ID: 914813692

View in Genome Browser
Species Human (GRCh38)
Location 1:151047900-151047922
Sequence GCCTTGGGCCCCCGCCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 376}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914813692_914813704 25 Left 914813692 1:151047900-151047922 CCCGGGCGGCGGGGGCCCAAGGC 0: 1
1: 0
2: 4
3: 34
4: 376
Right 914813704 1:151047948-151047970 AGCGGGTCAGTTTACGCTTTGGG 0: 1
1: 0
2: 0
3: 3
4: 30
914813692_914813700 8 Left 914813692 1:151047900-151047922 CCCGGGCGGCGGGGGCCCAAGGC 0: 1
1: 0
2: 4
3: 34
4: 376
Right 914813700 1:151047931-151047953 GACTCCGACCGAAATGCAGCGGG 0: 1
1: 0
2: 0
3: 5
4: 17
914813692_914813706 27 Left 914813692 1:151047900-151047922 CCCGGGCGGCGGGGGCCCAAGGC 0: 1
1: 0
2: 4
3: 34
4: 376
Right 914813706 1:151047950-151047972 CGGGTCAGTTTACGCTTTGGGGG 0: 1
1: 0
2: 0
3: 0
4: 33
914813692_914813703 24 Left 914813692 1:151047900-151047922 CCCGGGCGGCGGGGGCCCAAGGC 0: 1
1: 0
2: 4
3: 34
4: 376
Right 914813703 1:151047947-151047969 CAGCGGGTCAGTTTACGCTTTGG 0: 1
1: 0
2: 0
3: 2
4: 25
914813692_914813699 7 Left 914813692 1:151047900-151047922 CCCGGGCGGCGGGGGCCCAAGGC 0: 1
1: 0
2: 4
3: 34
4: 376
Right 914813699 1:151047930-151047952 AGACTCCGACCGAAATGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 46
914813692_914813705 26 Left 914813692 1:151047900-151047922 CCCGGGCGGCGGGGGCCCAAGGC 0: 1
1: 0
2: 4
3: 34
4: 376
Right 914813705 1:151047949-151047971 GCGGGTCAGTTTACGCTTTGGGG 0: 1
1: 0
2: 0
3: 0
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914813692 Original CRISPR GCCTTGGGCCCCCGCCGCCC GGG (reversed) Exonic
901805974 1:11738809-11738831 TCCCTGGGCCCCGGCCACCCTGG + Intronic
902557469 1:17255403-17255425 GCCTTGGACCCTCGCCGCTGAGG - Intronic
902916696 1:19644133-19644155 GCCCGGGGCCCCTGCCGCCGCGG + Intronic
903322964 1:22553562-22553584 GCCTGGGTCCCCAGCGGCCCTGG + Intergenic
903476033 1:23619690-23619712 GCGTGGGGCCCCGCCCGCCCAGG - Intronic
904285810 1:29452697-29452719 GCCTTGAGCCCTCTCCTCCCGGG + Intergenic
904606523 1:31700934-31700956 GCCATGGGCCTCCCTCGCCCTGG + Intronic
904673051 1:32180179-32180201 GCCGTTGGCGCCCTCCGCCCGGG + Exonic
904822796 1:33256349-33256371 GCGTCGGGCCCCCGCCTCTCCGG - Intergenic
905173992 1:36125102-36125124 GCCCGGAGCCCTCGCCGCCCGGG - Exonic
905900905 1:41581482-41581504 GCCCTGGGCCCTTGCCTCCCGGG + Exonic
908714299 1:67053782-67053804 GGCCTGGGCCGCCGCCGCCTCGG + Intronic
911073164 1:93847832-93847854 GCCCTGGGCCACCGAGGCCCGGG - Intergenic
911723783 1:101220132-101220154 GCCTGGAGCTCCCGCCGCACTGG + Intergenic
912354262 1:109042171-109042193 GCCTCAGGACCCCGCCGCGCGGG + Intergenic
912936923 1:114011787-114011809 GCCTTGGCCTCCCACAGCCCTGG + Intergenic
913193478 1:116433257-116433279 GCCTTGGGCTGCAGCTGCCCTGG - Intergenic
913703510 1:121396757-121396779 GCGTTTTGCCCCCGCCGCCACGG + Intergenic
913703520 1:121396801-121396823 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
913942011 1:125118541-125118563 GCTTTTGGCCCCCGCCACCGCGG + Intergenic
913942188 1:125119289-125119311 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
913979631 1:143497641-143497663 TTTTTGCGCCCCCGCCGCCCCGG + Intergenic
913979886 1:143498588-143498610 GCGTTTTGCCCCCGCCGCCGAGG + Intergenic
914043940 1:144076672-144076694 GCTTTTGCCCCCCGCCGCCGCGG + Intergenic
914044338 1:144078033-144078055 TCTTTGTGCCCCCGCCGCCGTGG + Intergenic
914074235 1:144324072-144324094 GCGTTTTGCCCCCGCCGCCGAGG + Intergenic
914104941 1:144642374-144642396 GCGTTTTGCCCCCGCCGCCGAGG - Intergenic
914133773 1:144882654-144882676 TCTTTGTGCCCCCGCCGCCGTGG - Intergenic
914813692 1:151047900-151047922 GCCTTGGGCCCCCGCCGCCCGGG - Exonic
916085867 1:161268796-161268818 GCCTTGGGCTCCCAAAGCCCTGG + Intronic
920002376 1:202808484-202808506 GCCGTGCGCCTCCGCCGCCACGG + Exonic
1066780599 10:38942051-38942073 GCTTTTGGCCCCTGCCGCCACGG + Intergenic
1066954226 10:42149839-42149861 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1066954260 10:42149958-42149980 GCTTTTTGCCCCCGCCGCCACGG - Intergenic
1066954291 10:42150094-42150116 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1066954451 10:42150715-42150737 GCTTTTGGCCCCCGCCACCGCGG - Intergenic
1067769934 10:49115614-49115636 GCCTCGGGACCCAGCAGCCCCGG - Intergenic
1069592767 10:69652284-69652306 GCCTGGAGCCTCCGCCGCTCTGG + Intergenic
1069756344 10:70776327-70776349 GCCTTGTGCCCCCTCCCCACAGG + Intronic
1069962722 10:72087923-72087945 GCCCTGGGACCCCCCAGCCCCGG - Intronic
1069991632 10:72319892-72319914 GCCCTGGGCGCCCCCCGCACCGG - Intergenic
1069996132 10:72343235-72343257 GCCTTGGGCCCAAGTTGCCCAGG - Intronic
1070599748 10:77857361-77857383 CCCTTGGGCCCCAGCTGCCCTGG - Intronic
1070768470 10:79069434-79069456 GCCTCGGCCCCCGGCCGCCAAGG - Intronic
1072700943 10:97640936-97640958 GCCCTGGGCCGCCGCGCCCCGGG - Exonic
1074829995 10:117241335-117241357 GCCCTGCGCCCCGGCTGCCCCGG - Intronic
1076687575 10:132204969-132204991 CCCTGGGGCCCCCGCGGCCTCGG - Exonic
1076726093 10:132413971-132413993 GCCTTGGGGCCCCACCTGCCTGG - Intronic
1076750092 10:132538070-132538092 GCCCAGCGCCCGCGCCGCCCGGG + Exonic
1076820011 10:132933598-132933620 GCCCTGTGCCCCTGCGGCCCAGG + Intronic
1076866254 10:133167823-133167845 GCCCTGAGCCCCCTCCGCTCAGG + Intronic
1077108582 11:852482-852504 GCCTTGGCCCCCCCCAACCCTGG + Intronic
1077442550 11:2575361-2575383 CCCTGGGCCCCCCACCGCCCAGG + Intronic
1080642172 11:34164441-34164463 GCCTGGGCCTCCCGACGCCCAGG - Intronic
1081812771 11:45922765-45922787 GCCGTCGGGCCCCGCCGCCCAGG + Intronic
1081860926 11:46333042-46333064 GCCAGGAGCCCCCGCCCCCCCGG + Intronic
1083615599 11:64024629-64024651 GGCTTGGGCCCCAGCCAGCCGGG + Intronic
1083665011 11:64269496-64269518 GCCCGGGGCCAGCGCCGCCCGGG - Intergenic
1083765302 11:64838697-64838719 TCCATGGGCCCCCGCAGCTCAGG + Exonic
1084178591 11:67435754-67435776 GCCCTGGCCCCCAGCTGCCCTGG + Exonic
1084603954 11:70162019-70162041 GCCTGGGGTCCCCACGGCCCAGG - Intronic
1084604017 11:70162203-70162225 GCCTGGGGTCCCCACTGCCCGGG - Intronic
1084604048 11:70162279-70162301 GCCTGGGGTCCCCACTGCCCGGG - Intronic
1085303747 11:75473619-75473641 GGCTCAGGCCCCCGCTGCCCAGG + Intronic
1088438824 11:109845654-109845676 GCCTTGGGCCCCTGCCCAGCTGG + Intergenic
1089458970 11:118641688-118641710 TCCCTGGGCCTCCGCCTCCCGGG + Intronic
1093057296 12:14567885-14567907 GCCTGGGGCCCACCCCGCCTAGG + Exonic
1093692634 12:22125249-22125271 GACTTGGTCCCCTGCCTCCCAGG + Intronic
1096246466 12:49991594-49991616 TCCTTGTGCCTCAGCCGCCCTGG + Intronic
1100444814 12:94650579-94650601 GCCCTGCGCCGCCGCCGCCGCGG + Intergenic
1102346418 12:112163840-112163862 GGCCTGGGGCCCAGCCGCCCTGG + Intronic
1103623804 12:122204234-122204256 GCCTTGGGCGGCAGCCGCCTCGG - Intronic
1103764489 12:123271146-123271168 GGCGCGGGGCCCCGCCGCCCTGG - Intronic
1103764652 12:123271622-123271644 GCCCGGCGCGCCCGCCGCCCGGG - Exonic
1103916582 12:124378878-124378900 GCCTTGTGTCCCCACAGCCCTGG - Intronic
1104785428 12:131445240-131445262 GCCCTTGGCCTCCGCAGCCCAGG - Intergenic
1104947726 12:132424054-132424076 GCCTGGGGATCCCGCAGCCCAGG - Intergenic
1105779619 13:23695370-23695392 GCCCTGGGCGCCCGCCGGCTGGG - Intergenic
1106087798 13:26558299-26558321 CCATTCGGCCCTCGCCGCCCTGG + Intronic
1106995050 13:35471271-35471293 GCCCTCGGCCCCCGCCGGGCCGG - Intronic
1107849930 13:44561055-44561077 TCCCTGGTCCCCCGACGCCCCGG - Intronic
1108363976 13:49691907-49691929 CCCTTGGCCCCCAGCCTCCCTGG - Intergenic
1110977987 13:81864513-81864535 GTCTTGTGCCCCCCCCACCCAGG + Intergenic
1111396303 13:87672632-87672654 GCCTGGGGCCGCCGCCGCGGTGG - Exonic
1112050734 13:95642125-95642147 ACCTTAGGCCGCCGCCGCCGCGG - Exonic
1113847226 13:113399312-113399334 CCTTTGGCCCCCCGCGGCCCAGG + Intergenic
1114668840 14:24398514-24398536 TCCTTAGGCCCCGGCCTCCCTGG + Intergenic
1116815889 14:49583299-49583321 GCCTTGGGCCCCCAAAGCTCTGG - Intronic
1117315676 14:54568223-54568245 GCCTCGGGGCCACGCCGTCCAGG - Intronic
1118059211 14:62117060-62117082 GCCTCGGTCCCGCGCCTCCCCGG - Intergenic
1120167850 14:81220238-81220260 GCCTGGGGCCGCCGCGGGCCGGG - Intronic
1122065898 14:99174480-99174502 GCCCGGGGCCCGGGCCGCCCAGG + Exonic
1122297062 14:100711698-100711720 CCCTGGGGCCCCAGCCGGCCTGG - Intergenic
1122458922 14:101879395-101879417 GCCGTAGGGCCACGCCGCCCAGG - Intronic
1122582194 14:102777752-102777774 GCCCCCGGGCCCCGCCGCCCAGG - Intronic
1122691821 14:103535213-103535235 CCCCTGGGCCCCCACGGCCCTGG + Exonic
1122806831 14:104264110-104264132 GCCTTGGGCCAGCGACCCCCAGG + Intergenic
1122810857 14:104287245-104287267 GCCTGGGGCCCCTGACACCCTGG - Intergenic
1122975460 14:105168943-105168965 GCCCCGTGCCCCCGCCGCCCGGG - Intergenic
1202940101 14_KI270725v1_random:137585-137607 GCTTTCGGCCCGCGCCGCCGCGG - Intergenic
1202940119 14_KI270725v1_random:137655-137677 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1202940199 14_KI270725v1_random:138000-138022 GCTTTTTGCCCCCGCCGCCACGG - Intergenic
1202940239 14_KI270725v1_random:138166-138188 GCTTTTGGTCCCCGCCGCCACGG - Intergenic
1202940305 14_KI270725v1_random:138401-138423 GCTTTTTGCCCCCGCCGCCGAGG - Intergenic
1123396683 15:19944138-19944160 GCTTTTTGACCCCGCCGCCCTGG + Intergenic
1124707001 15:31974565-31974587 GCCTTGGGCCGCTCCCTCCCCGG - Intergenic
1125718761 15:41835201-41835223 GCCCTGGGCCTCCGAAGCCCTGG + Exonic
1125933525 15:43616345-43616367 GCCTTGGGCACCTGGTGCCCAGG + Exonic
1125946623 15:43715807-43715829 GCCTTGGGCACCTGGTGCCCAGG + Intergenic
1127268019 15:57376639-57376661 CCCTGGGGGTCCCGCCGCCCTGG - Intronic
1128314062 15:66649086-66649108 GCCTCCGGCCTCCGCCTCCCAGG + Intronic
1129189212 15:73927667-73927689 GCCATGGGCCTGCGCCGCCTCGG - Exonic
1131517387 15:93088531-93088553 CCCATTGGCCCGCGCCGCCCGGG - Intronic
1132515121 16:362674-362696 GCCTTGGGCTGCTGCAGCCCAGG + Intergenic
1132609717 16:809374-809396 CCCTTGGTCCCCCGACCCCCAGG + Intronic
1132750341 16:1454702-1454724 GCTTGGGGCCCTCCCCGCCCCGG - Intronic
1132898007 16:2238044-2238066 GTCTTGGGTCCCCACCGCCCGGG + Intronic
1133156347 16:3879796-3879818 GCCCCGGGCCCCCGCCGCCCCGG + Intronic
1133288918 16:4705104-4705126 GCCGTGGGGCTCTGCCGCCCAGG + Exonic
1135572304 16:23558107-23558129 CCCTGGGGACCCCGCAGCCCAGG + Exonic
1136485774 16:30571049-30571071 GGCTTGGAGCCCCGCCGCCCAGG - Exonic
1136514799 16:30761775-30761797 GCCCCGGGCTCCCGCCGCCTAGG + Exonic
1136696347 16:32084790-32084812 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1136696469 16:32085296-32085318 GCTTTTTGCCCCCGCCGCCACGG - Intergenic
1136768463 16:32811492-32811514 GCCTTTTGCCCCCGCCGCAGCGG - Intergenic
1136771718 16:32846492-32846514 GCTTTTGGCCCCCGCCGCCCCGG - Intergenic
1136771780 16:32846745-32846767 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1136796842 16:33028042-33028064 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1136796966 16:33028570-33028592 GCTTTTTGCCCCCGCCGCCAGGG - Intergenic
1136797062 16:33028948-33028970 GCTTTTGGCCCCCGGCGCCGCGG - Intergenic
1136797127 16:33029206-33029228 GCTTTCTGCCCCCGCCGCCGCGG - Intergenic
1136867823 16:33770702-33770724 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1136867842 16:33770771-33770793 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1136898810 16:34014702-34014724 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1136898818 16:34014734-34014756 GCTTTCTGCCCCCGCCGCCGCGG + Intergenic
1136902029 16:34050521-34050543 GCTTTTTGCCCCCGCCGCCACGG + Intergenic
1136902041 16:34050574-34050596 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1136927754 16:34389574-34389596 GCCTAGGGCCCCACCCGCCGAGG - Intergenic
1136957584 16:34803575-34803597 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1136957621 16:34803717-34803739 GCTTTTTGCCCCCGCCGCCGTGG + Intergenic
1136976820 16:35022232-35022254 GCCTAGGGCCCCACCCGCCGAGG + Exonic
1137084387 16:36102016-36102038 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1137219064 16:46428537-46428559 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1137219093 16:46428673-46428695 GCTTTTTGCCCCCGCCGCCGTGG - Intergenic
1137288464 16:47035654-47035676 GCCCTGGGCCCTCGCAGCCAGGG - Intergenic
1138360618 16:56424975-56424997 GCCTAGGGGCCCCTCCGCCAGGG - Intronic
1138450659 16:57092176-57092198 GCCCTGGGGCCCCGCAGGCCCGG + Intergenic
1138536706 16:57664057-57664079 GCCCTGGGCCCCATTCGCCCTGG - Exonic
1139467776 16:67163425-67163447 GCGTTGCGCCGCCGCCACCCTGG + Exonic
1140224431 16:73066729-73066751 GCCCAGGGCCCACGCCGCCCAGG + Intergenic
1141009911 16:80387646-80387668 GCCTGGGGCCCCCTCCTCCAAGG + Intergenic
1141407670 16:83808159-83808181 GGCTTGGCCCGGCGCCGCCCGGG - Intronic
1141692128 16:85602439-85602461 CCCTTGGGCCCTGGCCGCCCTGG + Intergenic
1203070860 16_KI270728v1_random:1073546-1073568 GCCTTTTGCCCCCGCCGCAGCGG - Intergenic
1203074144 16_KI270728v1_random:1108603-1108625 GCTTTTGGCCCCCGCCGCCCCGG - Intergenic
1203074206 16_KI270728v1_random:1108856-1108878 GCTTTTTGCCCCCGCCGCCGTGG - Intergenic
1203104331 16_KI270728v1_random:1345499-1345521 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1203104344 16_KI270728v1_random:1345546-1345568 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1203129170 16_KI270728v1_random:1616822-1616844 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1203129183 16_KI270728v1_random:1616869-1616891 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1143387185 17:6538050-6538072 GCCAGGGGGCACCGCCGCCCGGG + Exonic
1143644570 17:8221922-8221944 GCTTTGGCCCCCAGCCGTCCAGG - Intergenic
1144075629 17:11716869-11716891 GCCATGGCCCCCTGCCTCCCAGG - Intronic
1144756186 17:17681839-17681861 GCCTCGCGCCGCCCCCGCCCCGG - Intronic
1145327120 17:21842106-21842128 GCTTTTTGCCCCCGCCGCCACGG + Intergenic
1145327150 17:21842230-21842252 GCTTTTTGCCCCCGCCGCCGAGG + Intergenic
1145327162 17:21842268-21842290 GCTTTTTGCCCCCGCCGCCCCGG + Intergenic
1145327200 17:21842402-21842424 GCTTTTCGCCCCCGCCGCCGGGG + Intergenic
1145327221 17:21842484-21842506 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1145327403 17:21843185-21843207 GCTTTTTGCCCCCGCCGCCACGG + Intergenic
1145327521 17:21843654-21843676 GCTTTTCGCCCCCGCCGCCGCGG + Intergenic
1145327623 17:21844050-21844072 GCTTTTCGCCCCCGCCGCCGCGG + Intergenic
1145693108 17:26765847-26765869 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1145694099 17:26774107-26774129 GCTTTTGGCCCCCGCCGCCGCGG + Intergenic
1145694142 17:26774268-26774290 GCTTTTTGCCCCCGCCGCCGAGG + Intergenic
1145694282 17:26774760-26774782 GCTTTTTGCCCCCGCCGCCATGG + Intergenic
1145694447 17:26775458-26775480 GCTTTTCGCCCCCGCCGCCGCGG + Intergenic
1145694462 17:26775501-26775523 GGCTTTTGCCCCCGCCGCCGTGG + Intergenic
1145709937 17:26962798-26962820 GCTTTTTGCCCCCGCCGCCGAGG + Intergenic
1147967075 17:44199399-44199421 GGCTTGGGCCCCCTCCCCCCAGG - Intronic
1149430653 17:56593886-56593908 GCCCTGCGCCGCCGCCGGCCCGG + Exonic
1151674100 17:75589120-75589142 GCCGTGGGCCCCCGCCGCGCTGG + Intergenic
1152152220 17:78609314-78609336 GCCTTGGCCCCCATCCCCCCTGG - Intergenic
1152160686 17:78666814-78666836 GCCCTGGGGCCCGGCTGCCCTGG - Intergenic
1152250924 17:79212225-79212247 CCCTTGGCCACCCGCTGCCCTGG + Intronic
1152361444 17:79834976-79834998 GCCTGGAGCACCCGCCGCACCGG + Exonic
1152552318 17:81035706-81035728 GCCCGCCGCCCCCGCCGCCCCGG - Intronic
1152553867 17:81043404-81043426 GCCTGGGGCCACCGAGGCCCTGG - Intronic
1203191962 17_KI270729v1_random:199033-199055 GCTTTTGGTCCCCGCCGCCGAGG + Intergenic
1203192015 17_KI270729v1_random:199244-199266 GATTTTGGCCCCCGCCGCCGCGG + Intergenic
1203192024 17_KI270729v1_random:199276-199298 GCTTTTGGCCCCCGCCACCGCGG + Intergenic
1203192082 17_KI270729v1_random:199515-199537 GCTTTTGGCCCCCGCCGTCGCGG + Intergenic
1153024057 18:657775-657797 GCCCTTGCCCCCCGCCGCACAGG + Exonic
1154503677 18:15010504-15010526 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1154515951 18:15165273-15165295 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1154518354 18:15197935-15197957 GCTTTTTGCCCCCGCCGCCCAGG - Intergenic
1154518398 18:15198124-15198146 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1154518407 18:15198146-15198168 GCTTTTTGCCCCCGCCGCCCCGG - Intergenic
1155055341 18:22177203-22177225 GCCTTGGGCGTCCCCCTCCCAGG + Intronic
1158780067 18:60637950-60637972 GTCTTGGGACCCCCCCACCCAGG - Intergenic
1158930923 18:62324967-62324989 GCCTGTGGGCCCCGCCTCCCGGG - Intergenic
1158976691 18:62716436-62716458 GCCCGGAGCCGCCGCCGCCCGGG + Exonic
1161120678 19:2524164-2524186 ACCCTGGGCCCCTGCTGCCCTGG + Intronic
1161171207 19:2813303-2813325 GGCCTGCGCTCCCGCCGCCCTGG + Exonic
1161581898 19:5085725-5085747 GCGTAAGGCCCTCGCCGCCCAGG - Intronic
1161973443 19:7596281-7596303 GGCTCGGGCCCCTGCCGCGCCGG + Intronic
1162153257 19:8660133-8660155 GCCCTGGGCTCCGGCTGCCCAGG + Intergenic
1162298993 19:9833371-9833393 GCCTTGGGCTCCCAAAGCCCTGG + Intergenic
1163633683 19:18429081-18429103 GGCTTGGGCGGCCTCCGCCCTGG - Intronic
1164659433 19:29949656-29949678 GCCTTGGCCCCCCGACGTGCCGG - Intronic
1165065486 19:33225857-33225879 CTCCCGGGCCCCCGCCGCCCGGG - Intergenic
1165236923 19:34428799-34428821 GCCGCGGGCCCCCGCCTCCCCGG + Intronic
1165902709 19:39176239-39176261 GCCCTGGGGCCCTGCTGCCCTGG - Intronic
1166788213 19:45382149-45382171 ACCTCGGGCCCCCCCCACCCGGG - Intronic
1167145585 19:47679622-47679644 GGCTTGGGGCCCCGCAGCCACGG - Exonic
1167269313 19:48498770-48498792 TCCTCGGGCCCCCGCGGACCCGG - Exonic
1168297498 19:55384484-55384506 GCCTAGGGCCCGTGCCACCCAGG + Exonic
1168311055 19:55461105-55461127 GCCTTGGGTACCCTCCACCCAGG - Intronic
1202669548 1_KI270709v1_random:39179-39201 GCTTTTGGCCCCCGGCGCCGTGG + Intergenic
1202669583 1_KI270709v1_random:39317-39339 GCTTTTGGCCCCCGCCACCGCGG + Intergenic
1202669645 1_KI270709v1_random:39546-39568 GCTTTTTGCCCCCGCCGCCACGG + Intergenic
1202680288 1_KI270712v1_random:3025-3047 GCATTTTGCCCCCGCCGCCGTGG - Intergenic
1202681423 1_KI270712v1_random:7112-7134 GCCCTCCGCCGCCGCCGCCCCGG - Intergenic
1202683627 1_KI270712v1_random:30506-30528 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
925386081 2:3462795-3462817 GGCTTGGGCCCCCCCTCCCCCGG + Intronic
927679779 2:25131930-25131952 GCCTCGGCCCCGCCCCGCCCCGG - Intronic
928606403 2:32947765-32947787 GCCTAGAGCCTCCGCCGCTCTGG - Exonic
928964950 2:36966745-36966767 GCCTCGGGCCCGCCCCGCCCCGG + Intergenic
929758088 2:44784744-44784766 GCATGGGGCCCCCACCACCCTGG - Intergenic
933667053 2:84971838-84971860 GCCTAGCGCTCCCGCCGCCCCGG + Intronic
934188928 2:89767612-89767634 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
934247806 2:90323375-90323397 TCTTTGTGCCCCCGCCGCCGTGG - Intergenic
934248612 2:90326145-90326167 GCTTTTGCCCCCCGCCGCCGCGG - Intergenic
934251701 2:90360528-90360550 GCTTCTTGCCCCCGCCGCCCCGG - Intergenic
934257734 2:91442415-91442437 GCTTCTTGCCCCCGCCGCCCCGG + Intergenic
934257803 2:91442659-91442681 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
934260958 2:91477311-91477333 GCTTTTGCCCCCCGCCGCCGTGG + Intergenic
934261526 2:91479272-91479294 TCTTTGTGCCCCCGCCGCCCTGG + Intergenic
934307659 2:91840343-91840365 GCTTTTTGCCCCCGCCGCCCCGG + Intergenic
936222673 2:110616281-110616303 GGCTTGGGCCCCCCCCCCCAAGG + Intergenic
936279156 2:111122674-111122696 GCCTCTGGCCCGCGCTGCCCCGG - Intronic
937933053 2:127220186-127220208 GCCGCGGGGCCCCGCCGCCCAGG + Intergenic
938518374 2:132038613-132038635 GCTTTTTGCCCCCGCCGCCGTGG - Intergenic
938518398 2:132038718-132038740 GCTTTTCGCCCCCGCCGCCGCGG - Intergenic
946053119 2:216880488-216880510 GCCTTGGTTCCCTGCCTCCCGGG + Intergenic
946747568 2:222861209-222861231 GCCTCGGGCCCGCGCAGGCCTGG - Exonic
948411069 2:237761274-237761296 GCCTTGGCCACCCGCAGCGCTGG - Intronic
948420879 2:237859487-237859509 GCCCTGGGCGCCCCCGGCCCTGG + Intronic
948559516 2:238842278-238842300 GCCTTGGGCCCCCTACCCCCAGG + Intergenic
948942091 2:241201704-241201726 GCCTTGGGCCTGCCCCGCCTGGG - Intronic
948954002 2:241272914-241272936 CGCTGGGGTCCCCGCCGCCCCGG + Intronic
1172408208 20:34704560-34704582 GCCCTGCGCCCCCCGCGCCCGGG + Intronic
1173494317 20:43507811-43507833 GACCTGAGCCCTCGCCGCCCTGG - Intronic
1174369655 20:50078001-50078023 GCCATGGGGCCCCACTGCCCTGG - Intergenic
1175981176 20:62739441-62739463 GCCTGGGGCCCCCTGAGCCCAGG + Intronic
1176219544 20:63963491-63963513 GCCCTGGCCCCGCCCCGCCCAGG + Intronic
1176582842 21:8548543-8548565 GCTTTTTGCCCCCGCCGCCGAGG + Intergenic
1176582978 21:8549084-8549106 GCTTTTTGCCCCCGCCGCCACGG + Intergenic
1176582995 21:8549160-8549182 TCTTTTTGCCCCCGCCGCCCCGG + Intergenic
1176586715 21:8595108-8595130 GCTTTGCTCCCCCGCCGCCGCGG + Intergenic
1176743341 21:10627530-10627552 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1177941810 21:27421004-27421026 GCCATGGGCCGCCGCCCCGCGGG - Intergenic
1179783928 21:43719261-43719283 GCCTCGGCCCCGCGCCGCCGCGG + Exonic
1179882654 21:44300005-44300027 GCCTTCCGCCCGCCCCGCCCCGG - Intergenic
1179912027 21:44455634-44455656 GCCTCCGGCCGCCGCCGCGCAGG + Exonic
1179983324 21:44907577-44907599 GCCCTGGGCCCAGGCCTCCCAGG - Intronic
1180265673 22:10525590-10525612 GCTTTTTGCCCCCGCCGCCGAGG + Intergenic
1180265776 22:10525992-10526014 GCTTTTTGCCCCCGCCGCCACGG + Intergenic
1180265793 22:10526068-10526090 TCTTTTTGCCCCCGCCGCCCCGG + Intergenic
1180266031 22:10527037-10527059 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1180269587 22:10572241-10572263 GCTTTGCTCCCCCGCCGCCGCGG + Intergenic
1180281369 22:10699381-10699403 GCCTTTTGACCCCGCTGCCCTGG + Intergenic
1180281428 22:10699646-10699668 GCTTTCTGCCCCCGCCGCCGCGG + Intergenic
1180281464 22:10699784-10699806 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1180655679 22:17418868-17418890 GGCTTCGGCCCGCGCCTCCCGGG - Intronic
1180699679 22:17774490-17774512 TCCTTCGGCCCCCCACGCCCGGG + Intronic
1180839998 22:18954781-18954803 GGCTTGGGCCGCCGCCCTCCAGG + Intergenic
1180949377 22:19714383-19714405 GACCTGGGTCCCCGCCCCCCCGG + Intergenic
1181061902 22:20285699-20285721 GGCTTGGGCCGCCGCCCTCCAGG - Intergenic
1181329155 22:22075535-22075557 GCCTGGGGACCCCGGAGCCCTGG - Intergenic
1182355347 22:29720252-29720274 GCCTAGCGCCCCCGCGCCCCGGG - Exonic
1183427223 22:37746383-37746405 GCCTCCTGCTCCCGCCGCCCTGG + Intronic
1183689212 22:39378806-39378828 GGCCTGGGCCCCCGCTGGCCTGG - Intronic
1184101499 22:42343727-42343749 GCCGGGAGCCCGCGCCGCCCGGG - Intergenic
1184276278 22:43411421-43411443 GCTGTGGGCCCCTCCCGCCCGGG - Exonic
1184288419 22:43484824-43484846 GCCTTGGGCCCCCTCATCCATGG - Intronic
1184408390 22:44313019-44313041 GCCTAGGGCCGCCACCTCCCAGG + Intergenic
1184466063 22:44669323-44669345 GCCTGTGGCCCCCACCGCTCTGG + Intronic
1184523561 22:45009122-45009144 CCCTCGGGCCCCCGCGCCCCGGG - Intronic
1184876746 22:47281134-47281156 CCCTTGGGCCCTCGCCCCCCAGG + Intergenic
1185337848 22:50278716-50278738 AGCTTGGGCCCCAGCCACCCAGG + Intronic
1203238430 22_KI270732v1_random:30773-30795 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1203238648 22_KI270732v1_random:31647-31669 GCGTTTTGCCCCCGCTGCCCTGG + Intergenic
1203289197 22_KI270735v1_random:17585-17607 GCTTTTTGCCCCCGCCGCCTAGG - Intergenic
1203289296 22_KI270735v1_random:17947-17969 GCTTTTTGCCCCCGCCGCCACGG - Intergenic
1203325071 22_KI270738v1_random:5233-5255 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950750558 3:15124652-15124674 GCCTGGGGACCCCACCTCCCAGG + Intergenic
952241346 3:31533393-31533415 GACTTGGCCCCGCGCCGCCGCGG + Intronic
952418917 3:33114084-33114106 GCCGCGGCCCCCCGGCGCCCCGG - Exonic
953921890 3:46957660-46957682 GGCATGAGCCACCGCCGCCCTGG - Intronic
956468680 3:69542751-69542773 GCCCTCGGCCCCCGCCGCACGGG + Intergenic
958952510 3:100431741-100431763 GCCTTGGGCCCCCACAGTGCTGG - Intronic
961389199 3:126542415-126542437 TCCCTGGGCCGCCGCGGCCCCGG + Exonic
963133248 3:141877036-141877058 GCACTGCGCCGCCGCCGCCCGGG - Intronic
963236794 3:142963860-142963882 TCCTCGGGCCGCCGCAGCCCGGG + Intergenic
967055619 3:185826086-185826108 GGCTTTCGCCGCCGCCGCCCGGG - Intergenic
968651894 4:1763482-1763504 GCCTTGAGCCGCCCCGGCCCCGG + Intergenic
968788196 4:2640219-2640241 GCCTTGGGCACCCTCAGACCTGG - Intronic
968983725 4:3864520-3864542 GCCATGGGCATCCGCGGCCCTGG + Intergenic
968983971 4:3865448-3865470 GCCCTGTGCTCCTGCCGCCCCGG - Intergenic
969476904 4:7427063-7427085 GCCTTGGGCCACGGCCTCCCAGG + Intronic
969845947 4:9920297-9920319 GGCTTGGGCCCCAGACGCCCAGG - Intronic
977231137 4:94452240-94452262 CCCTGGGGTCCCCGCAGCCCGGG + Intronic
977257729 4:94758522-94758544 GCCCTGGGCCCCCGCCCCGCCGG - Intronic
977600450 4:98929063-98929085 GCCTTTGGCCCCCACCCCCACGG - Intronic
979487264 4:121283535-121283557 GCCTTGGGGCCCTGGGGCCCTGG - Intergenic
980075412 4:128288280-128288302 TCCTTGCGCTCCCCCCGCCCGGG + Exonic
982745879 4:159103651-159103673 GGCTTGCGCAGCCGCCGCCCAGG - Intergenic
985629742 5:1008399-1008421 GCGTTGGCCCCCCCCGGCCCCGG - Intergenic
985634702 5:1030283-1030305 GCCTTGGCCCCCCTCCGCAGTGG + Intronic
985746879 5:1652873-1652895 TCCTTGGGCCCCCACCAGCCTGG + Intergenic
985994904 5:3592441-3592463 GCCTTGGGTCCCCGGAGCACTGG + Intergenic
987050405 5:14143572-14143594 GCCGCCGCCCCCCGCCGCCCCGG + Intergenic
990553700 5:56909573-56909595 GCCTCGGGCCCGCCCCGGCCCGG - Exonic
996329354 5:122312059-122312081 GCTTCGGGCCGCGGCCGCCCAGG + Exonic
996717758 5:126601244-126601266 CCCCTCGGCCCCCGCAGCCCGGG - Intronic
1001125305 5:169013682-169013704 GCATGGGGCCCCGGCTGCCCTGG - Intronic
1002719080 5:181246986-181247008 GCCGGGGCCCCCCGCCTCCCCGG + Intronic
1004241329 6:13925002-13925024 GCCCTGGGCCGCCGCCGGCCAGG + Exonic
1006441367 6:34055717-34055739 CCCTAGGGCCCCCGCCCCCTAGG - Intronic
1007321924 6:41033912-41033934 GCCGGGGGCCCACGCCTCCCGGG - Exonic
1011195300 6:84774255-84774277 GCCTTGGGCGCCCGCCGCTTTGG + Intergenic
1012450576 6:99349571-99349593 GCTCTGGGGCCCCGCCGGCCAGG - Exonic
1017161424 6:151369301-151369323 TCCTTGGGCCCTCGCATCCCTGG - Intronic
1018812721 6:167309015-167309037 GCCTGGGGCCCCTTCCTCCCTGG - Intronic
1018986848 6:168644224-168644246 GCTTCGGGACCCCTCCGCCCTGG + Intronic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019111932 6:169724023-169724045 GCGCGGGCCCCCCGCCGCCCCGG + Exonic
1019402859 7:866503-866525 GCCTTTGCCCCCCGTCTCCCCGG + Intronic
1019471705 7:1224651-1224673 GCGTGGGGCCCGCGCCGGCCAGG - Intergenic
1019518252 7:1448974-1448996 GCCTTGAGCGCCCACCGGCCTGG - Intronic
1020567592 7:9817547-9817569 GCCTTTGGCCCCTGCTGCCCTGG + Intergenic
1022496274 7:30854987-30855009 GCCTGGGGCTCCCGATGCCCCGG - Intronic
1023435123 7:40134456-40134478 GCCGTGGTCCGCCCCCGCCCGGG + Exonic
1023765160 7:43504000-43504022 GCGTTGGGGCCCCGCCTACCTGG - Intronic
1023902257 7:44490727-44490749 TCGTTCGGCCCCCGCGGCCCCGG + Exonic
1023945144 7:44796976-44796998 GCCTTTGTCCGCCGCCGTCCCGG - Intronic
1025306977 7:57869115-57869137 GCCTTTTGCCCCCGCCGCCGCGG - Intergenic
1025320008 7:58086483-58086505 GCTTTCTGCCCCCGCCGCCGCGG + Intergenic
1025320139 7:58087048-58087070 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1025320163 7:58087130-58087152 GCTTTTTGCCCCCGCCGCCACGG + Intergenic
1025320204 7:58087318-58087340 GCTTTTTGCCCCCGCCGCCACGG + Intergenic
1025478376 7:60955794-60955816 GCTTTTGGCCCCCGGCGCCGCGG + Intergenic
1025481830 7:60992488-60992510 GCTTTTTGCCCCCGCCGCCGAGG + Intergenic
1025553464 7:62275988-62276010 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1025553518 7:62276189-62276211 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1025553558 7:62276365-62276387 GCTTTTTGCCCCCGCCGCCGCGG - Intergenic
1025553637 7:62276701-62276723 GCTTTTGGCCCCCGGCGCCGCGG - Intergenic
1025553706 7:62276993-62277015 GCTTTCTGCCCCCGCCGCCGTGG - Intergenic
1025561144 7:62376599-62376621 GCTTTTGGCCCCCGGCGCCGCGG + Intergenic
1025878581 7:65509985-65510007 GCTTTTTGCCCCCGCCGCCGTGG - Intergenic
1026013598 7:66655113-66655135 GACTTGATCCCCCGTCGCCCTGG + Intronic
1026568369 7:71508692-71508714 CCCTTTGGCCCCCACAGCCCGGG - Intronic
1026665158 7:72335771-72335793 GCCTTGGGCCACGTGCGCCCGGG - Intronic
1026806792 7:73433985-73434007 GCCTTCGGCCCGGGCCTCCCGGG + Exonic
1026909461 7:74083890-74083912 GCCCTCCGCCCCCGCCTCCCCGG + Intronic
1027220477 7:76210782-76210804 TCCTTGAGCCCCAGCAGCCCTGG + Intronic
1028121331 7:87059427-87059449 GCCGCGGGCGCTCGCCGCCCTGG - Exonic
1028567182 7:92246134-92246156 GCCTTGCGCGCTCGCAGCCCCGG - Intronic
1029707716 7:102284601-102284623 CCCATGGGCCCCCGCCTGCCAGG + Intergenic
1030345055 7:108423808-108423830 GGCTAGGGCCCCCACCTCCCAGG + Intronic
1032119354 7:129145105-129145127 GCGGGGGGACCCCGCCGCCCAGG - Intronic
1035640195 8:1178938-1178960 ACCTGGGGCCCACGCCGCCCTGG + Intergenic
1035783257 8:2244982-2245004 GCCCTGAGCCCCCGCTGCACAGG + Intergenic
1035808867 8:2474604-2474626 GCCCTGAGCCCCCGCTGCACAGG - Intergenic
1038429743 8:27490946-27490968 GCCTGGGGTCCCCGCCTTCCCGG + Exonic
1039895332 8:41713095-41713117 GCTTAGGGCCTCCGCAGCCCAGG - Intronic
1040077155 8:43247430-43247452 GCCTAGGGCCCCCTCCCACCTGG - Intergenic
1040603850 8:48910623-48910645 GCCTTGGGCCCCTGCAGACCAGG - Intergenic
1041304519 8:56446208-56446230 GCCCTGGGCCGCGGACGCCCAGG - Intronic
1041552431 8:59118090-59118112 TCCCCGGGCCCCCGCGGCCCTGG + Intronic
1049105506 8:140609942-140609964 GCCTTGGGCTCCCACCGTGCTGG - Intronic
1049217682 8:141415488-141415510 GCCCTGGGACCCTGCGGCCCCGG + Intronic
1049411903 8:142477312-142477334 GCCCTGGCCCCCCGCTGCCCTGG - Intronic
1049563519 8:143325296-143325318 GCACTGGACCCCCGCCACCCGGG - Intronic
1049714338 8:144082818-144082840 CCCTCGGGTCCCCGCCTCCCCGG - Intronic
1049801009 8:144517543-144517565 GGCCTGGGCCCCTGCCGACCCGG + Intronic
1050563351 9:6857106-6857128 GCCTTGGCCCCCCGAAGTCCTGG + Intronic
1051809288 9:21031586-21031608 CCCATGGGCCGCCGCCGCCAGGG + Exonic
1053014110 9:34652140-34652162 GCCCTGGGCCCCCGCAGCGGGGG - Intronic
1053397455 9:37787308-37787330 GCCTAGGGCTCCCGCCGCCTAGG - Intronic
1053945978 9:43311023-43311045 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1053946014 9:43311169-43311191 GCTTTTTGCCCCCGCCGCCATGG + Intergenic
1055090923 9:72364604-72364626 GCCATTGGCCCGCGGCGCCCCGG + Intronic
1056706109 9:88953867-88953889 GCCCTGGGACCCAGCTGCCCTGG - Intergenic
1057190272 9:93083347-93083369 GCCCTGGGCCCCGGGCTCCCAGG + Intronic
1058937208 9:109780282-109780304 GCCTCTGGCCCCCGCCCTCCCGG - Intronic
1059375345 9:113876453-113876475 GCCCCGGGCCCCGGCCCCCCGGG - Intronic
1059404807 9:114093081-114093103 GCCTAGGGCTCCCTCTGCCCTGG - Intronic
1060393671 9:123300606-123300628 GCCTTGGATCCCTGCCTCCCTGG - Intergenic
1061396361 9:130346004-130346026 CCCCTGGGCCCCCGCTGCCAGGG + Intronic
1062268744 9:135699360-135699382 GCCTTGGGCCCCCAACCCCTTGG + Intronic
1062415235 9:136445607-136445629 GCCAGGGCCCCCCGCAGCCCAGG - Intronic
1062628973 9:137455162-137455184 GGCCTGGGCCCCCTCGGCCCTGG - Intronic
1062718747 9:138023853-138023875 CGCTGGGGCCCGCGCCGCCCCGG - Intronic
1203589113 Un_KI270747v1:39603-39625 GCTTTTTGCCCCCGCCGCCGCGG + Intergenic
1203589149 Un_KI270747v1:39749-39771 GCTTTTTGCCCCCGCCGCCATGG + Intergenic
1203612867 Un_KI270749v1:26557-26579 GCTTTTTGCCCCCGCCGCCGAGG + Intergenic
1203612986 Un_KI270749v1:27055-27077 GCTTTTTGCCCCCGCCGCCACGG + Intergenic
1203613058 Un_KI270749v1:27351-27373 GCTTTCGGCCCGCGCCGCCGCGG + Intergenic
1203613229 Un_KI270749v1:28091-28113 GCTTTTTGCCCCCGCCGCCGTGG + Intergenic
1185747281 X:2583616-2583638 GCCTTGGACCCAAGGCGCCCAGG + Intergenic
1197709335 X:129654636-129654658 TCCTTGGGCCGCCGCGGCCCCGG + Exonic
1200310450 X:155071727-155071749 GCCTGTGGCCTCCGCAGCCCTGG - Intronic