGAGG - Intergenic
903357508 1:22757117-22757139 GGGTGATGGTGGGTGGGAGAGGG + Intronic
903560366 1:24222412-24222434 GGGTGGGGGTGGCAGGGAGTGGG + Intergenic
903634750 1:24804382-24804404 GTGTGTGGGTGGGTGGGTGGAGG + Intronic
903710729 1:25322132-25322154 GGGGGAGGGTGGCGGGGAGGTGG + Intronic
903716361 1:25370275-25370297 GGGGGAGGGTGGCGGGGAGGTGG - Intronic
904183929 1:28687911-28687933 GTTTGAGGGTGGGTGGGAAAAGG + Intronic
904326041 1:29727702-29727724 GTATCAGGTGGGCTGGGAGATGG + Intergenic
904435741 1:30493809-30493831 GTGGCAGCGAGGCTGGGAGAGGG + Intergenic
904464710 1:30700968-30700990 GTGGGAGCCTGGCTGGGCGATGG + Intergenic
904542240 1:31240668-31240690 TTTTGGGGGTGGCTTGGAGAAGG - Intergenic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
904894102 1:33801181-33801203 GAGTGAGGATGGGAGGGAGAGGG - Intronic
905546884 1:38807281-38807303 GTGTGTGTGTGTCAGGGAGAAGG - Intergenic
905770734 1:40636483-40636505 GTCTGAGGGTGCCTGAAAGAGGG - Intronic
905892699 1:41527213-41527235 GTGTGAGGGTGAGTGTGTGAGGG - Intronic
905892888 1:41528233-41528255 GTGTGAGGGTGAGTGTGTGAGGG - Intronic
906152697 1:43596761-43596783 GTGTGCGGGTGGCAGTGGGATGG + Intronic
906154225 1:43604740-43604762 GTTTGAAGCTGGCTGGGAGTGGG + Intronic
906205902 1:43986140-43986162 GTATCAGGCTGGCTGGGAGAAGG + Intronic
906206112 1:43987404-43987426 GTATCAGGCTGGCTGGGAGAAGG - Intronic
906583083 1:46952550-46952572 GTGTGAGGCTGTCTGGGAAAGGG + Intergenic
906701175 1:47859290-47859312 GTGTGAGGCTGGCTGGCTGTGGG - Intronic
906834413 1:49067897-49067919 GGGTGTGGGGGGCTGGGGGAGGG - Intronic
907425266 1:54375514-54375536 GTGTGAAAGTGGCTGGCAGCAGG - Intronic
907567811 1:55452758-55452780 GTGTGGGGGTGGGTGGGTGTGGG - Intergenic
907574349 1:55512736-55512758 GAGTGAGGCTGGCCAGGAGAAGG - Intergenic
907580424 1:55567530-55567552 GTGGCAGCGAGGCTGGGAGAGGG - Intergenic
907602872 1:55788009-55788031 GTGTGAGGCTTCCTGGGAAAAGG - Intergenic
907679554 1:56550716-56550738 GTGTGGGGGTGGGTGGGAGGAGG - Intronic
907700321 1:56780297-56780319 GTGTGAGGGAGGCTGGCCTAGGG - Intronic
907836426 1:58113281-58113303 GTTGGAGGGTGCGTGGGAGAGGG + Intronic
908431583 1:64063897-64063919 GTGAGAAGGGGGATGGGAGAGGG - Intronic
908472494 1:64457714-64457736 ATGGGAGGGTGGCAGGGGGAAGG + Intergenic
908726457 1:67182343-67182365 GTGGCAGCGAGGCTGGGAGAGGG - Intronic
908769420 1:67582824-67582846 GTGAGAGGGGAGGTGGGAGAAGG - Intergenic
908977810 1:69919904-69919926 GTGTGACAGTGGCAGGGAGTGGG - Intronic
909441193 1:75698057-75698079 GTGGCAGTGAGGCTGGGAGAGGG + Intergenic
909728192 1:78861550-78861572 GTGTCAGGGAGGCGGGGATATGG - Intergenic
909736461 1:78968502-78968524 GTGGGGGGGTGGGGGGGAGACGG + Intronic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910019134 1:82565180-82565202 GAGTGAAGGGGGCGGGGAGAAGG - Intergenic
910977699 1:92924609-92924631 GTGAGAAGGTGGGTGGAAGAAGG + Intronic
911136090 1:94442610-94442632 GTGGGAGGGTGGCGGGGTGAGGG - Intronic
911261695 1:95693989-95694011 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
911532864 1:99066163-99066185 TGGTGAGGGTGGCAGGGAGGTGG + Intergenic
911565985 1:99464087-99464109 GTGTCACGGTGACTGGGAGGTGG - Intergenic
912631212 1:111248178-111248200 GTGTTTGGGTGGCTTGGAAAAGG + Intergenic
912720475 1:112015793-112015815 GAGTGAGGGTAGATGGGAGAAGG - Intergenic
912749011 1:112270046-112270068 ATGTGATGGGGACTGGGAGAAGG - Intergenic
912822366 1:112878408-112878430 GCGTGGTGGTGGCTGGGAGGTGG - Intergenic
913470700 1:119182648-119182670 GTGTGAGGCTGTCTGGGGAATGG - Intergenic
913547113 1:119880032-119880054 GTGTGAGGGTGTCTGAGAGAAGG - Intergenic
914685037 1:149970934-149970956 GTCTGGGTTTGGCTGGGAGAAGG + Intronic
914743562 1:150484973-150484995 GTGTGTGTGTGGTTTGGAGAAGG - Intergenic
914750818 1:150533905-150533927 GAGAGAGGGAGGCTGGAAGAAGG + Intergenic
914812272 1:151037671-151037693 GTGTGAGGGTGGCTGGGAGAAGG + Intronic
915034679 1:152911694-152911716 GGGTGAGGGTGGGGGAGAGAGGG + Exonic
915088728 1:153406511-153406533 GTGTCAGGGTGGCAGGGAGATGG - Intergenic
915096170 1:153464324-153464346 GTGTCAGGGTGGCAGGGAGATGG + Intergenic
915267513 1:154729413-154729435 GAGAGAGGGTGGCTGGGACGGGG + Intronic
915402919 1:155636936-155636958 GTGTGAGGCTCTCTGGGAAAGGG - Intergenic
915598983 1:156910532-156910554 GTGGGAAGGTGGGAGGGAGACGG + Intronic
915605227 1:156946193-156946215 ATGTCAGCGTGGCTGGGAGCTGG + Intronic
915709146 1:157877382-157877404 GGGGGTGGGGGGCTGGGAGAAGG + Intronic
915711908 1:157907829-157907851 GGGGGTGGGGGGCTGGGAGATGG + Intergenic
916122558 1:161541672-161541694 GTGAGATGGTTGCTGGGAGGAGG + Intergenic
916348255 1:163819235-163819257 ATCTGAGGGTAGATGGGAGAGGG + Intergenic
916790879 1:168124119-168124141 GGGACAGGGTGGATGGGAGAAGG - Intronic
918235749 1:182579078-182579100 GTGGGAGGGTTGGAGGGAGAGGG + Intronic
918491780 1:185089052-185089074 GTGGGTGGGTGGGTGGGGGATGG + Intronic
918650306 1:186954439-186954461 GGGTGTGGGGGGCTGGGGGAGGG + Intronic
918651265 1:186966216-186966238 GTGTGTGGGTGGTTGGGGGTGGG + Intronic
919032053 1:192254426-192254448 GTGTGTGGGAGGCTAGGGGAGGG - Intergenic
920029847 1:203030282-203030304 AGGTGAGGCTGGATGGGAGAGGG + Intronic
920160642 1:203995473-203995495 GTGGGAGGCTGGCTGGGAGCAGG - Intergenic
920199191 1:204249125-204249147 GGGCGAGGCTGGCTTGGAGAAGG - Intronic
920393885 1:205629946-205629968 GTGGGAGAATGGCCGGGAGATGG + Intronic
920426000 1:205875631-205875653 GTGTGAGGCTTCCTGGGAAAAGG - Intergenic
920440033 1:205974373-205974395 GTGTGAGTGTGGGTGGGTGTGGG - Intergenic
920717672 1:208356008-208356030 GTGGGAGGCTGGATGGGGGAGGG + Intergenic
920995627 1:210987990-210988012 GTGTCAGCGAGGCTGGGGGAGGG - Intronic
921043871 1:211460287-211460309 ATGTGAGGGCGGCTGGGAAGAGG - Intergenic
921634931 1:217481016-217481038 GTGGGAGGGTAGCAGGGAGGTGG + Intronic
921848380 1:219907793-219907815 GTTTAGGGGTGGCTGGGAGCTGG + Intronic
921942398 1:220855624-220855646 ATGGGAGGGTGAGTGGGAGATGG - Intergenic
922050997 1:221990555-221990577 GGATGAGGGTGGCAGGAAGAGGG - Intergenic
922595880 1:226812555-226812577 GGGGGAGACTGGCTGGGAGATGG - Intergenic
922603896 1:226877088-226877110 GGGTGAAGGTGGGTGGGTGAGGG + Intronic
922651776 1:227346456-227346478 GGCTGAGGGTGGGTGGGAGACGG - Intergenic
922726381 1:227924865-227924887 GTGGGAGGGTGGCTGAAATAAGG + Intronic
922896307 1:229103018-229103040 GTGTGCGGGGTGCTGGGAGGTGG - Intergenic
923110498 1:230886064-230886086 GTATGAGACTGCCTGGGAGAAGG + Intergenic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
1062812376 10:476647-476669 GTGTGGAGGGGCCTGGGAGAGGG - Intronic
1063352280 10:5366625-5366647 GTGTGTGAGTGGCTGGGGGCTGG - Intronic
1064304178 10:14150533-14150555 GATTGGGGGAGGCTGGGAGAGGG - Intronic
1064514907 10:16136612-16136634 GTCGGCGGGTGGCAGGGAGAGGG - Intergenic
1065199736 10:23301351-23301373 GTGTGAGGCTGTCTGGGGAAGGG - Intronic
1065245040 10:23748151-23748173 GAGTGAGGGAGGCTGGGCCAAGG - Intronic
1065410930 10:25427204-25427226 GTGTGAAGGGTGTTGGGAGAAGG + Intronic
1065912305 10:30319066-30319088 GGGAGGGGGAGGCTGGGAGAAGG + Intronic
1067068976 10:43118996-43119018 GTGTGTGGGTGTGTGCGAGAGGG + Intronic
1067145005 10:43688511-43688533 GTGAGAAGCTGGCTGGGAGAGGG + Intergenic
1067170482 10:43902255-43902277 CTGTGAGGGAGGCTGGAAAATGG - Intergenic
1067250122 10:44578951-44578973 GTGGGTGGGGGGCTGGGGGAGGG - Intergenic
1067555581 10:47267674-47267696 GTGTGGGGGTGGGTGGGGGTGGG - Intergenic
1067897756 10:50202333-50202355 GTTTGAGGGAGGCTGGTAGCTGG - Intronic
1069278993 10:66629824-66629846 GTGTGAAGGTGGCTGTGAAAAGG - Intronic
1069383839 10:67866366-67866388 TTGTGAGGGTGGCTGTGAGAGGG - Intergenic
1069595517 10:69667482-69667504 TTGTGAAGGCGGGTGGGAGAAGG - Intergenic
1069794949 10:71046110-71046132 GTCTGTGAGTGGCAGGGAGACGG + Intergenic
1069961228 10:72080604-72080626 GGGTGGGGGTGGCTGGGAAGTGG + Intronic
1070424281 10:76270329-76270351 ATGTGAAGATGGCTGGGAGCTGG + Intronic
1070711759 10:78688370-78688392 GTGTGAGGGTGTGTGTGTGAGGG + Intergenic
1070718415 10:78739440-78739462 GTGTGGGCCTTGCTGGGAGAGGG - Intergenic
1070776799 10:79114537-79114559 GTGTGAAGGTGGGAGGGAGAAGG + Intronic
1071327322 10:84530130-84530152 GTGTGAGGCTGTCTGGGGAAGGG - Intergenic
1071370795 10:84949740-84949762 ATGTGAGGCAGACTGGGAGAGGG + Intergenic
1071457028 10:85858774-85858796 GTGTGTGGATGGGTGGGAGTAGG - Intronic
1072472341 10:95724188-95724210 GTGTGAGGCTATCTGGGAAAGGG - Intronic
1073098606 10:100995664-100995686 GTGTGGGGGTGTCTGCTAGAAGG - Intergenic
1073291008 10:102413269-102413291 CTGAGAGGGTAGCTGGCAGAGGG + Intronic
1073434468 10:103507889-103507911 GTGTGTGTGTGGCTGGGAACTGG - Intronic
1073531891 10:104239954-104239976 GTATGAGGGTGGGGTGGAGAGGG - Intronic
1074063471 10:109990141-109990163 GTGGGGTGGTGGCTGGGACAAGG - Intergenic
1074101543 10:110358177-110358199 CGGGGAGCGTGGCTGGGAGAGGG - Intergenic
1074195092 10:111176838-111176860 GTGAGAGTGGTGCTGGGAGAAGG - Intergenic
1074445453 10:113517820-113517842 GAGTGTGGGTGGCTGAGAGTAGG + Intergenic
1074580887 10:114718330-114718352 GTGTGGGGGTGGGTGGGCTATGG - Intergenic
1074767976 10:116714550-116714572 GGGTGAGTGTGTCTGGGGGAGGG - Intronic
1074867363 10:117552624-117552646 GTGTAAGGCTGGCAGGGTGAGGG + Intergenic
1074976051 10:118582590-118582612 GTGTGAGCATGGCTTGGAGTAGG + Intergenic
1075257001 10:120933240-120933262 GGCTGAGGGTGGCTAGGAGGAGG + Intergenic
1075259873 10:120953956-120953978 GTGTGGCTGGGGCTGGGAGAGGG + Intergenic
1075357303 10:121792076-121792098 CTGTTTGAGTGGCTGGGAGAGGG + Intronic
1075518026 10:123125016-123125038 GAGTGAGGCTGGATGGGAGCAGG - Intergenic
1075591102 10:123692340-123692362 GTGTGAGGCTGGCTGGGAAGAGG - Exonic
1075677941 10:124309112-124309134 GTGTGAGAGTGCCTGGCAGGTGG + Intergenic
1075979619 10:126725388-126725410 GTGGGTGGGGGGCTGGGAGAGGG - Intergenic
1076598022 10:131637986-131638008 GGGTGAGTGGGGCTGGGACAGGG - Intergenic
1076598033 10:131638019-131638041 GGGTGAGTGGGGCTGGGACAGGG - Intergenic
1076598045 10:131638052-131638074 GGGTGAGTGGGGCTGGGACAGGG - Intergenic
1076598057 10:131638085-131638107 GGGTGAGTGGGGCTGGGACAGGG - Intergenic
1076598069 10:131638118-131638140 GGGTGAGTGGGGCTGGGACAGGG - Intergenic
1076598081 10:131638151-131638173 GGGTGAGCGGGGCTGGGACAGGG - Intergenic
1076598093 10:131638184-131638206 GGGTGAGTGGGGCTGGGACAGGG - Intergenic
1076684284 10:132190087-132190109 ATGAGAGAGGGGCTGGGAGAAGG - Intronic
1076902645 10:133347538-133347560 GTGTGCGGGTGGGAGGGAGAAGG + Intronic
1077045900 11:544999-545021 GTGTGAGGGGGTCTCTGAGAGGG + Intronic
1077121394 11:910598-910620 GTGTGAGGGGGCGTGTGAGAGGG - Intronic
1077140000 11:1020117-1020139 ATGTGAGCGTGGCTGGAAGGAGG + Exonic
1077159503 11:1106276-1106298 GTGGGTGGGTGGATGGTAGATGG - Intergenic
1077159580 11:1106551-1106573 ATGGGAGGGTGGATGGTAGATGG - Intergenic
1077213516 11:1384345-1384367 GTGGGTGGGTGGCAGGGGGAGGG - Intergenic
1077280090 11:1740375-1740397 GGGTGAGGGTGGCTTGGACCAGG + Intronic
1077306407 11:1870523-1870545 GTGTGGGGGTGTCAGGAAGAGGG + Intronic
1077308862 11:1879734-1879756 GAGGGAGGCAGGCTGGGAGAGGG + Intronic
1077410135 11:2400048-2400070 GTGTGAGGGTGGCCGGGCAGTGG + Intergenic
1077416703 11:2427328-2427350 GTGTCAGGGTGCTGGGGAGAAGG - Intergenic
1078429577 11:11278364-11278386 GTGGGTGGGGGGCTGGGGGAGGG + Intronic
1078686389 11:13536094-13536116 GTGGTAGGGTGGTTGGTAGAAGG + Intergenic
1078757353 11:14223681-14223703 GCGTGAGGGTGGGAGGTAGAAGG - Intronic
1078836785 11:15037871-15037893 GTGTGAGTGTGGCTAGAAGAGGG + Intronic
1079112183 11:17611106-17611128 GTGAGAGGGTGGCTCGTAGCAGG - Exonic
1079161555 11:17999646-17999668 GTGTGAGGGGGACAGGGAGGTGG - Intronic
1079323696 11:19473629-19473651 CTGTGAGGGAGGCTTGGAAATGG + Intronic
1079391161 11:20023274-20023296 GTGTGAGTGGGGGTGGGAGGGGG + Intronic
1079671237 11:23174115-23174137 TAGTGAGGGTGGGTGGGTGAGGG + Intergenic
1080216479 11:29847652-29847674 GTGTGTGTGTGGCAGGGATAAGG - Intergenic
1080576785 11:33607098-33607120 GTGTGAGGGGGTCGGGGAGCAGG - Intronic
1080685208 11:34509610-34509632 GAGTGAGGGGGGCAGGGAGGGGG + Intronic
1080692192 11:34567344-34567366 GGGTGATGGAGACTGGGAGAAGG + Intergenic
1080791808 11:35528001-35528023 GTGTGGTGGGGGCTGGGAGGTGG - Intronic
1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG + Intergenic
1081323835 11:41721884-41721906 GGGAGTGGGGGGCTGGGAGAGGG - Intergenic
1081526112 11:43928798-43928820 GAGTTAGGGAGGCTGGGAAAAGG + Intronic
1081593481 11:44443288-44443310 GTGGGTGGGGGGCTGGGGGAGGG + Intergenic
1081693007 11:45090800-45090822 GTGTGAATGAGGCTGGCAGAGGG + Intergenic
1081717434 11:45260437-45260459 GAGAGAGGGAGCCTGGGAGAGGG + Intronic
1081787284 11:45756525-45756547 GAGTGGGCCTGGCTGGGAGAGGG + Intergenic
1082619111 11:55398971-55398993 GTGGCAGCGAGGCTGGGAGAGGG - Intergenic
1082811024 11:57479105-57479127 GTGTCAGGCTGGCTGTGAGGAGG + Intergenic
1082871588 11:57947690-57947712 GTGGGTGGGAGGCTAGGAGAGGG - Intergenic
1082901283 11:58255985-58256007 GTGAGAGGGTGGGAAGGAGAAGG + Intergenic
1083252199 11:61475625-61475647 GGCTGGGGGTGGCAGGGAGAGGG - Intronic
1083307390 11:61768508-61768530 GTGGGTGGGTGGCTGGCACAGGG + Intronic
1083311107 11:61784202-61784224 GTGGCAGGCTGGCTGGGAGGGGG + Intronic
1083332466 11:61905337-61905359 GAATGAGGGAGGCTGGGAGGGGG + Intronic
1083840485 11:65301593-65301615 CTGGGAGGGTGGCCGAGAGATGG + Intronic
1083891044 11:65595859-65595881 CTGTGTGGGTGGCTGGGACCCGG + Exonic
1083997888 11:66281021-66281043 GTGTTGGGGTGTCTGGCAGACGG - Intronic
1084009222 11:66338466-66338488 GTGGGAGGGTGGCGGGGAGGCGG - Intronic
1084116532 11:67045876-67045898 AGGTGAGGGGGGCTGGGGGATGG + Exonic
1084128917 11:67118866-67118888 GTGTGAGGGTGTGTGGGGGGAGG + Intergenic
1084192124 11:67504082-67504104 AGGTGAGGGCGGCGGGGAGAGGG - Exonic
1084603614 11:70160543-70160565 GGGTGCTGCTGGCTGGGAGAAGG + Intronic
1084611919 11:70208737-70208759 GTGTGAGTGTGGCGTGGAGGGGG - Intergenic
1084675265 11:70630327-70630349 CTGTGAGGGTGGCAGACAGAAGG + Intronic
1084694022 11:70743285-70743307 GTGTGAGGGTGTCTGGAGGTGGG + Intronic
1085318047 11:75557843-75557865 GAGAGAGGGAGGCTGGGAGAGGG + Intergenic
1085464273 11:76713500-76713522 GTGGGAGGGTGGATGGATGATGG + Intergenic
1085510494 11:77085747-77085769 GTGTGAGGGTGGGCTGGGGAGGG + Intronic
1085615295 11:77993472-77993494 ATGTGAGGATGGGTGGAAGAGGG + Intronic
1085794292 11:79523233-79523255 GGGGGAGGGCGGGTGGGAGAAGG + Intergenic
1085842567 11:80029233-80029255 CTGGGAGTGTGGCTGGCAGATGG - Intergenic
1086256133 11:84878556-84878578 GTGGGTGGGTGGCTAGGGGAGGG + Intronic
1087076062 11:94128440-94128462 GTGAGAGGGTGGCGCGGAAACGG - Intergenic
1087273519 11:96137671-96137693 GTGTGAGTGTGTCTGAAAGACGG + Intronic
1087553790 11:99688752-99688774 GTCAGAGGGTGGCGGGGAGAAGG - Intronic
1087719406 11:101644886-101644908 GTGGGTGGGGGGATGGGAGAGGG + Intronic
1087837673 11:102891085-102891107 ATGGGACTGTGGCTGGGAGATGG - Intergenic
1088361483 11:108994627-108994649 GTGGGAGGGTGGGGAGGAGATGG - Intergenic
1088385148 11:109246052-109246074 GTCTGAGGGGGGCCGGGGGAGGG + Intergenic
1089070584 11:115696601-115696623 GTGTGAGTGTGTGTGGGAGAGGG - Intergenic
1089201143 11:116725473-116725495 GGGTGAGGGTGGGGAGGAGATGG + Intergenic
1089322976 11:117639253-117639275 GTGGGAGGCTGGCTGGGAGCTGG + Intronic
1089574601 11:119432468-119432490 GTTGCAGGGTGGCTGAGAGACGG + Intergenic
1089577272 11:119454027-119454049 GAGGGTGGGTGGCTGGGAGCAGG + Intergenic
1089744496 11:120607371-120607393 GTGTGCAGGAGGCCGGGAGAAGG + Intronic
1089887257 11:121839506-121839528 TTCTGCGGTTGGCTGGGAGAAGG - Intergenic
1090534671 11:127627400-127627422 GTGTGAGGGTGGGGTGGGGAGGG + Intergenic
1090579998 11:128148993-128149015 CAGTGAGGGAGGCTGGGAGGAGG + Intergenic
1090627608 11:128619892-128619914 GTGTGAGGGTGGGGGGCTGAGGG - Intergenic
1090664468 11:128905518-128905540 GGGGGAGGGTGGCTGCGACAGGG - Intronic
1090798388 11:130154924-130154946 GTTTGTGGGTGGGTGGGATAAGG + Intergenic
1091377594 12:35715-35737 GTGGGTGGGGGGCTGGGGGAGGG - Intergenic
1091560025 12:1605209-1605231 GTGTGAGAGTGTGTGGGGGAGGG + Intronic
1091821652 12:3479950-3479972 GTGAGGGGGAGGATGGGAGAGGG + Intronic
1091842564 12:3631426-3631448 GTCTGGGGGAGGCAGGGAGAGGG - Intronic
1092055240 12:5503546-5503568 GAGTAAGGGGGGCTGGGCGAGGG + Intronic
1093022493 12:14216914-14216936 GTGTGAGGCTTTCTGGGAAAGGG + Intergenic
1093380167 12:18482156-18482178 GTGCGAGGGTGGCGGGGGGCGGG - Intronic
1093589706 12:20886858-20886880 GTGGGAGGGTGGAAGGGAGTGGG - Intronic
1093780870 12:23135866-23135888 GTGAGAGTGTGGCTGTTAGAGGG + Intergenic
1094123518 12:26998723-26998745 GTGTGGGGATGGATTGGAGAGGG - Intronic
1094475916 12:30840425-30840447 GTGTGAGGGTGGGTGTGCGGAGG + Intergenic
1094490927 12:30960126-30960148 GTGGGTGGGTGGGTGGGTGATGG + Intronic
1094755984 12:33468716-33468738 GGGTGTAGGGGGCTGGGAGAGGG + Intergenic
1094861870 12:34476723-34476745 GTGGCAGGGAGGCGGGGAGAGGG + Intergenic
1095102854 12:38201833-38201855 GTGGGAGAGGGGCTGGGAGAGGG + Intergenic
1095222695 12:39635643-39635665 GTGGGCGGGGGGCTGGGGGAGGG + Intronic
1095582298 12:43814245-43814267 GTGTGATGTTGAATGGGAGATGG + Intergenic
1095945593 12:47751551-47751573 GAAGGAGGGTGGCAGGGAGAGGG + Intronic
1096122531 12:49097551-49097573 CTGAGAGGGTGGGTGGCAGAGGG - Exonic
1096492282 12:52019335-52019357 GGGTGGGGGTGGATGGGAAAAGG + Intergenic
1096801437 12:54113077-54113099 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1096838049 12:54363662-54363684 GTGTGAGGTTGGCTATGAGCAGG + Exonic
1096944742 12:55392243-55392265 TGGTGAGGGTGGCTGGGTGCTGG - Intergenic
1096997427 12:55847632-55847654 GGGTAAGGGTGGCTGTCAGAGGG - Intergenic
1097046148 12:56189174-56189196 GGGAGAGGGAGGCTGGGGGAGGG + Intronic
1097189665 12:57213411-57213433 GTGTGAGAGACGCTGGGAGCTGG + Intergenic
1097679303 12:62633666-62633688 GGGTGAGGGTGGCTGGGCTGGGG + Intergenic
1097899568 12:64859232-64859254 GTGTGAGGGGGACTGTCAGAAGG + Intronic
1098166091 12:67699551-67699573 GGGTGGGGGGAGCTGGGAGAAGG - Intergenic
1098291131 12:68957832-68957854 GGGGGTGGGTGGCTGGGGGAGGG - Intronic
1098922522 12:76315565-76315587 GTGTGTGGGGGGTTGGGGGAGGG - Intergenic
1098964764 12:76775278-76775300 GTGTGTCAGTGGCTTGGAGAAGG + Intronic
1099893072 12:88612707-88612729 GTGTCAGTTTGGCTGGGAGATGG - Intergenic
1100021257 12:90072002-90072024 GTGTGTGTGTGTGTGGGAGAGGG + Intergenic
1100132383 12:91512240-91512262 GTGTGTGTGTGGCAGGGAGGCGG + Intergenic
1100281250 12:93120297-93120319 GTGTGAGGGTGGCCCAGAAATGG + Intergenic
1100381907 12:94070251-94070273 GGGGGTGGGGGGCTGGGAGATGG + Intergenic
1100605948 12:96152305-96152327 GTGAGAAGGTGGCTGGGCCAAGG - Intergenic
1100620399 12:96265590-96265612 GTGGGAGGATGGCTGGGAGGTGG + Intronic
1100648471 12:96558040-96558062 TTGTGGAGGTGGCAGGGAGATGG + Intronic
1100957483 12:99925076-99925098 GTGCGAGGGTGGCTGGGGGCTGG + Intronic
1101033039 12:100678530-100678552 GTGTGGGTGTGGGTGGGAGTGGG - Intergenic
1101191701 12:102340512-102340534 GTGTGAGTGTGGATGGGGTAGGG + Intergenic
1101429440 12:104614815-104614837 GTGAGAGGGGAGATGGGAGAGGG + Intronic
1101757942 12:107635855-107635877 GTGTGTGGGTGGGTGGGGGGGGG - Intronic
1101970536 12:109309410-109309432 GTGTGAGGGGGGCGGGGCGGAGG + Intergenic
1102436128 12:112925356-112925378 GCCTGCGGTTGGCTGGGAGAGGG - Intronic
1102601228 12:114032367-114032389 ATGTGAGGGTGGCTGCCACAAGG + Intergenic
1102703585 12:114862018-114862040 GTTTGGGGGCGGCTGGGAGAGGG - Intergenic
1102725754 12:115063109-115063131 GGGTGGGGGTGGCAGGTAGACGG + Intergenic
1102929012 12:116848556-116848578 TTGTTGGGGTGGATGGGAGAGGG - Intronic
1103007546 12:117433910-117433932 GTGTGAGGGTGTGTGTGTGAGGG - Intronic
1103172307 12:118832225-118832247 GTGTGTGGGAGGCAGGAAGAGGG - Intergenic
1103173696 12:118843865-118843887 GTGTGAACCTGGCTGGGGGAGGG - Intergenic
1103197329 12:119056106-119056128 GTGGGAGGGAGGCTGAGAGGGGG - Intronic
1103329667 12:120145235-120145257 GTCTGAGGTAGGCTGGGGGATGG - Intronic
1103351586 12:120287417-120287439 GTGGGAGGGTGGGTGGGGGTTGG + Intergenic
1103809517 12:123602275-123602297 GGGGGAGTGAGGCTGGGAGAGGG + Intronic
1104067939 12:125320543-125320565 GGGTGAGCTTGGCTAGGAGAAGG + Intronic
1104517102 12:129437880-129437902 GGGGGAGGGGGGCTGGGGGAGGG - Intronic
1104651562 12:130538491-130538513 GTGGGCGGGTGGCTGGGTGCTGG - Intronic
1104851879 12:131880026-131880048 GTGTGAGGCTGTCTGGGAAAGGG - Intergenic
1104896195 12:132166213-132166235 GTGGGTGGGTGGCTGGATGATGG - Intergenic
1105280101 13:18958339-18958361 CTGTGATGGGGACTGGGAGAAGG - Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105407009 13:20141738-20141760 GTTTGGGGGTGGCGGGGACAAGG - Exonic
1105518195 13:21109346-21109368 ATGTGGAGGTGGCTGAGAGAGGG - Intergenic
1105662577 13:22514826-22514848 GTGTGTGTGTGGCAGGGAGGAGG + Intergenic
1105939130 13:25131206-25131228 GTGTGAGAGTGAGTGGGGGAGGG + Intergenic
1106167332 13:27259869-27259891 GTGTGTGGGTGGGTGGGTGGTGG + Intergenic
1106245300 13:27944618-27944640 GGAGGAAGGTGGCTGGGAGAGGG + Intergenic
1106597750 13:31161441-31161463 CTGCGAGGGTGGATGGGAGGAGG - Intronic
1107585902 13:41848083-41848105 GGGTGAGGGTGATGGGGAGAAGG + Intronic
1107753258 13:43591946-43591968 GTGTGTGGGCTGCTGTGAGAAGG - Intronic
1108174535 13:47778582-47778604 GGGTGGGGGTGGCTAGGGGAGGG - Intergenic
1108707567 13:53003450-53003472 GGGTGGGAGTGGGTGGGAGAGGG - Intergenic
1109306207 13:60644993-60645015 GGGTGAGGGAGGGTGAGAGAAGG + Intergenic
1109742813 13:66577624-66577646 GTGTTAGGGGGGCGGGGAGTGGG - Intronic
1109931390 13:69222569-69222591 GTGTGAGGCTATCTGGGAAAGGG + Intergenic
1110729232 13:78860612-78860634 GTGGCAGCGAGGCTGGGAGAGGG - Intergenic
1110788998 13:79566861-79566883 GTGAGAGGGAGGAGGGGAGAAGG - Intergenic
1111021540 13:82458245-82458267 GTGTGAGGCTGTCTGGGGAAGGG + Intergenic
1111232729 13:85364355-85364377 GTGTGTGGGTGGGTGGGTGGAGG + Intergenic
1112386632 13:98946092-98946114 GAGAGAGGCGGGCTGGGAGAAGG + Intronic
1112630027 13:101150242-101150264 GGGTGGGGGTGGCGGGGAGCGGG + Intronic
1113093378 13:106637763-106637785 GTGTGAGGTTGGAAGGGACATGG - Intergenic
1113437692 13:110306652-110306674 GGGTGAGGGTGCCTGGGAGCCGG - Intronic
1113465675 13:110511269-110511291 TTCTGAGGCTGGCTGGGAGATGG - Intronic
1114390260 14:22300450-22300472 GTCAGAGGGTGGTTGGGAGCTGG - Intergenic
1114486682 14:23067009-23067031 GGGTGGGGGTGGATGGGAAAGGG - Intronic
1114684026 14:24510853-24510875 TAGTGAGGGTGACTGGTAGAGGG + Intergenic
1115440608 14:33430520-33430542 GTGGGAGTGTAGTTGGGAGAGGG - Intronic
1115730198 14:36260199-36260221 GTGGGTGGGGGGCTGGGGGAGGG + Intergenic
1115872020 14:37815342-37815364 GCGTCAGGGTGGCGGGGTGATGG + Intronic
1115897240 14:38104372-38104394 GTTTGAGGGTTTCTGGGAAAGGG + Intergenic
1115936428 14:38558323-38558345 GGGAGTGGGGGGCTGGGAGAGGG + Intergenic
1116634463 14:47377646-47377668 GTGGCAGTGAGGCTGGGAGAGGG + Intronic
1117202107 14:53401531-53401553 GTGTGTGGTGGGCAGGGAGAAGG - Intergenic
1117588076 14:57234366-57234388 GTGTGTGGGTGGGTGTGAGTGGG - Intronic
1117707084 14:58481765-58481787 GTATGGGGGTGGGTGGGGGAGGG - Intronic
1117803976 14:59470936-59470958 GTGTGGGGGTGGCTGGGGGCGGG + Intronic
1118640798 14:67790523-67790545 GTGGTGAGGTGGCTGGGAGAGGG - Intronic
1119153065 14:72383230-72383252 GTATGTGTGTGGATGGGAGAGGG + Intronic
1119157896 14:72428349-72428371 GTGGGTGGGTGGATGGTAGATGG + Intronic
1119268116 14:73277091-73277113 AGGTGATGCTGGCTGGGAGATGG + Exonic
1119564284 14:75615461-75615483 GTGTGAGAGTGTGTGGGAAAGGG + Intronic
1119856254 14:77903485-77903507 GCGTCAGGGGGACTGGGAGAGGG + Intronic
1120008120 14:79382986-79383008 GTGTGTGGGTGGGTGGGTGAGGG + Intronic
1120033667 14:79671033-79671055 GGGTGAGTTTGGCTGAGAGACGG - Intronic
1120838877 14:89065244-89065266 GGGTGAGCCTGGATGGGAGATGG + Intergenic
1121085640 14:91144180-91144202 GTGGGAGGGTCCCTGGGACAGGG + Intronic
1121535469 14:94687616-94687638 TTGTGAGTGTGGGTGGGGGAAGG - Intergenic
1121586350 14:95065552-95065574 GTGTGAGGGGTGGTGGGAGGGGG - Intergenic
1121672793 14:95725742-95725764 GTCTGCTGGTGCCTGGGAGAAGG + Intergenic
1121824411 14:96998912-96998934 GTGTGTGGGTGGGTGGGTGGGGG + Intergenic
1122253116 14:100454365-100454387 GTGTGAGGGTGGAGGTGAGGAGG + Intronic
1122348273 14:101073598-101073620 GTGTGGGGGTGGCGGGGAGGAGG + Intergenic
1122462589 14:101907793-101907815 GAGAGAGGGTGCATGGGAGAGGG - Intronic
1122485948 14:102079876-102079898 GCATGGGGGTTGCTGGGAGATGG + Intergenic
1122546208 14:102524219-102524241 ATGAAAGGGGGGCTGGGAGAAGG + Intergenic
1122604259 14:102937964-102937986 GTGTGAGGGTGACGGGGGCAGGG - Intronic
1122784169 14:104156283-104156305 GTGAGGGAGTGGCTGGGAGAAGG + Intronic
1122805562 14:104254801-104254823 CGCTGAGGGTGGGTGGGAGAAGG + Intergenic
1122957103 14:105075963-105075985 CTGGGAGGGTGGCTGGGAGACGG + Intergenic
1124478716 15:30059252-30059274 GGGTGAGGGCTGCTGGAAGAAGG + Intergenic
1124797446 15:32795591-32795613 GTGGGGGGGTGGCAGGGTGAAGG + Intronic
1124857162 15:33400363-33400385 GTGTGTGTGTGGCGGGGGGAAGG - Intronic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1125170260 15:36758983-36759005 GGGTGAGAGTGGTTGGGATAGGG + Intronic
1125284069 15:38073277-38073299 GGGTGGGGGAGGCCGGGAGAGGG - Intergenic
1125289115 15:38126010-38126032 GTGTGTGGGCGGCTAGGAAAGGG + Intergenic
1125891583 15:43270708-43270730 GGGTGAGGGTGCTGGGGAGAGGG + Intergenic
1126257761 15:46647947-46647969 GTGTGTGAGTGGGTGGGAGGTGG + Intergenic
1126383505 15:48071328-48071350 GTATGCTAGTGGCTGGGAGAAGG - Intergenic
1126578750 15:50222789-50222811 GTGTGTGGGTGGCAGGAAAAAGG + Intronic
1126582953 15:50257895-50257917 GTGTGTGGGTGGGTGGGCGGGGG - Intronic
1126699773 15:51357527-51357549 GTGTGAGGCTTTCTGGGAGAGGG + Intronic
1127333126 15:57957909-57957931 CTGAGAGGGTGGGTGGGAGCGGG + Intronic
1127449882 15:59105693-59105715 CTGTGATGGCGGCTGGGAGGAGG + Intronic
1127522133 15:59753666-59753688 GTGAGAGGGTGCATGAGAGATGG + Intergenic
1127962387 15:63899337-63899359 GTGTGCTGGTGCCTGGCAGATGG - Intergenic
1128039886 15:64562899-64562921 GTGTGTGTGTGTCTAGGAGAGGG + Intronic
1128160691 15:65421597-65421619 GTGGGAGGGAGGCGGGGGGAAGG - Intronic
1128179303 15:65587608-65587630 TTGTGTAGGTGGGTGGGAGATGG + Intronic
1128186314 15:65646043-65646065 GTGGGAGGGATGCTGGGTGAAGG + Intronic
1128294178 15:66503875-66503897 GGGTGAGGGTGAGTGGGACAGGG - Intronic
1128363010 15:66975942-66975964 GTGTGAGGCTGTCTGGGAAAGGG - Intergenic
1128506379 15:68275933-68275955 GAGGGAGGGTGGTAGGGAGACGG + Intergenic
1128756182 15:70185536-70185558 AAGCGAGGGGGGCTGGGAGATGG - Intergenic
1128902744 15:71439865-71439887 GGGTGTGGGGGGCTAGGAGAGGG + Intronic
1129682534 15:77665907-77665929 GTGTGGGGGTGGCTGGGATGGGG - Intronic
1129757008 15:78104808-78104830 TTGTGAAGGAGGCCGGGAGAAGG + Exonic
1130012308 15:80161137-80161159 GAGTGAGAGGGGCTGGGAGGAGG - Intronic
1130352193 15:83102412-83102434 GTGTGAGTGGGGCTGGCAGGAGG - Intergenic
1130520765 15:84658946-84658968 CTGTGATGCTGGCTGTGAGAGGG - Intergenic
1131046635 15:89320735-89320757 GTGTTAAAGTGGATGGGAGAGGG + Intronic
1131094571 15:89647358-89647380 GTGTGAGCTTGGACGGGAGAGGG - Intronic
1131302343 15:91210609-91210631 GGTTAAGGGAGGCTGGGAGATGG - Intronic
1131327792 15:91465739-91465761 GTGTGAGGATAGCTGGAACAGGG - Intergenic
1131420215 15:92298826-92298848 GTGTGAGGCTGTCTGGGGAAGGG + Intergenic
1131489306 15:92848866-92848888 GGGGGAGGGTGGCAGGGATACGG - Intergenic
1131509118 15:93039536-93039558 GTGGGTGGGGGGCTGGGGGAGGG - Intronic
1132074690 15:98810134-98810156 GTGTGGGGGTGGCTGGCGGAGGG + Intronic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132186187 15:99803890-99803912 CTGTGAGAGTGGCTGGGGGTAGG + Intergenic
1132243106 15:100275999-100276021 GTGGGAGGGTGGGAGGGAGTAGG + Intronic
1132243179 15:100276181-100276203 GTGGGAGGGTGGGAGGGAGTGGG + Intronic
1132243191 15:100276210-100276232 GTGGGAGGGTGGGAGGGAGTGGG + Intronic
1132243214 15:100276268-100276290 GTGGGAGGGTGGGAGGGAGTGGG + Intronic
1132243225 15:100276297-100276319 GTGGGAGGGTGGAAGGGAGTGGG + Intronic
1132243301 15:100276484-100276506 GTGGGAGGGTGGGAGGGAGTGGG + Intronic
1132243313 15:100276513-100276535 GTGGGAGGGTGGGAGGGAGTGGG + Intronic
1132449333 15:101957277-101957299 GTGGGTGGGGGGCTGGGGGAGGG + Intergenic
1132568576 16:634370-634392 TTGTGAGGTTGGGTGGGAGACGG - Intergenic
1132579401 16:678187-678209 GGGGGTGGGTGGCTGGGACAGGG - Exonic
1132607128 16:798313-798335 GTGTGAGTGGGGCTGGGAGTGGG + Exonic
1132607151 16:798383-798405 GTGGGAGTGGGGCTGGGAGTGGG + Exonic
1132607174 16:798453-798475 GTGGGAGTGGGGCTGGGAGTGGG + Exonic
1132607212 16:798591-798613 GTGGGAGTGGGGCTGGGAGTGGG + Exonic
1132654196 16:1035072-1035094 GTGTGGAGGTGGCTGGGCCAGGG + Intergenic
1132671145 16:1102772-1102794 AGGTGAGGGGGGCTGGGGGAGGG - Intergenic
1132830344 16:1924908-1924930 GATTGAGGGTGGCTGGAAGCAGG - Intergenic
1133233532 16:4377350-4377372 GTGGGAGGGTGGGTGGGCGGCGG + Intronic
1133302063 16:4788342-4788364 GTGTGATGGGGGAGGGGAGAGGG + Exonic
1133407194 16:5534163-5534185 GTGCAAGGGTGGCTGGGAAAGGG + Intergenic
1133890934 16:9877852-9877874 GGGAGAGGGAGGCAGGGAGAGGG - Intronic
1133950516 16:10387831-10387853 GTGTCCGGGTGGCGGGGGGAGGG - Intronic
1133998574 16:10765663-10765685 GTGTGAGGGAGGTGGGAAGATGG - Intronic
1134185591 16:12082718-12082740 GTGTGTGGGTGGCTGGGACAAGG + Intronic
1134197502 16:12170275-12170297 GTGTGTGGGTGACAGGGAGCGGG + Intronic
1134224713 16:12381345-12381367 GTGGGTGGGTGGCTGGATGATGG - Intronic
1134224842 16:12381766-12381788 GTGGGTGGGTGGCTGGATGATGG - Intronic
1134325539 16:13204349-13204371 GAGGCAGGGTGGCTGGGCGAGGG + Intronic
1134746069 16:16589550-16589572 AGGTGAGGGTGTCTGTGAGAGGG + Intergenic
1134999411 16:18764194-18764216 AGGTGAGGGTGTCTGTGAGAGGG - Intergenic
1135136574 16:19889273-19889295 GTGTGAGGGGGGTTAGGACAGGG + Intergenic
1136138671 16:28274848-28274870 ATGTGGGAGTGGGTGGGAGAGGG + Intergenic
1136993514 16:35172197-35172219 GTGGGTGGGTGGGTGGGTGAAGG + Intergenic
1138281826 16:55778109-55778131 ATGTGAGGATGGCAGGGAGCAGG - Intergenic
1138287045 16:55818304-55818326 ATGTGAGGATGGCAGGGAGCAGG + Intronic
1138443089 16:57046787-57046809 GTGTGAGGGGTGCTGGGAGTTGG + Intronic
1138443243 16:57047449-57047471 GAGTGAGGGATGCTGGGAGAAGG + Intronic
1138608741 16:58106211-58106233 GTGTGTGGGTGGGTGGGAGTGGG - Intergenic
1138614663 16:58155793-58155815 GTGTGTGTGTGGCTGGGGGCTGG + Intergenic
1138691264 16:58770912-58770934 ATGTGAGGGTAGCAGGCAGAGGG - Intergenic
1139322353 16:66125758-66125780 CTGAGATGGTGGCTAGGAGAGGG + Intergenic
1139442766 16:66977136-66977158 GGAGGAGGGTGGCTGGGAGGGGG + Intergenic
1140066812 16:71618453-71618475 GTGTCATCGTGGCTGGGGGATGG - Intergenic
1140606253 16:76542536-76542558 GCGTGCAGGTGGCTGGGAAAGGG + Intronic
1140996799 16:80268035-80268057 GTGTGTGGGGGGCTGGGGGGTGG + Intergenic
1141149211 16:81552569-81552591 GTCAGAGAGAGGCTGGGAGATGG - Intronic
1141163488 16:81644821-81644843 GTGAGATGGGGGCTTGGAGAGGG + Intronic
1141265753 16:82495458-82495480 GTGTGAGAGTGCCAGGGGGAGGG + Intergenic
1141431363 16:83971892-83971914 GTGTCAGCGTGGCTGGGAGCAGG + Intronic
1141461425 16:84180625-84180647 GAGTGGGGGTGGCTGCGAGAAGG - Intronic
1141489394 16:84361798-84361820 GTGGGGGTGGGGCTGGGAGAAGG + Intergenic
1141601154 16:85127157-85127179 GTGTGTGGGTGGGTGGAAGGGGG - Intergenic
1141748135 16:85939902-85939924 GAGTGAAGGTGGCTTGTAGAAGG - Intergenic
1141766193 16:86061466-86061488 GTGTGAGGGTGACTGGGGGCGGG - Intergenic
1141855396 16:86677732-86677754 GTGTGGGGATGGCGGGGAGAGGG - Intergenic
1142130395 16:88429368-88429390 GTGAGTGGGTGGGTGGAAGAAGG - Exonic
1142285970 16:89171695-89171717 GTGTGAGGGGGGCGGGGAGGGGG - Intergenic
1142380714 16:89730421-89730443 GTGTGAGGAGGGCTGGGAGCTGG + Intronic
1142399869 16:89852946-89852968 GTGAGAGGGAGGATGGAAGACGG - Intronic
1142399884 16:89852986-89853008 GTGAGAGGGAGGATGGAAGACGG - Intronic
1142478632 17:204623-204645 GGGTGAGGATGGTTGGGGGATGG - Intergenic
1142785166 17:2215847-2215869 GAGTGAGGGTGGGTGGGGGGCGG + Intronic
1142880291 17:2878413-2878435 GGGTGAGGCTGAGTGGGAGAGGG + Intronic
1142883746 17:2900069-2900091 GTGGGTGGATGGCTGGGAGCGGG + Intronic
1143172410 17:4937947-4937969 GTGTGAAGGCAGCTGGGTGAGGG - Intronic
1143352355 17:6298077-6298099 CTGGGAGGGAGGCTGGGAGGGGG - Intergenic
1143423733 17:6816372-6816394 GGGTGTGGGGGGCTGGGGGAGGG - Intronic
1143460736 17:7101908-7101930 GGGTGAGGGTTGCTGGGACTGGG - Intronic
1143676512 17:8436454-8436476 TTGCGAGGGTGGCTTGGAGCGGG + Intronic
1143793612 17:9318262-9318284 GTGGGTGGGGGGCTGGGGGAGGG - Intronic
1143885472 17:10061781-10061803 CTGAGAGGGAGGCTGGGAGTGGG - Intronic
1143953710 17:10653167-10653189 GGGTGATGGTGGCTGGGAACGGG + Intronic
1144049927 17:11489867-11489889 GTGTGATGGTGGTTGGGGAAGGG - Intronic
1144222503 17:13112823-13112845 GAGGCAGGGTGGATGGGAGATGG - Intergenic
1144341110 17:14310894-14310916 GTGTGTGGGTGGATGGGTGTGGG + Intronic
1144577206 17:16436630-16436652 GAGTGAGGGAAGCAGGGAGAAGG + Intronic
1144591878 17:16531328-16531350 GTGTGGGGGTGGGTGGGGGGCGG - Intergenic
1144628699 17:16858639-16858661 GTGGGGAGGTGGCTCGGAGAGGG - Intergenic
1144853980 17:18258190-18258212 GGGTGGCGGTGGCGGGGAGAGGG + Intronic
1144945028 17:18965447-18965469 GTGGGAAGGTGGCTGAGAGCGGG + Intronic
1144966071 17:19078015-19078037 GGGTGAGGGTGCATGGGAAACGG + Intergenic
1144981897 17:19174174-19174196 GGGTGAGGGTGCATGGGAAACGG - Intergenic
1144986326 17:19204065-19204087 GGGTGAGGGTGCATGGGAAACGG + Intergenic
1145240000 17:21235607-21235629 GAGTGAGGCTGGCAGGGGGAAGG - Intergenic
1145279820 17:21458745-21458767 GTGTGTGTGTGGCGGGGAGCAGG + Intergenic
1146380645 17:32324722-32324744 GGGTCAGGATGGGTGGGAGAGGG + Intronic
1146569607 17:33941280-33941302 TTCTGAGGGCGTCTGGGAGAGGG - Intronic
1146790410 17:35747703-35747725 GTGTGGGGGAGGCTGGAGGAAGG - Intronic
1147059591 17:37864628-37864650 TTGGGATGGTGGCAGGGAGAAGG - Intergenic
1147140948 17:38460452-38460474 ATCTGAGGGTGGCGGGTAGAAGG - Intronic
1147161630 17:38572354-38572376 GTGTGTGGGTGGGTGGGTGGGGG + Intronic
1147313646 17:39608504-39608526 GCGTGAGGGTGGGTGGGGGAGGG - Intronic
1147436963 17:40422412-40422434 ATGGGAGGTTGGCTGGGAGCGGG - Intergenic
1147923575 17:43933227-43933249 GTGGGAGGGAGGCAGGAAGAAGG - Intergenic
1148123857 17:45227045-45227067 GTGGGCAGGTGGCAGGGAGATGG + Intronic
1148214946 17:45829409-45829431 GGGTGGGGGTTGCTGGGAGAGGG + Intronic
1148243071 17:46012743-46012765 GGGGGAGGGGGGCTGGGACAGGG - Intronic
1148408863 17:47447118-47447140 TTGGGATGGTGGCAGGGAGAAGG - Intergenic
1148752535 17:49953610-49953632 TTCTGAGAGTGGCTGGGAGTTGG - Intergenic
1148789783 17:50166710-50166732 GTGTGAGGGTGTGTGTGTGAGGG - Intronic
1148789791 17:50166756-50166778 GTGTGAGGGTGTGTGTGTGAGGG - Intronic
1148789797 17:50166790-50166812 GTGTGAGGGTGTGTGTGTGAGGG - Intronic
1149180474 17:53930822-53930844 GGGTGTGGGGGGCTGGGGGAGGG + Intergenic
1149235691 17:54588182-54588204 GGGGGTGGGTGGCTGGGGGAGGG - Intergenic
1149274465 17:55017817-55017839 GTGTGAGGCTGTCTGGGAAAGGG - Intronic
1149461622 17:56834014-56834036 GTGTGAGGTGGGAGGGGAGACGG - Intronic
1149737223 17:59007216-59007238 GTGTGTGGGTGGGTGGGGGTGGG - Intronic
1149949252 17:60967732-60967754 GTGTGGGGGGTGGTGGGAGAAGG - Intronic
1150441408 17:65194766-65194788 GTGTGAGGGAGGTGGGGTGATGG + Intronic
1151076407 17:71278598-71278620 GTGGGTGGGGGGCTAGGAGAGGG - Intergenic
1151313902 17:73310732-73310754 GTGTGTGTGTGACTGGGGGAGGG - Intronic
1151337751 17:73450119-73450141 ATGTGAGGGTGGCTGAGAGTTGG + Intronic
1151357766 17:73570623-73570645 CTTTGTGGGTGGCTGCGAGATGG - Intronic
1151358174 17:73572422-73572444 ATGTGGGGGTGGATGGGAGCTGG - Intronic
1151375313 17:73684475-73684497 CTGGGAGGGAGGCAGGGAGAAGG + Intergenic
1151654332 17:75488802-75488824 GGGTGAGGGTGGAGGGGAGAAGG - Exonic
1151943303 17:77305996-77306018 GTGGGTGGGTGGGTGGGTGAAGG + Intronic
1151957502 17:77387777-77387799 GTGTGAACGGGGCTGGGAGCAGG + Intronic
1152018562 17:77768377-77768399 GTGTGAGTGTGTATGGGAGGAGG - Intergenic
1152077733 17:78169264-78169286 GTGTGTGTGTGGCGGGGAGGGGG + Intronic
1152097590 17:78280945-78280967 GTGTTGGGGAGGCTGGGAGTGGG + Intergenic
1152585213 17:81186232-81186254 GAGTGCGGGAGGCTGGGAGTGGG - Intergenic
1152630214 17:81407572-81407594 GTGCCATGGTGGGTGGGAGAAGG + Intronic
1152767466 17:82148936-82148958 GTGGGTGGGTGGATGGTAGATGG + Intronic
1152799484 17:82324176-82324198 GGGTGGGGGTGGCAGGGAGGCGG + Intronic
1153054700 18:934486-934508 CTGTGAGGGAGGCTGGAAGAGGG + Intergenic
1153115668 18:1652616-1652638 CTGTGAGGGGAGCTGGGAGAAGG + Intergenic
1153266350 18:3273747-3273769 GGGTGAGGCAGGCTGGGAGTGGG + Intronic
1153842895 18:9022970-9022992 GTCAGAGGGTGGCTAGGTGAAGG + Intergenic
1154122614 18:11663973-11663995 GGGTGAGGCTGTCTGGGGGATGG + Intergenic
1154173657 18:12067923-12067945 GTGGGGGGATGGCTGGGAGCCGG + Intergenic
1154432784 18:14321122-14321144 GTGAGAGGGTGGTGGGCAGAAGG + Intergenic
1154485037 18:14866467-14866489 GTAGGAGGGTGGCTGGCAGCTGG + Intergenic
1155331685 18:24725275-24725297 ATTTGAGGGTTGCTGGGAGGGGG - Intergenic
1156298825 18:35817890-35817912 GGCTGAGGGTGGCTGGGTGCTGG - Intergenic
1156481863 18:37441373-37441395 CTGGGATGGTTGCTGGGAGACGG + Intronic
1156830727 18:41487797-41487819 GTGGGAGGGGGGCAAGGAGAGGG - Intergenic
1157002083 18:43538989-43539011 GGGTGTGGGGGGTTGGGAGAGGG - Intergenic
1157302478 18:46489026-46489048 GAGTGAGGGTGACGGGCAGACGG - Exonic
1157552228 18:48589761-48589783 GTGTGGGGGGAGCTGGGAGATGG + Intronic
1157685558 18:49640076-49640098 GGGTGAGGGAGGCTGGAAGAGGG + Intergenic
1157701465 18:49763621-49763643 GAGTCAGGGTGGTTGGGAGAGGG + Intergenic
1157824639 18:50801691-50801713 GGGTGGGGGTGGCTTGAAGAGGG + Intronic
1158125987 18:54100150-54100172 CTGCCAGTGTGGCTGGGAGAAGG + Intergenic
1158818871 18:61135528-61135550 GTGGTGGGGTGGGTGGGAGATGG - Intergenic
1158947092 18:62456642-62456664 GTGGGAGGGTGGGTGGGTGGGGG - Intergenic
1160201665 18:76801612-76801634 GGGCGAGGGAGGCAGGGAGAGGG - Intronic
1160409756 18:78667747-78667769 GTGGGAGGGTGGATGGGAGAGGG - Intergenic
1160409775 18:78667789-78667811 GTGGGAGGGTGGATGGGAGAGGG - Intergenic
1160409817 18:78667902-78667924 TTGGGAGGGTGGATGGGGGAAGG - Intergenic
1160409833 18:78667939-78667961 GTGGGAGGGTGGATGGGGGAGGG - Intergenic
1160500966 18:79400879-79400901 GGGGGAGGGTGGCTGGGGGGAGG - Intronic
1160504565 18:79419607-79419629 GCGTGAGGGCGGCAGGGAGCTGG + Intronic
1160635923 19:75276-75298 GTGGGTGGGGGGCTGGGGGAGGG - Intergenic
1160922434 19:1527164-1527186 GTGTGAGGGAGGACGGGGGAGGG + Intronic
1161048955 19:2151860-2151882 GTGTGAGCGTGGCTGGATGTGGG + Intronic
1161063099 19:2225027-2225049 GTCTGAGAGGGGCCGGGAGAGGG + Intronic
1161528798 19:4774241-4774263 CCTTGGGGGTGGCTGGGAGAGGG - Intergenic
1161878967 19:6933792-6933814 GTGTGGGGGCAGCGGGGAGAAGG - Intronic
1161964286 19:7539871-7539893 GGGTGAGGGGGGCACGGAGAAGG - Intronic
1162081126 19:8218504-8218526 GAGTCAGGGTGGCTGCGGGAGGG + Intronic
1162301922 19:9849288-9849310 GTGTGACGGTGGCAGGGAGTGGG - Exonic
1162901409 19:13797085-13797107 GTTTGTGGGAGGCTCGGAGATGG - Intronic
1163364829 19:16870014-16870036 GTGTGAGGGCCGCAGGGAGAAGG + Exonic
1163738608 19:18996985-18997007 AGGTGGGAGTGGCTGGGAGAGGG + Intronic
1163744101 19:19034523-19034545 GAGTGGGTGTGGCTGGTAGAGGG + Intronic
1164173259 19:22746054-22746076 GTGTGAGGCTGTCTGGGAAAGGG + Intergenic
1164495061 19:28753077-28753099 GTGGGTGGGGGGCTGGGGGAGGG + Intergenic
1164524149 19:29001117-29001139 GGGTGAGGGAGGCGGGGAGAGGG + Intergenic
1164635088 19:29785964-29785986 GGGTGTGGGAGGCTGGGAGGGGG + Intergenic
1164678239 19:30117402-30117424 GTGTGTGTGTGGCGGGGGGAAGG + Intergenic
1165256132 19:34578121-34578143 GTGTGATTGCGGCTGGGACAGGG + Intergenic
1165319761 19:35077891-35077913 GAGTGAGGGTGCCAGGGAGGTGG - Intergenic
1166118105 19:40667843-40667865 GTGTGGGGGTGGCAGGAACACGG + Exonic
1166133996 19:40764243-40764265 GTTGGAGGGTGTCTGGGAGAAGG + Intronic
1166303457 19:41924706-41924728 GTGTGGGGGTGGCTGGGAACAGG + Intronic
1166317197 19:41995893-41995915 GTATGAGGGTGGGTGGGTGAAGG + Intronic
1166318745 19:42003498-42003520 GTGGGAAGGGGGCTGGGAGGGGG + Intronic
1166392894 19:42419698-42419720 GGGTGGGGGTGGATGGGGGATGG + Intronic
1167116566 19:47492319-47492341 GTGTGATGGTGGCTGGGTGGGGG + Intronic
1167217159 19:48172126-48172148 GGGTGGGTGTGGGTGGGAGACGG + Intronic
1167272023 19:48511311-48511333 GTGGGAGGGAGGCTGGGGGCTGG - Intronic
1167308309 19:48721322-48721344 GTGGGTGGGTGGCTGGTGGAGGG + Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1167574568 19:50311972-50311994 GAGTGAGGGTGGGTGGGAAGGGG + Intronic
1167575811 19:50317003-50317025 GGGTGGGGGTGGCTGGGTGGGGG - Intronic
1167672139 19:50859456-50859478 CTGTGAGGGAGGCTGGGTAAGGG - Intronic
1167674893 19:50877882-50877904 CTGTGAGGGAGGCTGGGTGAGGG - Intronic
1168029799 19:53670426-53670448 GGGAGAGTGTGGCTGGGAAATGG - Intergenic
1168146057 19:54420647-54420669 GTGGGAGGGAGGCTGGAGGATGG - Intronic
1168204437 19:54839367-54839389 GTGTGAGGGGAGCTGTGACAAGG + Intronic
1168348070 19:55660427-55660449 GTGAAAGGGTGCCTGGGAGGGGG + Intronic
1168682535 19:58326637-58326659 GGGTGAGGGCGGCTGTGTGAGGG - Intergenic
1168682555 19:58326732-58326754 GGGTGAGGGCGGCTGTGTGAGGG - Intergenic
925128989 2:1481293-1481315 GTGTGAGGGAGGCAGAGAGGAGG + Intronic
925282898 2:2697064-2697086 GTGTGATGGTGGCTGGGTGCAGG + Intergenic
925307505 2:2860693-2860715 GTGTGAGAGTGGTTGTGAGATGG + Intergenic
925335445 2:3095697-3095719 GGGTCAGGGAGGCTGGGGGAAGG - Intergenic
925354895 2:3233564-3233586 CTGTGAGGTTGGCTTGGGGAAGG - Intronic
925427526 2:3762918-3762940 GTGTGAGGCTGCCTGGGAAGGGG + Intronic
925999281 2:9317202-9317224 GTGTGAGTGTGGATGTGAGTGGG - Intronic
926111608 2:10187567-10187589 GTGTGGGGGTCACTGAGAGAAGG + Intronic
926362138 2:12099765-12099787 GTGGGAGGGCTGCTTGGAGACGG - Intergenic
926368943 2:12161377-12161399 GTTTGAGAGCAGCTGGGAGATGG - Intergenic
926642700 2:15254265-15254287 GGGTGTGGGTGGCTAGGAAATGG - Intronic
927059526 2:19403138-19403160 GAGTGAGGGAGGCTAGGAGGTGG - Intergenic
927247858 2:20972220-20972242 GGGGGAAGGTGGATGGGAGAAGG + Intergenic
927385173 2:22524240-22524262 GTGAGAGGATGGATGGGGGAGGG + Intergenic
927865253 2:26583764-26583786 GTGTGCTGGGGGCTGGGAGTTGG - Intronic
928106106 2:28471566-28471588 CTGTGAGGGTGACAGGAAGAGGG + Intronic
928347751 2:30516866-30516888 GTGTGAGGCTTTCTGGGAAAAGG + Intronic
928349331 2:30534263-30534285 GTGTGTGTGTGTTTGGGAGACGG + Intronic
928476115 2:31629535-31629557 GTGTGAGGCTATCTGGGAAAGGG + Intergenic
928612992 2:33009156-33009178 GGGATAAGGTGGCTGGGAGAAGG + Intronic
928618850 2:33069110-33069132 GTGTTAAGTTGTCTGGGAGAGGG + Intronic
928676727 2:33658080-33658102 GCGTGAGGCTGTCTGGGAAAGGG + Intergenic
928688383 2:33773684-33773706 GTGTGTGGGTGGCGGGGGGTGGG + Intergenic
928736786 2:34300589-34300611 GGGGGTGGGGGGCTGGGAGAGGG + Intergenic
929281611 2:40086793-40086815 GGGTGGGGGTGGCGGGGAGTTGG + Intergenic
929309580 2:40407069-40407091 GTGTGTGGGTGTGTGTGAGAGGG + Intronic
929784843 2:44981942-44981964 GGATGAGAGTGGCTTGGAGAAGG - Intergenic
930001316 2:46863549-46863571 GCCCGAGGCTGGCTGGGAGAAGG + Intergenic
930471097 2:51814840-51814862 TTGTGTGGGTGGGTGGGAGAGGG + Intergenic
930631233 2:53757254-53757276 GTGTGAGGCTATCTGGGAAAGGG + Intronic
930871121 2:56172020-56172042 GTGTGAGGGAGGCAGGTACAGGG + Intergenic
931385831 2:61796438-61796460 GTGTGGGGGGCGCTGGGAGAGGG + Intergenic
931592155 2:63896345-63896367 GTATGGGGGTGGGAGGGAGAAGG + Intronic
931691656 2:64838982-64839004 GAGTGTGGGTGGGTGGGAGGGGG - Intergenic
931854273 2:66285554-66285576 GTGAGAGGATGGGAGGGAGAAGG - Intergenic
932080656 2:68711660-68711682 GGGGGTGGGTGGCTGGGGGAGGG - Intronic
932411247 2:71549297-71549319 GGGTGGGCATGGCTGGGAGAAGG - Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932481514 2:72042221-72042243 GTGTGAGGTGGGCAGGGGGATGG + Intergenic
932575279 2:72959311-72959333 GGGTGAGGGGGGCTGAGAGATGG - Intronic
932660521 2:73647910-73647932 GTGGCAGCGAGGCTGGGAGAGGG - Intergenic
932740815 2:74290032-74290054 GGGTCGGGGTGGCTGGGTGAGGG - Intronic
932830965 2:74989431-74989453 GGGGGTGGGGGGCTGGGAGAGGG + Intergenic
933175636 2:79169654-79169676 GTGTGAGGCTGTCTGGGGAAGGG - Intergenic
933363371 2:81316069-81316091 GTGTGAGGACAGCTTGGAGATGG - Intergenic
933778676 2:85787050-85787072 GGGTGAGGGCGGAGGGGAGAGGG - Exonic
934048361 2:88190293-88190315 CTGTGAGGATGGTTGGGAGCAGG + Intergenic
934492474 2:94771057-94771079 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
934492609 2:94771930-94771952 GTGGGAGGGTGGGTGGTAGTAGG - Intergenic
934540990 2:95174977-95174999 GATTTATGGTGGCTGGGAGATGG - Intronic
934612778 2:95753253-95753275 GTGGGTGGGTGGCTGGGAACTGG + Intergenic
934648132 2:96071170-96071192 GTGGGTGGGTGGCTGGGAACTGG - Intergenic
934672334 2:96222640-96222662 GTGTGAGGCTGTCTGGGAAAGGG - Intergenic
934715662 2:96541921-96541943 GGCTGAGTGGGGCTGGGAGACGG + Intronic
934752483 2:96802374-96802396 GTGTGTGGGTGGCCTGGAGCAGG - Intronic
934841511 2:97627000-97627022 GTGGGTGGGTGGCTGGGACCTGG - Intergenic
935562611 2:104574734-104574756 GTGTGAGGATGGCAGTGAGGAGG - Intergenic
935788698 2:106571385-106571407 ATGAGAGTGAGGCTGGGAGAAGG + Intergenic
936112462 2:109676238-109676260 GTGTGAGTGAGCCTGGGAGCCGG + Intergenic
936233023 2:110720583-110720605 GGGTGGGGGTGGGTGGCAGATGG - Intergenic
936387642 2:112044312-112044334 GTGTGAGGCTGTCTGGGAAAGGG - Intergenic
936519006 2:113200187-113200209 GAGTGTGGGTGGATGGGTGAGGG - Intronic
936565557 2:113579776-113579798 GTGGGTGGGGGGCTGGGGGAGGG + Intergenic
936593655 2:113827249-113827271 GTGGGTGGGGGGCTGGGGGAGGG + Intergenic
936677094 2:114728189-114728211 GTGGGAGGCAGGCAGGGAGAAGG + Intronic
936711529 2:115137075-115137097 GTGTGAGGGTGTGTGTGGGAGGG + Intronic
936911731 2:117600749-117600771 GTGGGTGGGGGGCTGGGGGAGGG + Intergenic
937005661 2:118510522-118510544 GTGTGTGGGAAGCTGTGAGAAGG + Intergenic
937028820 2:118721257-118721279 TGGTGAGTGTGGCTGGGATATGG + Intergenic
937080617 2:119137147-119137169 GTGTGAGGGTGTCTACGAGAAGG + Intergenic
937290167 2:120777324-120777346 GTGTGAGTGAGTGTGGGAGACGG + Intronic
937664970 2:124476440-124476462 GTTTGTGGGTGGGTGGGAGAGGG + Intronic
937977387 2:127589888-127589910 GTGTGTGAGTGGATGGGTGAAGG + Intronic
938048630 2:128146760-128146782 ATGGCAGGGTGGCTGGGAGTAGG - Intronic
938102045 2:128504078-128504100 CTCTGAGGGTGGTTGGGAGATGG + Intergenic
938373736 2:130790527-130790549 GGGTCAGGGTGACAGGGAGAGGG + Intergenic
938954181 2:136283090-136283112 GGGGGAGGGTGGCTGGGAGGTGG - Intergenic
939494016 2:142906946-142906968 GTGTGAGGCTTCCTGGGAAAAGG - Intronic
939502151 2:143001257-143001279 GTGTGAGGATGGCTGGGGTAGGG - Intronic
939564302 2:143768528-143768550 GAGTGAGTGTGGTTGGGAGTAGG + Intergenic
939649097 2:144740160-144740182 GTGGGAGGGTTGTGGGGAGAAGG - Intergenic
939758175 2:146138889-146138911 GAGGGAGGGAGGCAGGGAGACGG + Intergenic
939824557 2:146999042-146999064 GTGTGAGGCTGCCTGGGGAAAGG + Intergenic
940414441 2:153403515-153403537 GTGGCAGGGAGGCTGGGGGAGGG - Intergenic
940866493 2:158822738-158822760 GTGTGGGTGGGGGTGGGAGAGGG + Intronic
940915874 2:159255135-159255157 GTGTGGGGGTGGCAGGGTGGGGG - Intronic
941170031 2:162125258-162125280 GAGGGAGGGGGGCTGGGAGAAGG - Intergenic
941182982 2:162283812-162283834 GTGTCTGGGGGGCTGGAAGAAGG + Intronic
941567909 2:167131462-167131484 GTGAGAGAGTGACTGGGAGATGG - Intronic
942224872 2:173806238-173806260 GTCTGTGGGTGTCTGGGAGGTGG - Intergenic
942453337 2:176122058-176122080 GTGTGAGTGTGGCAGGGGGAGGG + Intergenic
942466946 2:176218293-176218315 GGGCGTGGGGGGCTGGGAGAGGG - Intergenic
942742525 2:179196361-179196383 GTGGCAGTGAGGCTGGGAGAGGG + Intronic
942759967 2:179386176-179386198 GTGGCAGCGAGGCTGGGAGAGGG + Intergenic
942901800 2:181129074-181129096 GGGGGTGGGGGGCTGGGAGAGGG + Intergenic
943714297 2:191133458-191133480 GTGTGTGGGTGGGTGGGGGCAGG + Intronic
944020717 2:195100480-195100502 CTGCAAGGGTGGCTGGGAAAGGG - Intergenic
944334052 2:198508626-198508648 GGGGGTGGGGGGCTGGGAGAGGG - Intronic
944883201 2:204036362-204036384 GAGTCTGGGGGGCTGGGAGAGGG + Intergenic
945404254 2:209425062-209425084 GTGTGTGGGGGGCTAGGAGTGGG + Intronic
945842052 2:214898964-214898986 GTGTGTGGGTGGGTAGGGGAGGG - Intergenic
946195864 2:218032888-218032910 GTGTGACAGTGGCAGGGAGAGGG - Intergenic
946384647 2:219375104-219375126 GTGGGAAGGGGCCTGGGAGATGG + Intronic
946894778 2:224312331-224312353 GTGTGAGCCTGCCTTGGAGAAGG + Intergenic
946948086 2:224843068-224843090 GGGTGGGGGTGGCGGGGAAAGGG + Intronic
947001693 2:225464398-225464420 GTGAGAGGGTCTGTGGGAGAAGG + Intronic
947160653 2:227210734-227210756 GTGGTGGGGTGGCTGTGAGAAGG - Intronic
947385447 2:229586425-229586447 GTGTGTGGGTGGGTGGGTGGGGG - Intronic
947516209 2:230807213-230807235 GGGTGAGTGTGGGTGGGAGGGGG - Intronic
947532825 2:230923606-230923628 GTTGGAGTGGGGCTGGGAGAGGG + Intronic
947595727 2:231410482-231410504 TTGTGAGGGTGACTGAGAGAAGG - Intergenic
947742159 2:232489608-232489630 GGGAGAGGGTGGCTGGAAGGGGG - Intergenic
947749787 2:232526141-232526163 GAATGAGGGTGGGCGGGAGAGGG - Intronic
948211131 2:236193923-236193945 GTGTGTGGGTGGGTGGGTGTGGG + Intergenic
948261570 2:236607842-236607864 GTGTGAAGGTGTCTTAGAGATGG - Intergenic
948505138 2:238423231-238423253 CTGTGAGGGGGGCTGAAAGAGGG + Intergenic
948553665 2:238792781-238792803 GGGTGCTGGGGGCTGGGAGAGGG - Intergenic
948928786 2:241117068-241117090 GTGTGAGGGAGGCGGGGGGCTGG + Intronic
949035538 2:241814274-241814296 GTGCGAGGGAGGGTGGGGGAGGG + Intronic
1168907683 20:1419176-1419198 CTGGGAAGGTGTCTGGGAGAAGG + Intergenic
1169218472 20:3806866-3806888 GTGTGTGGGGGGCTGGGGGGAGG - Intergenic
1170506749 20:17034567-17034589 GTATGAGGTTGGCAGAGAGAGGG - Intergenic
1171343304 20:24447024-24447046 ATGTGAGGGCTGCTGGGACAAGG - Intergenic
1171501088 20:25593843-25593865 CTGTGAAGGAGGCTGGGTGAAGG - Intergenic
1171516856 20:25745301-25745323 GGGTGAAGGTAGCTGGGACAGGG - Intergenic
1171536716 20:25898951-25898973 GTCTGAGGGTGGCTGGGCACTGG + Intergenic
1171776320 20:29371781-29371803 GTGGCAGGGAGGCTGGGAGAAGG - Intergenic
1171795256 20:29561389-29561411 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1171853200 20:30322876-30322898 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1172094163 20:32452582-32452604 GGGGGAAGGTGGCTGGGGGAGGG - Intronic
1172638784 20:36428440-36428462 GTGTGAGCTTGGCTGGCAGGTGG + Intronic
1172945058 20:38680912-38680934 GAGGGAGGGTGGAAGGGAGAAGG - Intergenic
1173082092 20:39877897-39877919 CTTTGAGAGTTGCTGGGAGATGG + Intergenic
1173199870 20:40946407-40946429 GTGTGAGGGGGGCTGGCAGCCGG - Intergenic
1173701001 20:45071534-45071556 GTCTGAAGGTGGCTGAGATAAGG + Intronic
1174077223 20:47946253-47946275 CTGTGGGGGTGGCAGGGAGCAGG + Intergenic
1174355567 20:49995694-49995716 GAGTGAGGGGGGCGGGGAAAGGG - Intergenic
1174742073 20:53024637-53024659 GTGGGTGGGGGGCTAGGAGAGGG - Intronic
1174931367 20:54818861-54818883 GTGTCAGTGTGACTGGGACATGG + Intergenic
1175173104 20:57093342-57093364 GTGGGAGGGTGGGTGGGGGAGGG + Intergenic
1175400032 20:58694646-58694668 GTGGGAGGGAGGTCGGGAGAGGG + Intronic
1175429730 20:58892328-58892350 GTGTGAGATTTGTTGGGAGAGGG + Intronic
1175708804 20:61202739-61202761 GTGTGAGGCTGTGTGGGAGAAGG - Intergenic
1175932207 20:62498339-62498361 GTGTGGGGGTGGGTGGGTGTTGG + Intergenic
1175965520 20:62658303-62658325 GAGTGAGCGTGGCTGGGCGGAGG + Intronic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176423770 21:6535324-6535346 GTGTCAGGGTGACTGGGTGGAGG + Intergenic
1176587871 21:8607153-8607175 GTGTGAAGATGCCTGGAAGAGGG + Intergenic
1176723789 21:10413795-10413817 GTAGGAGGGTGGCTGGCAGCTGG + Intergenic
1176795439 21:13368348-13368370 GGGTGAGGGTGTGTGGGTGAGGG + Intergenic
1176795443 21:13368362-13368384 GGGTGAGGGTGTGTGGGTGAGGG + Intergenic
1176795449 21:13368390-13368412 GTGTGAGGGTGTGTGGGTGAGGG + Intergenic
1176796291 21:13373008-13373030 GTAGGAGGGTGGCTGGCAGCTGG - Intergenic
1177067335 21:16456307-16456329 GGTTGAGGGTGGGAGGGAGAAGG - Intergenic
1178180678 21:30157505-30157527 GATGGAGGGTGGCTTGGAGAAGG + Intergenic
1178472512 21:32905960-32905982 GTGTCAGCTTGGCTGGGACATGG + Intergenic
1178763341 21:35425205-35425227 GTCTGAGGGTGGGTGAGAGGTGG - Intronic
1178823171 21:35993328-35993350 GTGTGAGGGTGTGTGTGAGTTGG - Intronic
1178913213 21:36692996-36693018 GTGGGAGGGAGGATGGGAGATGG + Intergenic
1179055929 21:37934093-37934115 CTATGAGGGAGGCTGGGAGGAGG - Intergenic
1179107710 21:38418291-38418313 GTGTGTGTGTGTCTGGGAAAGGG + Intronic
1179699263 21:43143639-43143661 GTGTCAGGGTGACTGGGTGGAGG + Intergenic
1179879160 21:44286312-44286334 GTGTGGGGACGGCTGGGGGAAGG - Intronic
1179892796 21:44345383-44345405 GGATGAGGGGGGCAGGGAGAGGG + Intergenic
1179986963 21:44927508-44927530 GTTGGAGGGTGGGCGGGAGAGGG - Intronic
1180066820 21:45416440-45416462 GTGTGGGGGTGGCCGGGGCAGGG + Intronic
1180082027 21:45491375-45491397 GTGTGGGGGGGGCTCGGGGAGGG - Intronic
1180091602 21:45536393-45536415 GTCAGTGGGTGGCAGGGAGAGGG + Intronic
1180270703 22:10584152-10584174 GTGTGAAGATGCCTGGAAGAGGG + Intergenic
1180304934 22:11066536-11066558 GTAGGAGGGTGGCTGGCAGCTGG + Intergenic
1180517624 22:16162265-16162287 GTGAGAGGGTGGGAGGGGGAAGG + Intergenic
1180722329 22:17918734-17918756 GTGAGAGGGTGTCTGGTAGGTGG - Intronic
1181033291 22:20158281-20158303 GTGGGAGTGGGGCTGGGAGCAGG + Intergenic
1181439213 22:22927218-22927240 GGGTGGGGGTGGGTGGGTGAGGG - Intergenic
1181510012 22:23384951-23384973 GTGGGAGTGGGGCTGGGAGTAGG - Intergenic
1181521754 22:23452354-23452376 GTGTGGTGGTGGCTGGGAGGTGG + Intergenic
1181743973 22:24942929-24942951 GTGTGTGTGTTGCTGGGGGAGGG + Intronic
1181756774 22:25029562-25029584 GTGGGTGGGCGGCTGAGAGAGGG - Intronic
1182013888 22:27022989-27023011 GTGCTCGGGGGGCTGGGAGAAGG + Intergenic
1182124181 22:27804392-27804414 GTGTGTGAGTGGCTGAAAGAAGG + Intergenic
1182281451 22:29219991-29220013 GAGTGGGGGTGGCTGGGCGGTGG - Intronic
1182310040 22:29397928-29397950 GTGACAGGGTGGCTGGGAAGTGG + Intronic
1182366409 22:29782330-29782352 TTGGCAGGGTGGCTGGGATAAGG - Intergenic
1182747644 22:32617775-32617797 GTGTGAGGGAGGCAGGGTTAGGG + Intronic
1183032768 22:35117896-35117918 GTGCTAGTGTGTCTGGGAGATGG + Intergenic
1183263048 22:36808392-36808414 GTGTGAGGCAGGATGGCAGAGGG + Intronic
1183281720 22:36935927-36935949 GTGTGGGGATGCCTGGGACAGGG + Intronic
1183513235 22:38248137-38248159 GGGAGAGGCTGGCTGGGACAGGG - Intronic
1183642689 22:39101701-39101723 GTGGGGGGGTGGCGGGGAGCGGG + Intronic
1183686141 22:39362408-39362430 GTGTGAGGCGGGGTGGGGGAGGG + Intronic
1183731041 22:39618765-39618787 ATTTGAGGGCGACTGGGAGATGG - Intronic
1183747404 22:39699543-39699565 GTGTCAGGCTGGCTGGGCTACGG - Intergenic
1184150744 22:42636957-42636979 GGATGAGGGTGGTGGGGAGAGGG - Intronic
1184236849 22:43187317-43187339 GTGGGCGGGGGGCTGGGAGGAGG - Intergenic
1184270327 22:43377528-43377550 GTGTGAAGGTAGGTGGGAGAAGG + Intergenic
1184373962 22:44099997-44100019 TTGTGGGGGTGGCAGGGACACGG - Intronic
1184393172 22:44217422-44217444 GTGTGGGGTGTGCTGGGAGATGG + Intronic
1184538149 22:45101525-45101547 GGGTGAGGGGGGAGGGGAGAAGG - Intergenic
1184694899 22:46133724-46133746 AGGTGCAGGTGGCTGGGAGACGG - Intergenic
1184717617 22:46290883-46290905 GTCTGAGGGTGGCAGGGACATGG - Intronic
1184885889 22:47344200-47344222 GTGTGTGTGAGGCTGGGAGAGGG + Intergenic
1185332963 22:50259947-50259969 GTGAGTGGGTGGGTGGGAGCAGG + Intronic
1185358839 22:50392790-50392812 GTGGGAGTGTGGCTGGACGATGG + Intronic
1185377080 22:50487581-50487603 CTGTGGGGCTGCCTGGGAGAGGG + Intronic
1185417199 22:50716700-50716722 GTGTGATGGTGGCTGGGGAGTGG - Intergenic
949139485 3:614592-614614 GTGTGAAGATGCCTGGAAGACGG - Intergenic
950056089 3:10026007-10026029 GTGTGAGGTAGGCTGGGGAAGGG + Intergenic
950195956 3:11009430-11009452 GTATGCGGCTGGCTGGGAGTTGG + Intronic
950202191 3:11052788-11052810 GGTCGTGGGTGGCTGGGAGAAGG - Intergenic
950554323 3:13686063-13686085 GTGGCAGGGTGGCTGGCAGAGGG + Intergenic
951962792 3:28348422-28348444 GTGTGGGGGTGACTGGGGAAAGG + Intronic
951966455 3:28391342-28391364 GTGTGTGTGTGGCAGGGAGAGGG - Intronic
952064281 3:29549087-29549109 ATGTGAGGGTGGAATGGAGAGGG - Intronic
952632205 3:35482829-35482851 GTGGGAGCGAGGCTGGGGGAGGG - Intergenic
952827671 3:37537664-37537686 GTGGGAGGGGGGCAGGCAGACGG + Intronic
953040639 3:39252385-39252407 GTGTGAGGGTTGTTTGGGGAAGG + Intergenic
953060934 3:39428409-39428431 GGGTCAGGTTGGCTGGGAGCTGG + Intergenic
953112235 3:39953943-39953965 GTGGCAGGGAGGCTGGGAGAGGG + Intronic
953418569 3:42737054-42737076 GTGGGTGGGGGGCTGGGGGAGGG - Intronic
953820340 3:46202770-46202792 GTGGGAGGGTGGCGGGGGGGGGG + Exonic
954334567 3:49908823-49908845 GAGTGAGGGTGGATGGGCGAAGG + Intronic
954538893 3:51381061-51381083 TTGTGGGGGAGGCTGGGATAGGG - Exonic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954701511 3:52453158-52453180 GAGTGAGGGAGGCTGAGGGAGGG + Intronic
955028526 3:55193554-55193576 GTGGGAGGATGCCAGGGAGATGG - Intergenic
955059951 3:55485652-55485674 GTGCGAAGGTGGCTGGGGGGAGG + Intronic
955434990 3:58890860-58890882 ATGTGATGGTGGCTGGGAAGAGG + Intronic
955877932 3:63513150-63513172 GTGTGGGGGTGGGGGGGAGGGGG - Intronic
956170768 3:66431768-66431790 ATGGAAGGGTGGCTGTGAGAAGG - Intronic
956328764 3:68081900-68081922 GTGGCAGCGAGGCTGGGAGAGGG - Intronic
956683430 3:71802964-71802986 GTGTCAAGCTGACTGGGAGAAGG + Intergenic
956911880 3:73826630-73826652 GTATGAGCGAGGCGGGGAGACGG - Intergenic
956994417 3:74807869-74807891 GTATGTGTGTGGCAGGGAGAAGG + Intergenic
957606985 3:82413092-82413114 TTGTGAGTGTGGGTGAGAGAGGG - Intergenic
958905561 3:99938224-99938246 ATGTGAGGGTGTCTGTGAGAGGG - Intronic
959004345 3:101003315-101003337 GTGGGTGGGGGGCTGGGGGAAGG - Intergenic
960404950 3:117248369-117248391 GTGTGATGGGGTGTGGGAGAGGG + Intergenic
960577134 3:119240770-119240792 GTGCGAGGGTAGCCGGGCGACGG - Intronic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
960694564 3:120383442-120383464 GTGTGTGGGAGGCAGAGAGAAGG + Intergenic
960809701 3:121615990-121616012 GTGTGAGGGTGTCTGGCTGTGGG - Intronic
960812261 3:121636345-121636367 GCGTGAAGAAGGCTGGGAGAGGG - Intronic
960942843 3:122945877-122945899 GGGTGAGGGCTACTGGGAGAGGG - Intronic
961004540 3:123396054-123396076 GAGGGAGGGTGGGAGGGAGAGGG + Intronic
961106944 3:124250309-124250331 GTGTGGGGGTTCCTGTGAGAGGG + Intronic
961120823 3:124368497-124368519 ATGTGATGGTGGCTGGGAAGAGG + Intronic
961311355 3:126004006-126004028 TTGGGAGGGAGGCTGGGAGGTGG + Intergenic
961332930 3:126153650-126153672 GTCTGAGCAGGGCTGGGAGAGGG + Intronic
961379037 3:126485426-126485448 GCGTGTGGGTGGGTGGGGGAGGG + Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961647778 3:128401536-128401558 GTGTGAGCATGGCAGGCAGAGGG + Intronic
961654530 3:128433791-128433813 GGGTCAGGATGGGTGGGAGAGGG - Intergenic
961951822 3:130757506-130757528 GTGTGTGTGTGTCGGGGAGAGGG - Intergenic
962198284 3:133381172-133381194 GGGAGAGGATGGGTGGGAGAGGG - Intronic
962229555 3:133650359-133650381 GTGTGTGGGGGGCGGGGGGAGGG + Intronic
962462489 3:135627240-135627262 GTGGGAGGTTGGCTGGGGGGCGG + Intergenic
962514053 3:136132014-136132036 GGGTGGGGGGGGCTGGGGGAGGG + Intronic
962642873 3:137406672-137406694 ATGGGAGGGTGTCAGGGAGAGGG + Intergenic
962758104 3:138483725-138483747 GGGTGAGGGTGGAGGGGAGGTGG - Intergenic
963270920 3:143285224-143285246 GGGTGTGGGGGGCTAGGAGAGGG - Intronic
963648059 3:147942666-147942688 GTTTGAGGGAGGATGGGAGAGGG + Intergenic
963837546 3:150072216-150072238 CTGTGGAGGTGTCTGGGAGATGG - Intergenic
963978487 3:151509909-151509931 GTGGCAGGGAGGCTGGGGGAGGG + Intergenic
964282187 3:155079511-155079533 ATGTGAGGGGGCCGGGGAGACGG - Intronic
964407682 3:156366570-156366592 GTATCATGGTGGCTGGGAGCTGG - Intronic
964576654 3:158177643-158177665 GAGTGTGGGGGGCTGGGAGAGGG + Intronic
964828755 3:160859715-160859737 GGGTGAGGGTGGCTCAGAAAGGG - Intronic
964917279 3:161853126-161853148 GTGTCAGGCTGTCTGGGAAAGGG - Intergenic
965528836 3:169750145-169750167 GTATGAGGATGGCAGGCAGAGGG - Intergenic
965739531 3:171859150-171859172 GTGGGTGGGAGGCTGGGGGAGGG + Exonic
966677971 3:182609794-182609816 GTGTACGGGTGGCTGAGAGTGGG - Intergenic
966742808 3:183249904-183249926 TTGTGAGGGTGGCAAGGAGACGG + Intronic
967222292 3:187257476-187257498 GTGGGAGGATCACTGGGAGAAGG - Intronic
967843437 3:194025820-194025842 GAGTGAGGGTGGCAGGAGGAAGG - Intergenic
967895588 3:194393971-194393993 GGGGGTGGGGGGCTGGGAGAGGG - Intergenic
968383326 4:113076-113098 CTGTCAGGGTGGCTGTGAGTTGG - Intergenic
968449061 4:666646-666668 GGGGCAGGGTGGCTGGGAGCAGG + Intronic
968570281 4:1336736-1336758 GTGTGTGGGTCACTGGGGGATGG + Intronic
968620883 4:1602991-1603013 GTGTCCGGACGGCTGGGAGATGG - Intergenic
968698432 4:2043559-2043581 GCATGAGGGTGGCAGGGAGTGGG + Intronic
969354881 4:6619516-6619538 GTGTAAGGGAGGCTGGGACAAGG + Intronic
969355230 4:6621124-6621146 GTGAGAGGGAGGCTGGGAGGAGG + Intronic
969644756 4:8421286-8421308 GTGTGAGGCTTTCTGGGAAAAGG + Intronic
969703564 4:8780523-8780545 GGGCAGGGGTGGCTGGGAGAAGG - Intergenic
970156940 4:13151332-13151354 GGGTGTGGGAGCCTGGGAGAGGG + Intergenic
970355290 4:15245213-15245235 CTGTGAGGGTGGCCTGGAGTGGG - Intergenic
970428366 4:15965618-15965640 CTGTGAAGGTGGCAGGGAGAAGG - Intronic
971172555 4:24248571-24248593 GTGTCATGGTCGCTGGGGGAGGG - Intergenic
972323952 4:37997824-37997846 GACTGAGGGTGGATGGGCGAGGG + Intronic
972367251 4:38387722-38387744 GTGGAAGGGTGGCTGGAGGACGG + Intergenic
972781689 4:42291959-42291981 GTGTGAGGCTGTCTGGGAAAGGG - Intergenic
973162012 4:47031132-47031154 GGGTGGGGGTGACTGGGAGCAGG - Intronic
974370590 4:61012073-61012095 GTGGCAGGGAGGCTGGGCGAAGG + Intergenic
974375033 4:61064926-61064948 GTGGGAGGGTGCCTGGGTGGTGG - Intergenic
975087177 4:70355915-70355937 GGGGGTGGGTGGCTGGGGGAGGG + Intergenic
975180491 4:71338914-71338936 GAGGGAGGGTGGGTGGGAGGCGG + Intronic
975298349 4:72760345-72760367 GTGTGAGAGAGGTTGAGAGAAGG - Intergenic
975314103 4:72932248-72932270 GTGTGAGGCTGTCTGGGGAAAGG - Intergenic
975596141 4:76049549-76049571 GTGTCAGGCTGTCTGGGAAAGGG - Intronic
975751095 4:77524446-77524468 GTGGCAGCCTGGCTGGGAGAGGG - Intronic
976049410 4:80994103-80994125 GGGTGCTGGTGGGTGGGAGAAGG - Intergenic
976158733 4:82175821-82175843 GTGGCAGCGAGGCTGGGAGAGGG + Intergenic
976189378 4:82474189-82474211 GTGTGAGGCTGTCTGGGAAAGGG + Intergenic
976782553 4:88777199-88777221 GTGTCAGGTAGGCTGGGAGATGG + Intronic
977114161 4:93000808-93000830 TGGGGAGGGTGGGTGGGAGAAGG + Intronic
977435766 4:96992392-96992414 GTGTGTGGGTGGGTGGGGGAAGG - Intergenic
977618343 4:99109264-99109286 GTGTGAGGCTTCCTGGGAAAAGG - Intergenic
978007196 4:103631177-103631199 GGGTGTGGGTGGCTGGAGGAGGG + Intronic
978256019 4:106693784-106693806 TTGTGAGGGTGGCCTGGAGAGGG + Intergenic
978291054 4:107141181-107141203 GTCTGAGGCTGGATTGGAGAAGG - Intronic
978329507 4:107597394-107597416 GGGGGTGGGGGGCTGGGAGAGGG + Intronic
978521939 4:109625240-109625262 GCCTGAGAGTAGCTGGGAGAAGG - Intronic
978561940 4:110042702-110042724 GTGGGTGGGAGGGTGGGAGATGG + Intergenic
979589820 4:122465550-122465572 GTGGCAGCGAGGCTGGGAGAGGG - Intergenic
980260033 4:130436964-130436986 GGGGGAGGGGGGCTGGGGGAGGG - Intergenic
980369606 4:131850227-131850249 GTTTGGTAGTGGCTGGGAGATGG - Intergenic
981071435 4:140544639-140544661 GTGAGAGGGGGGCTGGTATATGG - Intronic
981165220 4:141549719-141549741 GTGTCAGCGAGGCTGGGGGAGGG + Intergenic
981166623 4:141566467-141566489 GGGTGAGGGTGGCTAGGCAATGG - Intergenic
981550633 4:145937851-145937873 GTTTGGGGGTGTCGGGGAGAGGG - Intronic
981847085 4:149181829-149181851 GGGTGTGGGGGGCTGGGGGAGGG + Intergenic
982052071 4:151511714-151511736 GTGTCAGTGAGGCTGGGGGAGGG + Intronic
982326071 4:154129200-154129222 GTCTGAGGGCAGGTGGGAGAGGG + Intergenic
982725598 4:158902828-158902850 GTTTGAGGTTGGTTGGGGGAGGG - Intronic
982798236 4:159670875-159670897 GTGTGTGGGTGGGTGGGTGTGGG + Intergenic
982927258 4:161353830-161353852 ATGTGATGGTAACTGGGAGAAGG + Intergenic
982961991 4:161850890-161850912 CTGTCAGGGTAGGTGGGAGAAGG + Intronic
983667345 4:170196410-170196432 GTGTGAGGCTCTCTGGGAAAGGG - Intergenic
983753890 4:171310128-171310150 GGGGGTGGGTGGCTGGGGGAGGG - Intergenic
984501688 4:180566017-180566039 GGGTGAGGGTGAGTGGGTGAGGG + Intergenic
984501768 4:180566462-180566484 GTGTGAGGGTGAGTGGGTGTAGG + Intergenic
984501827 4:180566784-180566806 GTGTGTGGGTGTGTGGGTGACGG + Intergenic
984678340 4:182576989-182577011 GTGTGGGTGGGGCTGGGACAGGG - Intronic
985200152 4:187476274-187476296 GTGTGGTGGTGGCAGGGAGATGG - Intergenic
985272420 4:188206817-188206839 GAGTGAGTGTGGATGGGTGAGGG + Intergenic
985472559 5:54610-54632 GTGCGGGGGTCGCTGGGAGGTGG + Intergenic
985563906 5:605665-605687 GTGAGAGGGGGGCTGTGAGAGGG + Intergenic
985655208 5:1128137-1128159 GAGTGGGCGTGGCTGGGAGGTGG + Intergenic
985655652 5:1130260-1130282 GGGCGAGGCTGGCTGGGAGGAGG + Intergenic
985780276 5:1867274-1867296 GGGAGAGGGTGTGTGGGAGAGGG + Intergenic
986300859 5:6477236-6477258 GTGGCAGGGTGACTGGGAGGAGG - Intronic
986898795 5:12406008-12406030 GTGTGAGGGTAGGGGGAAGATGG - Intergenic
987137394 5:14912729-14912751 GTGTGGGGGTGGCTCGTAGCCGG - Intergenic
987169308 5:15237782-15237804 GGGTGAGGATGAGTGGGAGAAGG - Intergenic
987472533 5:18350907-18350929 CTGTGAAAGTGTCTGGGAGAGGG + Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
987921124 5:24283294-24283316 GTGTGTGGGTGGGTGGGTGGGGG - Intergenic
988735478 5:34016215-34016237 GTGCGGGGGTGGTGGGGAGAGGG + Intronic
988740447 5:34064116-34064138 GTGTGAGGCTGTCTGGGGAAGGG - Intronic
988961931 5:36379237-36379259 TAGTGAAGGAGGCTGGGAGAGGG - Intergenic
988993482 5:36693166-36693188 GTGGGAGGGGGTCTGGCAGAAGG - Intergenic
989286081 5:39701628-39701650 ATATGAGGGTGGCTGGGGTAAGG + Intergenic
989778595 5:45237999-45238021 GTGTGATGGGGGGTGGGGGAGGG - Intergenic
989977296 5:50601840-50601862 GTGGCAGGGAGGCTGGGGGAGGG - Intergenic
991292343 5:65045013-65045035 GGGTGATGGTGGATGGAAGAGGG - Intergenic
991662585 5:68965460-68965482 GTGAGAGGGTGTGTGAGAGAAGG - Intergenic
991958525 5:72019319-72019341 GTGAGAGGGTGGCAGGGTGAGGG - Intergenic
992049067 5:72926955-72926977 GTGTCAGGCTTTCTGGGAGAGGG + Intergenic
992293587 5:75305114-75305136 GTGTGAGGCTGTCTGGGAGAGGG + Intergenic
992632966 5:78699723-78699745 GTGTGGGTGTGGCAGGGAGCAGG - Intronic
992907774 5:81363142-81363164 GTGTCAGGGTGCCTGGAGGAGGG - Intronic
993500403 5:88660470-88660492 GTGTGGTGGTGGCGGGGAGGGGG + Intergenic
994089891 5:95800610-95800632 GTGAGAGGGTGGGTGGGAGCTGG + Intronic
994197531 5:96936295-96936317 GGCTGAGGGAGGCAGGGAGAGGG + Intronic
994340084 5:98616974-98616996 GTGTGTGGGGGGGTGGGAGGTGG - Intergenic
994652556 5:102546872-102546894 GTGTGTTAGGGGCTGGGAGAGGG - Intergenic
994705781 5:103204996-103205018 GTGGGTGGGGGGCTGGGGGAGGG - Intronic
994744449 5:103661611-103661633 GAATGAGGGTGGGTGGGTGAGGG + Intergenic
994753265 5:103764513-103764535 ATGAGAGGGAGGCTGAGAGAGGG - Intergenic
994761682 5:103862211-103862233 TTATGAGGGTTGCTGGCAGAAGG - Intergenic
995342030 5:111070946-111070968 CTGTGAAGGTGGCTGGGCGCTGG + Intronic
995553677 5:113305248-113305270 AACTGAGGATGGCTGGGAGAGGG - Intronic
996379754 5:122850917-122850939 GTGTGAGGCTGGAAGAGAGAGGG + Intronic
996395063 5:123005331-123005353 CTGGGAGGGTGTCCGGGAGAAGG - Intronic
996473555 5:123888181-123888203 CTGTGTGAGTGTCTGGGAGAGGG + Intergenic
996737995 5:126775315-126775337 GGGGGAGGATGGCAGGGAGACGG - Intergenic
996830260 5:127732841-127732863 GGGTGAGGGTGGCAGGAGGAAGG + Intergenic
996909866 5:128643450-128643472 GTGTGCGTGGGGCTGGGGGAGGG + Intronic
997067985 5:130584462-130584484 GTTGGGGGGTGGCAGGGAGACGG + Intergenic
997427233 5:133811744-133811766 GTGTGAGGGTAGATGGGGAATGG - Intergenic
997523094 5:134535682-134535704 CTCTGTGGGTGGGTGGGAGAGGG + Intronic
997647047 5:135488794-135488816 GGGTGGGGTTGGCTGGGTGACGG + Intergenic
997869906 5:137498255-137498277 GTGTGTGTGTGGTTGGGAGGGGG - Intronic
997871141 5:137506081-137506103 CTGTGAGGGACGCAGGGAGATGG - Intronic
998004589 5:138648681-138648703 GAGTGAAGGAGACTGGGAGAGGG + Intronic
998150618 5:139755284-139755306 GTGTGAGTGTGGGTGTGAAATGG + Intergenic
998177878 5:139912989-139913011 GTGGGAGGGAGGCTGGCAGAGGG - Intronic
998181749 5:139950876-139950898 CTAGGATGGTGGCTGGGAGAGGG - Intronic
998334313 5:141357156-141357178 GTGTGACGGTGGCCGAGAGAGGG - Exonic
998341695 5:141423186-141423208 GCGTGACGGTGGCCGAGAGAGGG - Exonic
999467637 5:151822639-151822661 GGTTGGGGGAGGCTGGGAGAGGG - Exonic
1000214848 5:159145537-159145559 GGGGGTGGGTGGCTGGGGGAGGG + Intergenic
1000266230 5:159640884-159640906 GTGGGAGGGAGGCTGGCAGGGGG + Intergenic
1001040341 5:168330187-168330209 GAGTGAGGGTGGCAGGGGCACGG - Intronic
1001092400 5:168751049-168751071 GGGGGAGGGAGGCTGGGGGAGGG + Intronic
1001332662 5:170773193-170773215 GTGAGGGGGTGGCGAGGAGATGG + Intronic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001824399 5:174733744-174733766 GTGAGAGGGTGGCTGGGGGTGGG - Intergenic
1001959855 5:175873100-175873122 GGGTGGGGGTGGGTGGGAGTGGG - Intronic
1001979728 5:176030628-176030650 GTGTGAGGGTGGGGGTGTGAGGG + Intronic
1002056620 5:176601517-176601539 GGGTGAGGGCTGCTGGGTGATGG + Intronic
1002076521 5:176711880-176711902 GTGGGAGGCTGGCTGGAAGCAGG - Intergenic
1002140699 5:177135859-177135881 GTGAAAAGGGGGCTGGGAGAAGG - Exonic
1002176068 5:177402229-177402251 GTGAGAGAGTGGCTGGGGCATGG - Exonic
1002237689 5:177813135-177813157 GTGTGAGGGTGGGGGTGTGAGGG - Intergenic
1002282767 5:178142596-178142618 GAGAGAGGGTGGCTGAGAGAGGG - Exonic
1002662246 5:180799377-180799399 ATGTGTGGGTGGCTGGCAGGTGG - Intronic
1002672546 5:180880545-180880567 GGGTGGGGGGGGCTCGGAGAGGG - Intergenic
1003039115 6:2670694-2670716 GTGTCAGGGTGTATGGGAGGTGG + Intronic
1003268412 6:4586840-4586862 GTGTCAGTGTGGCTGGGTCATGG - Intergenic
1003592222 6:7445892-7445914 GCATGGGGGTGGGTGGGAGAAGG + Intergenic
1003915792 6:10785360-10785382 GTCGGAGGGTGGTGGGGAGAAGG - Intronic
1004241252 6:13924743-13924765 TTGTGAGGGAGACTGAGAGAGGG + Intronic
1005364963 6:25067555-25067577 GTGTGATGGGGGTTTGGAGAAGG + Intergenic
1005769923 6:29058723-29058745 GTGGGTGGGAGGCTAGGAGAGGG - Intergenic
1005823934 6:29621013-29621035 GGGAAAGGGTGGCAGGGAGAGGG - Intronic
1006187729 6:32190220-32190242 GAGGGAGGGAGGCTGGGGGAGGG + Intergenic
1006363381 6:33599940-33599962 GTGGGAGGGAGGCTGGGAAAAGG + Intergenic
1006435151 6:34022209-34022231 GGGGAAGGGTGGCAGGGAGAGGG + Exonic
1006460029 6:34152847-34152869 GTGGGAGGGTGGCTGGGGATGGG + Intronic
1006785409 6:36663253-36663275 GGGTGAGGGAGGGTGTGAGAAGG + Intergenic
1006936770 6:37724042-37724064 GTGTGAGGGTCGCAAGGAAAGGG - Intergenic
1006984178 6:38166615-38166637 CTGTGAGGGCGGCGGGGAGGTGG - Intergenic
1007067626 6:39007932-39007954 GTGTGTGGGTGGGTGGGGGGTGG - Intronic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007210174 6:40187386-40187408 GTGTGTGTGTGGCGGGGTGAGGG + Intergenic
1007376176 6:41458260-41458282 GTGTCAGCCTGGCTGGGAGTGGG + Intergenic
1007378031 6:41469562-41469584 GGGTGAGGGAGGCTGGAAGGGGG + Intergenic
1007418644 6:41706486-41706508 GTGTAAGGGTGGTTGGGGGTGGG - Intronic
1007740765 6:44008238-44008260 GTGGGCTGGGGGCTGGGAGAGGG + Intergenic
1008275416 6:49538343-49538365 GTGTAAGGGAGGGTGGGAGATGG + Intergenic
1008632971 6:53381685-53381707 GTGGGAGAGGGCCTGGGAGAGGG - Intergenic
1008836456 6:55837790-55837812 GTGGGAGGCTGGCAGGGAGATGG - Intronic
1009461476 6:63919261-63919283 GTGTGAGGGTGGCTCAGGGGCGG + Intronic
1009592972 6:65698046-65698068 GTGTCAGGGTGGGAGGGAGACGG + Intronic
1010043918 6:71419841-71419863 GTGCGCGGCTGGGTGGGAGATGG - Intergenic
1010236758 6:73581170-73581192 GTTTGAGGGTGGATTGGGGAGGG + Intergenic
1010332156 6:74635895-74635917 GTGAAAGTGTGGCTGGGAGCAGG - Intergenic
1010652116 6:78467624-78467646 GTGGGAGCGAGGCTGGGGGAGGG + Intergenic
1010692473 6:78926678-78926700 GTGGGAGGGTGTCGGGGAGGTGG - Intronic
1010727574 6:79352773-79352795 GGGTGCGGGGGGCTGGGGGAGGG + Intergenic
1011076479 6:83444421-83444443 GTGTGAGGCTGTCTGGGAAAGGG + Intergenic
1011099928 6:83709200-83709222 GTGTGTGAGTAGCTGGGAGGGGG - Exonic
1011377156 6:86701244-86701266 CTGTTGGGGAGGCTGGGAGAGGG - Intergenic
1011533529 6:88351234-88351256 GTGGCAGGGAGGCTGGGGGAGGG + Intergenic
1011537933 6:88396712-88396734 GTGGGTGGGGGACTGGGAGAGGG + Intergenic
1011698886 6:89937097-89937119 GTATGGGGGAGCCTGGGAGACGG + Intronic
1012598669 6:101069105-101069127 GGGTGTGGGGGGCTGGGGGAGGG + Intergenic
1012654131 6:101793922-101793944 GCGGCAGGGAGGCTGGGAGAGGG - Intronic
1012950982 6:105517605-105517627 CTGTGAGGGAGGCGGGGAAATGG + Intergenic
1013316367 6:108947065-108947087 GTGTTAGGGTTGATGGCAGAGGG + Intronic
1013543170 6:111131635-111131657 GTGTGAGGCTGTCTGGGGAAGGG + Intronic
1013888357 6:114998547-114998569 GTGTGAGGCTTTCTGGGAAACGG + Intergenic
1013977122 6:116091730-116091752 GTGTCAGGGTTTCTGGGAAAGGG + Intergenic
1014185234 6:118427225-118427247 GTGGCAGGGAGGCTGGGGGAGGG + Intergenic
1014571933 6:123020067-123020089 CTGTGAGGGTGTTTGGGATAGGG - Intronic
1015407376 6:132853239-132853261 GTGTGAGGGAGGCTCGGAAATGG + Intergenic
1016068354 6:139707591-139707613 GTGTGTGGGTTGCGGGGGGAGGG + Intergenic
1016329701 6:142944412-142944434 GTGTGTGGGTGTGTGGGGGAGGG - Intronic
1016467334 6:144338727-144338749 TGGTGAGGGTGGGCGGGAGATGG + Intronic
1017156330 6:151325603-151325625 GCGTGTGGGTGGCTGGGTGGGGG + Intronic
1017377702 6:153790086-153790108 GTGCAAGGGTGGTCGGGAGAGGG + Intergenic
1017412063 6:154178139-154178161 GTGGGTGGGGGGCTGGGGGAGGG + Intronic
1017442847 6:154479893-154479915 GTGTGAGGGAGTCTGGGGGCTGG - Intronic
1017935695 6:159002906-159002928 GTGAGAGGGTGGCTTGGATCTGG + Intergenic
1018628702 6:165804721-165804743 GTGGGAGGGTGTCCGGGTGAGGG + Intronic
1018651531 6:165995767-165995789 GTCTGGGGGTGGGAGGGAGATGG - Intergenic
1018729060 6:166635582-166635604 GTGTGAGGGTGTGTTGGAGTGGG + Intronic
1019028011 6:168988043-168988065 ATTTGAGGGTGGCTCTGAGATGG + Intergenic
1019130913 6:169873843-169873865 GTGTGGGGGTGGGAGGTAGATGG - Intergenic
1019255463 7:46942-46964 GTGGGACCGTGGCTGAGAGAAGG + Intergenic
1019490299 7:1310066-1310088 GCTTGAGGGAGGCTGGGGGAGGG + Intergenic
1019575611 7:1736259-1736281 GTGTGGGGGAGGCGGGGAGATGG - Intronic
1019589586 7:1824127-1824149 GTGTGCTGGTGGCCGGGAGGTGG - Intronic
1020869355 7:13607949-13607971 CTGTGAAGGAAGCTGGGAGAGGG + Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1020930455 7:14386783-14386805 TTCTGAGGGTGGGTGGCAGAAGG + Intronic
1021072388 7:16256763-16256785 GGGAGTGGGGGGCTGGGAGAGGG + Intronic
1021303114 7:18996835-18996857 ATGTGTGTGTGGCTGGGAGGTGG - Intronic
1021388919 7:20068219-20068241 GTGGCAGTGAGGCTGGGAGAGGG + Intergenic
1021802887 7:24325567-24325589 GTGGGTGGGTGGGTGGGGGATGG - Intergenic
1022283758 7:28935603-28935625 GTGTAAGGCTGGCTGGGGGTGGG + Intergenic
1022388974 7:29927351-29927373 GTGTGTGGGTGGGTGGGTGGGGG - Intronic
1022482257 7:30751964-30751986 GTGTCAGTGTGGCTGGGAGGTGG + Intronic
1023058485 7:36308348-36308370 GTGTGAGGATGACTGGGTGGAGG + Intergenic
1023108132 7:36783535-36783557 GGGAGAGGGTGTCTGTGAGATGG + Intergenic
1023244715 7:38189129-38189151 GTGTGTGTGTGTCTGGGAAAAGG + Intronic
1023439689 7:40172823-40172845 GTGTGAGGCTTCCTGGGAAAAGG - Intronic
1023761275 7:43467414-43467436 GAGTGTGGGTGGCTGGCAGGAGG + Intronic
1023772026 7:43566536-43566558 GTGTGGGGAGGACTGGGAGAAGG + Intergenic
1023861396 7:44219559-44219581 GCCTGGGGGTGGATGGGAGAGGG - Intronic
1024117305 7:46206327-46206349 GTGTGAGGGTGAATGTGACATGG - Intergenic
1024324957 7:48102222-48102244 GTGTGAGGGTGGCAGGTGCAGGG + Intronic
1024427490 7:49244175-49244197 GTGTGTTGGTGGCTGGGGAAGGG - Intergenic
1024537909 7:50453479-50453501 GTGTGAGGGATTCTGGGAGATGG + Intronic
1024655565 7:51448684-51448706 GTGTCAGGATGGGTGTGAGAAGG - Intergenic
1024684214 7:51727534-51727556 GGGTGAGAGTGAGTGGGAGAAGG + Intergenic
1024736950 7:52315515-52315537 GTGGGTGGGGGGCTAGGAGAGGG + Intergenic
1026079997 7:67209286-67209308 TGGAGGGGGTGGCTGGGAGAAGG + Intronic
1026157783 7:67842270-67842292 ATGTGAGGGTGGAAGGTAGAGGG + Intergenic
1026166858 7:67917902-67917924 GTGGGAGGGTGGGTGGGGGCTGG - Intergenic
1026665832 7:72338954-72338976 GGGTGAGGGGGGCTGGGTGGGGG - Intronic
1026867500 7:73832529-73832551 CTGGGAGGGTGGCAGGGAGGAGG + Exonic
1026962628 7:74418222-74418244 GGGAGAGGGTGGCTGGGAGGGGG - Intergenic
1027230583 7:76269441-76269463 GTGAGATGGGGGATGGGAGAGGG + Intronic
1027263779 7:76482913-76482935 GTGTGGGGGGTGCTGGGGGACGG - Exonic
1027729595 7:81853914-81853936 GTGTGTGGGTGGGTGGGTGGGGG - Intergenic
1028050069 7:86174347-86174369 GTGGCAGCGTGGCTGGGGGAGGG + Intergenic
1028497870 7:91482380-91482402 GTGGCAGGGAGGCTGGGGGAGGG - Intergenic
1028837294 7:95388939-95388961 GGGTGTGGGGGGCTGGGGGAGGG + Intronic
1028842258 7:95441275-95441297 GTATGCAGGTGGCTAGGAGATGG + Intergenic
1028916309 7:96263304-96263326 GTTGGAGGGTTTCTGGGAGATGG - Intronic
1029001745 7:97161574-97161596 GGGTGAGGGGGGCTAGGGGAGGG - Intronic
1029057400 7:97760831-97760853 GTGGCAGCGAGGCTGGGAGAGGG + Intergenic
1029475430 7:100780704-100780726 GGGTGAGGGTGGGAGGGAGACGG - Intronic
1029737916 7:102474704-102474726 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029755048 7:102568354-102568376 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029772998 7:102667434-102667456 GTGTGTGTGTGGCGGGGATAGGG - Intronic
1029920094 7:104253497-104253519 GTTTGAGATTGGCTGAGAGAAGG - Intergenic
1030655453 7:112162540-112162562 GTGTGTGGGTGGCAGGGAGAGGG - Intronic
1030820552 7:114086659-114086681 GCGTGGAGGTGGCTGGGACAGGG - Intronic
1031051501 7:116950333-116950355 GAGGGAGGGAGGCGGGGAGAAGG - Intergenic
1031084855 7:117292276-117292298 GTGTGAGTGTGGTTGGGAGTAGG - Intronic
1031484216 7:122309031-122309053 GTGTGATGGAGGCAGGGTGACGG + Intronic
1031662683 7:124445767-124445789 GTGTGAGGGCTGAGGGGAGAAGG - Intergenic
1031705359 7:124974696-124974718 GGGTGTGGGGGGCTGGGGGAGGG - Intergenic
1032299140 7:130670319-130670341 GACTGAGGATGGCTGGCAGACGG + Intronic
1032305750 7:130731977-130731999 GTGAGTTGGTGGGTGGGAGAGGG - Exonic
1032725426 7:134586358-134586380 GTGTGAGGCTTCCTGGGAAAAGG + Intergenic
1033808852 7:144986071-144986093 GGGTGTGGGTGGATGGGGGATGG + Intergenic
1033827777 7:145213301-145213323 GTGGGTGGGGGGCTGGGGGAGGG - Intergenic
1033962217 7:146928865-146928887 GTGGCAGGGAGGCTGGGGGAGGG + Intronic
1034248860 7:149672236-149672258 GTGTGAGGCTTCCTGGGAAAAGG + Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034427900 7:151024129-151024151 TTGGGGGGGTGGCTGGGATAGGG + Exonic
1034480177 7:151313957-151313979 GTGTGAGTGTGGGTGTGAGATGG + Intergenic
1034675549 7:152890385-152890407 GTGGGAGGGTGGGAGGGAGAAGG + Intergenic
1034722584 7:153308182-153308204 GGGGGTGGGGGGCTGGGAGAGGG + Intergenic
1034880352 7:154757976-154757998 GGGAGAGGGCGGCGGGGAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034889417 7:154827189-154827211 GTGTGTGTGTGTCTGGGAGGGGG - Intronic
1035002817 7:155628342-155628364 GTGGGTGGGGGGCTGGGGGAGGG + Intronic
1035054495 7:156025248-156025270 GTGTGTGGGTGGGTGGGTGTGGG + Intergenic
1035114987 7:156516963-156516985 GTGTGAGGGAGGCTGGGTGAAGG + Intergenic
1035115032 7:156517186-156517208 GTGTGAGGGAGGCTGTGTGAGGG + Intergenic
1035115055 7:156517291-156517313 CTGTGAGGGAGGCTGTGTGAGGG + Intergenic
1035115098 7:156517503-156517525 GTGTGAGGGAGGCTGTGTGAGGG + Intergenic
1035115127 7:156517650-156517672 GTGTGAAGGAGGCTGTGTGAGGG + Intergenic
1035115130 7:156517664-156517686 GTGTGAGGGAGGCTGTGTGAGGG + Intergenic
1035115132 7:156517678-156517700 GTGTGAGGGAGGCTGTGTGAAGG + Intergenic
1035115135 7:156517692-156517714 GTGTGAAGGAGGCTGTGTGAGGG + Intergenic
1035115138 7:156517706-156517728 GTGTGAGGGAGGCTGTGTGAGGG + Intergenic
1035115173 7:156517881-156517903 GTGTGAGGGAGGCTGTGTGAAGG + Intergenic
1035115176 7:156517895-156517917 GTGTGAAGGAGGCTGTGTGAGGG + Intergenic
1035115179 7:156517909-156517931 GTGTGAGGGAGGCTGTGTGAGGG + Intergenic
1035115181 7:156517923-156517945 GTGTGAGGGAGGCTGTGTGAAGG + Intergenic
1035115184 7:156517937-156517959 GTGTGAAGGAGGCTGTGTGAGGG + Intergenic
1035115207 7:156518044-156518066 GTGTGAGGGAGGCTGTGTGAGGG + Intergenic
1035196200 7:157222815-157222837 ATGAGATGGTGCCTGGGAGAAGG - Intronic
1035278954 7:157765466-157765488 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035279069 7:157765961-157765983 GTGTGTGGGTGGATGAAAGAAGG - Intronic
1035330231 7:158091924-158091946 GTGGGTGGGTGGATGGGTGAGGG + Intronic
1035407608 7:158609806-158609828 GTGTGAGGGAGTGTGGGTGAGGG + Intergenic
1035436437 7:158863580-158863602 GTGTGAGGGGGGCGGTGAGCCGG + Intronic
1035595550 8:854509-854531 GTGAGAGAGTGGGTGAGAGAGGG + Intergenic
1035794837 8:2345651-2345673 GTGTGTGTGTGTCTGTGAGAGGG + Intergenic
1036213899 8:6863547-6863569 GAGGGAGGCTGGCTGGGAGGTGG + Intergenic
1037159163 8:15746290-15746312 ATTTGGGGGTGGCTGGGAGCTGG - Intronic
1037386409 8:18347422-18347444 GTGTGCAGGTGGAGGGGAGATGG + Intergenic
1037521256 8:19682458-19682480 GTGTGTGGGTGAGTGGCAGAGGG - Intronic
1037617942 8:20536565-20536587 GTGTTGGGGTGGGTGGGTGAAGG + Intergenic
1037808237 8:22070103-22070125 GTGTGAGGGGGGAGGGGTGAAGG + Intronic
1037901585 8:22692234-22692256 GTGTGGGGACGGCGGGGAGAAGG - Intronic
1037943311 8:22971127-22971149 GAGTGAGGGTGGGAAGGAGAGGG - Intronic
1038370236 8:26981682-26981704 GCGGGGGGGTGGCTAGGAGAGGG + Intergenic
1038451492 8:27642244-27642266 GAGTGATGGGGGTTGGGAGATGG + Intronic
1039750021 8:40470163-40470185 GTGTGGGGATTGCAGGGAGAAGG + Intergenic
1039886854 8:41659701-41659723 GTGTGAGGGTGGCAGGGGGGTGG - Intronic
1039944926 8:42120827-42120849 GTGAGAGGGGAGCTGGGACAGGG - Intergenic
1040471089 8:47736768-47736790 GTGTGGGGGGGGCGGGGGGATGG - Intergenic
1040969439 8:53117821-53117843 GTGTGTGTGTGGTAGGGAGAAGG + Intergenic
1041288284 8:56283098-56283120 TTGGCATGGTGGCTGGGAGAAGG + Intergenic
1041351019 8:56947653-56947675 GTGTGTGTGTTGCAGGGAGAGGG - Intergenic
1041665916 8:60444694-60444716 GTGGCAGCCTGGCTGGGAGAGGG - Intergenic
1041718879 8:60958068-60958090 ATGTGAGTGTGGCTGAGATACGG + Intergenic
1041771992 8:61481631-61481653 GTGGCAGCGAGGCTGGGAGAGGG + Intronic
1042055746 8:64763619-64763641 GTGTGAGGCTGTCTGGGGAAGGG + Intronic
1042077335 8:65010455-65010477 GTGTGTGGGTGGCAGGGAGTAGG - Intergenic
1043123458 8:76360426-76360448 GTGGGAGTGAGGCTGGGGGAGGG + Intergenic
1043300590 8:78726094-78726116 ATGTGAGGGAGGGTGGAAGAGGG + Intronic
1044092246 8:88016166-88016188 GTCTGTGGGTGTCTGGCAGAGGG + Intergenic
1044832372 8:96262273-96262295 GAGGGAGGGTGGCGGGGAGGGGG + Intronic
1045242027 8:100410929-100410951 GGGAGAGAGTGGCTGGGAGGTGG + Intergenic
1046574980 8:116016799-116016821 GGGTGAGGGTGGCTGGGCATGGG + Intergenic
1046738946 8:117808641-117808663 CTGTGATGGTAGCTGGGGGACGG + Intronic
1047163588 8:122410430-122410452 GTGTGTGGGTAGCAAGGAGAGGG - Intergenic
1047791873 8:128211533-128211555 GTCTGTGGATGGCTGGGAGCAGG - Intergenic
1047808388 8:128381717-128381739 GTGTGAGGCTTTCTGGGAAAGGG - Intergenic
1047977320 8:130143513-130143535 GTCTGAGGGTGTGTAGGAGAGGG - Intronic
1048329905 8:133464392-133464414 ATGTGAGCGTGGCAGGGTGAGGG - Intronic
1048389518 8:133948171-133948193 GTGGGGGGGTGGCTGGGGGGAGG + Intergenic
1048415535 8:134224104-134224126 GTGGGAGGCTAGCTGGGAGCAGG - Intergenic
1048871881 8:138805848-138805870 GTGTGATGGTGTGTGTGAGATGG + Intronic
1048871918 8:138806256-138806278 GTGTGATGGTGTGTGTGAGATGG + Intronic
1049065991 8:140314596-140314618 GTCTGGGGATGGTTGGGAGAAGG - Intronic
1049252019 8:141594267-141594289 ATGTCAGGGTGGCTGTGACAGGG + Intergenic
1049350246 8:142160507-142160529 GTGGGAGGGTGGCTGTCAGGGGG + Intergenic
1049639259 8:143707135-143707157 GCGCGAGGTGGGCTGGGAGAAGG + Exonic
1049886868 9:33450-33472 GTGGGTGGGGGGCTGGGGGAGGG - Intergenic
1050071549 9:1820280-1820302 GGGGGTGGGGGGCTGGGAGAGGG - Intergenic
1050214995 9:3312798-3312820 GTGGCAGTGAGGCTGGGAGAGGG + Intronic
1050422183 9:5477540-5477562 GTGGTAGGGAGGCTGGGGGAGGG - Intergenic
1050537562 9:6644315-6644337 GTGAGAGGGTGCCTGGGAAGTGG + Intronic
1051314783 9:15817628-15817650 GTGGCAGGGAGGCTGGGGGAGGG + Intronic
1051366741 9:16326638-16326660 GAAGGAGGGTGGCTGGGAGAAGG + Intergenic
1051548249 9:18300461-18300483 GGGGGAGGGGGGCTGGGGGAGGG + Intergenic
1051934962 9:22435192-22435214 GTGTGAGGCTTTCTGGGAAAGGG + Intergenic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052733973 9:32321261-32321283 CTGGGAGGGTAGCTGGTAGAGGG + Intergenic
1052878451 9:33584889-33584911 GTGTGAGGGTGGTGGGTAGTAGG + Intergenic
1052996052 9:34552131-34552153 GAGTGAGGCTGGGTGGCAGAGGG - Intronic
1053160444 9:35810222-35810244 GTGTGAGGGTGACTAGGTGTTGG - Intronic
1053392969 9:37749266-37749288 ATGTGATGGTGGGTGGGAAAAGG - Intronic
1053497530 9:38559320-38559342 GTGTGAGGGTGGTGGGTAGTAGG - Intronic
1053664147 9:40305745-40305767 GTGGGAGGGTGGGTGGTAGTAGG + Intronic
1053665114 9:40311950-40311972 GTGGGAGGGTGGGTGGTAGTAGG + Intronic
1053790994 9:41686175-41686197 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1053914695 9:42937000-42937022 GTGGGAGGGTGGGTGGTAGTAGG + Intergenic
1054154156 9:61628597-61628619 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054179340 9:61897869-61897891 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1054376275 9:64451980-64452002 GTGGGAGGGTGGGTGGTAGTAGG + Intergenic
1054473944 9:65559717-65559739 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054519502 9:66064334-66064356 GTGGGAGGGTGGGTGGTAGTAGG - Intergenic
1054520468 9:66070540-66070562 GTGGGAGGGTGGGTGGTAGTAGG - Intergenic
1054658198 9:67682952-67682974 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054708615 9:68488239-68488261 GTGTGCTGGGGGATGGGAGAGGG - Intronic
1054993231 9:71354362-71354384 GTGTGTGGGTGGATGGGATGCGG - Intronic
1055371115 9:75600720-75600742 GTGTGTGGGTGGGTGGGTGTGGG + Intergenic
1055403598 9:75950141-75950163 GTGTGGGGGGGGCGGGGAGGGGG + Intronic
1056030809 9:82551498-82551520 GTCTGAGTGAGGCTGGTAGAGGG + Intergenic
1056254519 9:84785214-84785236 GTGTGATGGAGGGTGGGAGGAGG - Intronic
1056291423 9:85147724-85147746 GTGAGAGGGTGGGCAGGAGAAGG + Intergenic
1056704927 9:88943794-88943816 GTGTGAGGCTGTCTGGGGAAGGG - Intergenic
1056708579 9:88971797-88971819 GTGTGAGGGCCGCGGGGAGTCGG - Intergenic
1056710906 9:88991355-88991377 GGGAGAGGGGGGCGGGGAGAGGG + Intronic
1056765111 9:89440298-89440320 GTGAAAGCGTGGGTGGGAGAAGG - Intronic
1056857251 9:90142548-90142570 TGGCGAGGGTGGCGGGGAGAGGG - Intergenic
1057052234 9:91934451-91934473 GTGGGTGGGTTGCTGGGGGAAGG - Intronic
1057272802 9:93660248-93660270 GTGTGACGGGGACCGGGAGAAGG + Exonic
1057483449 9:95463356-95463378 GGGTGAGCGTGGAGGGGAGACGG + Intronic
1057499093 9:95582599-95582621 GGGTGAGGGGGGATGGGGGAAGG + Intergenic
1057677005 9:97143802-97143824 GTGTGAGGGTGGTGGGTAGTAGG - Intergenic
1057739755 9:97701142-97701164 GTGGGAGGGGGACTGAGAGAGGG - Intergenic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057795158 9:98150553-98150575 GTGTGACGTGGGTTGGGAGAGGG - Intronic
1058449727 9:105084844-105084866 TGGTGTGGGGGGCTGGGAGAGGG - Intergenic
1058866485 9:109166647-109166669 GGGAGAGTGAGGCTGGGAGAGGG - Intronic
1058994749 9:110288652-110288674 ATGTGTGTGTGGCTGGGAGTAGG - Intergenic
1059106468 9:111515995-111516017 GTTTGAGGGTGGTTGTGAGAGGG - Intergenic
1059448047 9:114351255-114351277 GTGTCATGGTGGGTGGGAGGAGG - Intronic
1060206231 9:121684441-121684463 ATGTGATGGGGGCTGGGAGAAGG - Intronic
1060876713 9:127089156-127089178 GTGAGAGGGTGTCTGGGAGGAGG + Intronic
1060944207 9:127560390-127560412 GAGTGAGTGTGGATGGGAGGAGG - Intronic
1061012834 9:127965575-127965597 GAGTGAGCGTGGCTGAGGGAGGG - Intronic
1061039058 9:128129083-128129105 GTGAGAGTGGCGCTGGGAGAAGG - Intergenic
1061517527 9:131098268-131098290 GGGTGAGGGTGGCGGTGAGGAGG - Intronic
1061539213 9:131268501-131268523 GAGTGGGGTTGGCAGGGAGAAGG - Intronic
1061809004 9:133151700-133151722 CTGGGTGGATGGCTGGGAGATGG - Intergenic
1062100219 9:134724082-134724104 GTGAGAGGGTGGCAGGGAAGAGG - Intronic
1062127376 9:134870821-134870843 GTGGGAGGGAAGCTGGCAGAAGG + Intergenic
1062138546 9:134942929-134942951 TTCTGAGGGAGGCTGGGAGCTGG - Intergenic
1062185743 9:135217603-135217625 GAGGGAGGGAGGCTGGGAGAAGG - Intergenic
1062658316 9:137615293-137615315 GGGTGGGGGTGGCAGGGAGCTGG + Exonic
1062714264 9:137998109-137998131 GGGTGGGGGTTGCTGGGAGGTGG + Intronic
1203365774 Un_KI270442v1:254438-254460 GTGGCAGTGTGGCTGGGGGAGGG + Intergenic
1203617877 Un_KI270749v1:85737-85759 GTGTGAAGATGCCTGGAAGAGGG + Intergenic
1185460437 X:330776-330798 GTGTGTTGGGGGCTGAGAGACGG + Intergenic
1185474028 X:402944-402966 GTGTGAGGGTGTGTGTGTGAGGG + Intergenic
1185705240 X:2262030-2262052 GTATGAGAGGGCCTGGGAGAAGG - Intronic
1187027398 X:15450125-15450147 GGGTGAGGGTAGCAGGGATAAGG - Intronic
1187099359 X:16176952-16176974 GGGAGAGGGAGGATGGGAGAGGG + Intergenic
1187280171 X:17852549-17852571 GTGTTTGGGGGGCAGGGAGAGGG - Intronic
1187370593 X:18702469-18702491 GTGTCAGGGTGGCTGAGCCAAGG + Intronic
1187484411 X:19688614-19688636 GTGTGTGGGTGGGTGTGGGAGGG - Intronic
1188007014 X:25022645-25022667 GAGTGGGGGTGGTTGGGAGGAGG - Intergenic
1188463888 X:30456412-30456434 GGGGGTGGGGGGCTGGGAGAGGG - Intergenic
1189207840 X:39257037-39257059 GTGTCCAGGTGGCTGGGGGAGGG - Intergenic
1189555372 X:42139271-42139293 GGGTGGGGGTGGCAGGGATATGG - Intergenic
1190056906 X:47186410-47186432 CTGTGAGGGGTGCTGGGGGATGG - Intronic
1190066807 X:47247233-47247255 GGGAGAGGATGGCTGGGGGAAGG + Intronic
1190123408 X:47682730-47682752 GGGAGAAGGTGGATGGGAGAAGG - Intergenic
1190541143 X:51480249-51480271 GTGTCAGGGTTTCTGGGAAAGGG + Intergenic
1190545134 X:51517909-51517931 GTGGCAGCGAGGCTGGGAGAGGG - Intergenic
1192031209 X:67514314-67514336 GGGAGAGGGGGGCTGGGGGAGGG + Intergenic
1192083990 X:68077002-68077024 GTGTGGGAGTGGCCTGGAGAGGG + Intronic
1192319984 X:70082975-70082997 AAGTGAGAGTGGCAGGGAGATGG + Intergenic
1192728348 X:73776428-73776450 GTGGGTGGGAGGCTGGGGGAGGG + Intergenic
1192940284 X:75904385-75904407 GTGTGAGGCTGTCTGGGAAAGGG - Intergenic
1193172291 X:78349830-78349852 GTGTGAGGCTGTCTGGGAAAGGG - Intergenic
1193319846 X:80108362-80108384 GGGTGAGAGTGGGTGGGAGGTGG + Intergenic
1193400987 X:81042232-81042254 GTGTGAGAGTGGGAGGGATAAGG - Intergenic
1193592515 X:83407551-83407573 GTGGCAGCGAGGCTGGGAGAGGG + Intergenic
1194653864 X:96547881-96547903 GTGTGTGTGTAGCTGGGGGAAGG - Intergenic
1195046465 X:101058869-101058891 GTGTGGGGGTGGCTAGGCAATGG - Intergenic
1195109631 X:101633927-101633949 GTGGGTGGGTGGCTAGGGGAGGG - Intergenic
1195584696 X:106551919-106551941 GTGTGAGGCTGTCTGGGGAAGGG + Intergenic
1195884597 X:109625334-109625356 GTGGGGGCGAGGCTGGGAGACGG + Intronic
1195886585 X:109645076-109645098 GTGGCAGGGAGGCTGGGGGAGGG + Intronic
1195983663 X:110606247-110606269 GTGGCAGGGAGGCTGGGGGAGGG + Intergenic
1196404558 X:115348025-115348047 ATGTGATGGTGGCTGGGAAGAGG + Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1197746423 X:129934470-129934492 GTGTGAGGTGGGCAGGGAGCTGG - Intergenic
1197896938 X:131326378-131326400 GTGTGTGTGTGTTTGGGAGAGGG + Intronic
1198033287 X:132776574-132776596 GAGTGAGGATGGATGGGGGAAGG - Intronic
1198600440 X:138279150-138279172 GAGGGTGGGTGGCTGGGAGAGGG - Intergenic
1198708009 X:139470262-139470284 GTGTGTGGGTGGGCGAGAGAGGG - Intergenic
1198796946 X:140407139-140407161 GTGGGTGGGGGGCTGGGGGAGGG + Intergenic
1198997904 X:142596503-142596525 GTGTTCGGGTGGGTGGCAGAGGG + Intergenic
1199267278 X:145843380-145843402 GTGTGAGGCTGCCTGGGGGAGGG + Intergenic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1201018435 Y:9626840-9626862 GTGTGAGTGAGGATGGCAGAGGG - Intergenic
1201536967 Y:15060257-15060279 ACATGAGAGTGGCTGGGAGAGGG - Intergenic
1201936739 Y:19418584-19418606 GTGGCAGCGAGGCTGGGAGAGGG - Intergenic
1202059148 Y:20867862-20867884 GTGGTAGGGAGGCTGGGGGAAGG - Intergenic