ID: 914822112

View in Genome Browser
Species Human (GRCh38)
Location 1:151112629-151112651
Sequence CCAGCATAGTCGGCCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914822112_914822116 10 Left 914822112 1:151112629-151112651 CCGCACCTGGCCGACTATGCTGG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 914822116 1:151112662-151112684 CATGACAAGAGCAAGAACCCTGG 0: 1
1: 1
2: 0
3: 41
4: 1071
914822112_914822117 24 Left 914822112 1:151112629-151112651 CCGCACCTGGCCGACTATGCTGG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 914822117 1:151112676-151112698 GAACCCTGGCCAAATTTTTGTGG 0: 1
1: 1
2: 8
3: 13
4: 109
914822112_914822121 28 Left 914822112 1:151112629-151112651 CCGCACCTGGCCGACTATGCTGG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 914822121 1:151112680-151112702 CCTGGCCAAATTTTTGTGGGTGG 0: 1
1: 1
2: 5
3: 31
4: 191
914822112_914822118 25 Left 914822112 1:151112629-151112651 CCGCACCTGGCCGACTATGCTGG 0: 1
1: 0
2: 0
3: 22
4: 201
Right 914822118 1:151112677-151112699 AACCCTGGCCAAATTTTTGTGGG 0: 1
1: 2
2: 6
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914822112 Original CRISPR CCAGCATAGTCGGCCAGGTG CGG (reversed) Intronic
900211332 1:1457302-1457324 ACAGCATTTTTGGCCAGGTGTGG + Intronic
903056256 1:20638176-20638198 CCATCTTAGTGGGCCTGGTGAGG + Intronic
904919412 1:33995232-33995254 ACAGCAGAGTCGTCCAAGTGTGG - Intronic
905189729 1:36224331-36224353 GCAGCCAAGTCGGCCAGGAGAGG + Intergenic
907271987 1:53296603-53296625 CCAGGTTAGTAGGCCAGGGGCGG - Intronic
911531489 1:99048429-99048451 GAAGCATAGATGGCCAGGTGTGG - Intergenic
912925263 1:113907346-113907368 CAAGAAAAGTCTGCCAGGTGTGG - Intronic
914822112 1:151112629-151112651 CCAGCATAGTCGGCCAGGTGCGG - Intronic
915724583 1:158008347-158008369 CCAGCACTGTGGACCAGGTGAGG - Intronic
916055604 1:161067280-161067302 CCTGAACAATCGGCCAGGTGCGG + Intronic
916085771 1:161268001-161268023 ATAGTATTGTCGGCCAGGTGCGG - Intronic
917106292 1:171495912-171495934 CCAGCATAGTAGTTCTGGTGAGG + Intronic
917383511 1:174441442-174441464 CTAGCACAGTCAGCCAGGTGTGG + Intronic
920569190 1:207003431-207003453 CCAGGAGAGGCGGCAAGGTGGGG - Intergenic
920665251 1:207958946-207958968 CCAGCAGAGGCGCCCAGGTGGGG - Intergenic
921650276 1:217670661-217670683 CCACCATACCCGGCCAGGTGTGG - Intronic
922226394 1:223649531-223649553 CCAGCAGTGTCGGCAAGCTGGGG + Intronic
923887937 1:238179228-238179250 TCTGCATAGTTGGCCAGGCGTGG - Intergenic
924352620 1:243132407-243132429 CCAGTGTAGTTGGCAAGGTGAGG - Intronic
1064558572 10:16572737-16572759 AAAGCAAAGTAGGCCAGGTGAGG + Intergenic
1064735733 10:18379975-18379997 GTAGAATAGTGGGCCAGGTGTGG - Intronic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1070556763 10:77533972-77533994 GCAGCATAGTGGGCCAGCTTTGG - Intronic
1076113816 10:127881489-127881511 CCAGAGTAGAGGGCCAGGTGTGG - Intronic
1077062531 11:624165-624187 CCAGCAGAGGTGGCCGGGTGGGG + Intronic
1078772171 11:14360888-14360910 CCCGCATTGTCGCCCAGGCGTGG - Intronic
1078818951 11:14856562-14856584 CCTTCTTAGTTGGCCAGGTGTGG + Intronic
1081657164 11:44864923-44864945 CCAGCAGAGCCTGCCATGTGGGG + Intronic
1082008212 11:47432740-47432762 CCAGTATCGTTGGCCAGGTGCGG + Intergenic
1084829391 11:71757036-71757058 CTTGCAGAGTCGGCCAGGTGTGG - Intergenic
1086102175 11:83112492-83112514 ACAGCATTGGTGGCCAGGTGTGG + Intergenic
1087544284 11:99564376-99564398 ACAGAATTGTTGGCCAGGTGTGG - Intronic
1087989777 11:104734451-104734473 ACAACACAGTAGGCCAGGTGTGG + Intergenic
1088166944 11:106950442-106950464 CCAGAATAAGGGGCCAGGTGTGG - Intronic
1088348362 11:108856313-108856335 CCAGCATACTCGGGAGGGTGAGG + Intronic
1088532477 11:110826087-110826109 CCAGCATAGTTGTCCAGAAGAGG - Intergenic
1090867403 11:130713749-130713771 CCATCATAATTGTCCAGGTGAGG - Intronic
1091705118 12:2688532-2688554 CCAGCCTCGGCTGCCAGGTGTGG - Exonic
1092413849 12:8274653-8274675 CTTGCAGAGTCAGCCAGGTGTGG + Intergenic
1092516583 12:9221101-9221123 TTACCATAGTTGGCCAGGTGCGG + Intergenic
1092879529 12:12877276-12877298 CCAGCATTGTAAGCCAGGTGAGG - Intergenic
1093519618 12:20033130-20033152 AAAGCATAGACGGCCGGGTGTGG + Intergenic
1098791512 12:74830046-74830068 CTAGCAAAGTGGGCCGGGTGAGG - Intergenic
1100851505 12:98717156-98717178 AGAGCACAGTAGGCCAGGTGCGG - Intronic
1101125811 12:101632883-101632905 CCAGCAAAATTAGCCAGGTGTGG - Intronic
1104067227 12:125315982-125316004 CCAGAAAAGCCAGCCAGGTGAGG - Intronic
1104525778 12:129519897-129519919 CAAGCATTCTTGGCCAGGTGCGG - Intronic
1104880807 12:132069204-132069226 CCTGAATAGTCGGGCTGGTGGGG - Intronic
1108097485 13:46918875-46918897 ACAGCATGGTAGGCCAGGCGCGG - Intergenic
1109734233 13:66460474-66460496 CCAGAAAACTCGGCCAAGTGAGG + Intronic
1112186744 13:97135021-97135043 CAAACATACTTGGCCAGGTGTGG + Intergenic
1112552614 13:100435751-100435773 AAAGTATAGGCGGCCAGGTGTGG + Intronic
1113611787 13:111651781-111651803 CCAGCACATTCTTCCAGGTGAGG - Intronic
1113866134 13:113526427-113526449 TCAGCACAGTTGGCCAGGTGTGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1119723985 14:76910839-76910861 CCACCACACCCGGCCAGGTGAGG - Intergenic
1121230741 14:92355782-92355804 CCCTGAGAGTCGGCCAGGTGAGG + Intronic
1121795040 14:96727750-96727772 GCAGCATGGTTGGCCAGGCGTGG + Intergenic
1122976539 14:105173179-105173201 CCAGCGTAGCGGTCCAGGTGGGG - Exonic
1123438716 15:20274298-20274320 ACTGCACAGTAGGCCAGGTGTGG + Intergenic
1123717064 15:23040702-23040724 CCAGCACCTCCGGCCAGGTGGGG - Intergenic
1123717291 15:23041452-23041474 CCAGCACCTCCGGCCAGGTGGGG - Intergenic
1123717853 15:23043341-23043363 CCAGCACCTCCGGCCAGGTGGGG - Intergenic
1123718535 15:23045709-23045731 CCAGCACCTCCGGCCAGGTGGGG - Intergenic
1123719043 15:23047484-23047506 CCAGCACCTCCGGCCAGGTGGGG - Intergenic
1123719334 15:23048489-23048511 CCAGCACCTCCGGCCAGGTGGGG - Intergenic
1124792085 15:32737637-32737659 CCACCATACCCGGCCAGCTGTGG - Exonic
1125996371 15:44165126-44165148 CAACCAAAGTCGGCCAGGAGCGG + Intronic
1126366148 15:47896509-47896531 CCATCATAGACAGCCAGGTAGGG + Intergenic
1127675770 15:61237144-61237166 ACAGCATAGGAGGCCAGGTGCGG - Intergenic
1127919534 15:63482319-63482341 GTAGGATAGTTGGCCAGGTGCGG - Intergenic
1129542062 15:76358496-76358518 CCAGCATGGTGGGGCTGGTGAGG + Intronic
1129710318 15:77817431-77817453 CCAGCATAGAGTGCCAGGTTGGG + Intronic
1129834588 15:78694085-78694107 GCAGAATATTCAGCCAGGTGTGG - Intronic
1133426994 16:5701201-5701223 ACAGCATAGTCTGGCAGGGGAGG - Intergenic
1134684484 16:16149058-16149080 ACACCAAACTCGGCCAGGTGCGG + Exonic
1134811696 16:17172761-17172783 TGAACACAGTCGGCCAGGTGCGG - Intronic
1135512638 16:23100480-23100502 GCAGAATAGTGGGCCGGGTGTGG + Intronic
1135875725 16:26198349-26198371 GCAGCAGAGCCGGCCAGGTGAGG - Intergenic
1136571185 16:31097873-31097895 TCAGCAAATTAGGCCAGGTGTGG - Intergenic
1137374771 16:47943221-47943243 CCAGCAACGTGGGTCAGGTGGGG - Intergenic
1139453573 16:67052669-67052691 CCTGCACAGTTGGCCAGGTATGG + Intronic
1140762060 16:78118617-78118639 CCAGAAGAGTCGCCCAGTTGTGG + Intronic
1141373050 16:83505031-83505053 TCATCATAGTCAGCCAGCTGTGG + Intronic
1142673174 17:1496885-1496907 CCAACATAGTGGGGAAGGTGGGG + Intronic
1145933096 17:28699963-28699985 CCAGCCTAGGGGACCAGGTGAGG + Intronic
1146012576 17:29207592-29207614 CCAGAAAAGAAGGCCAGGTGTGG - Intergenic
1146203211 17:30879047-30879069 AGATCATAGTTGGCCAGGTGTGG + Intronic
1147496385 17:40920464-40920486 TCACCATATACGGCCAGGTGTGG + Intergenic
1148493879 17:48040361-48040383 CAAACATAATTGGCCAGGTGAGG - Intergenic
1151453238 17:74212037-74212059 ACAGCCTAGTAGGCGAGGTGAGG - Intergenic
1151742929 17:75996193-75996215 CCAGCCTGGACGGCCGGGTGTGG + Intronic
1152449576 17:80368721-80368743 CCAGTGGCGTCGGCCAGGTGTGG - Intronic
1152619676 17:81356502-81356524 CCAGCCTGGTCGGCCGGGCGCGG + Intergenic
1153200844 18:2646206-2646228 CCAGCACATTTAGCCAGGTGTGG + Intergenic
1153626534 18:7026705-7026727 TGATCATATTCGGCCAGGTGCGG + Intronic
1154241242 18:12656187-12656209 ACAGCAATGTCTGCCAGGTGCGG - Intronic
1157961023 18:52153422-52153444 CCTTCATTGTAGGCCAGGTGCGG - Intergenic
1159003849 18:62995657-62995679 ACAGCAAAGGGGGCCAGGTGCGG - Intergenic
1159704530 18:71670279-71670301 CCAGCATTTTCGGCCAGGCATGG - Intergenic
1160313697 18:77821071-77821093 GCAGCAGAGGCGGCCTGGTGGGG + Intergenic
1162770458 19:12946144-12946166 CCAGGAAAGTCGGGCAGGTCGGG - Intronic
1162862029 19:13513366-13513388 TCACCATAGTCGGCCGGGTGCGG + Intronic
1163584243 19:18155465-18155487 CCACCATGCTCGGCCAGCTGAGG - Exonic
1163855112 19:19695505-19695527 AAAGAATAGCCGGCCAGGTGCGG - Intergenic
1164910329 19:32005967-32005989 CCATAATAGTAGGCCAGGCGTGG + Intergenic
1165450774 19:35880961-35880983 CCAGCATAATGGGACATGTGAGG - Intergenic
1165509717 19:36258925-36258947 TCAGCATAATTGGGCAGGTGTGG + Intergenic
1166334881 19:42099710-42099732 CCAGCAGAGCCAGCCAGGTAAGG - Exonic
1166783522 19:45354393-45354415 CCAGCACAGATGGCCTGGTGGGG - Intronic
1167333506 19:48870695-48870717 CCAGCCTGGTCGGCCGGGTGCGG + Intergenic
1168702183 19:58447266-58447288 CCTGCATTGTCGGCCAGGCATGG - Intergenic
928056537 2:28061966-28061988 CCAGGATTGTTGGCCAGGTGCGG + Intronic
929033928 2:37672703-37672725 CCCGCATGGTCAGCCAGGGGAGG + Intronic
930652893 2:53979980-53980002 CAAACACATTCGGCCAGGTGTGG - Intronic
930772910 2:55145604-55145626 ACATCAGAGTTGGCCAGGTGCGG + Intergenic
930975734 2:57458333-57458355 CTCACAGAGTCGGCCAGGTGTGG - Intergenic
934714564 2:96536321-96536343 CCAACAAAGAAGGCCAGGTGAGG - Intergenic
934961454 2:98679114-98679136 CCAGCCTAGATGGCCGGGTGCGG + Intronic
935842415 2:107127999-107128021 CCATCATGGTTGGTCAGGTGTGG + Intergenic
935964797 2:108462851-108462873 TGAGCAAAGTCGGCCAGATGCGG - Intronic
937213078 2:120290277-120290299 TAAGCATAGTCCGCCGGGTGTGG - Intronic
939318972 2:140590673-140590695 CCAGCATAGTCAGGTTGGTGAGG - Intronic
940384805 2:153058139-153058161 CCAGGAATGGCGGCCAGGTGTGG + Intergenic
944253962 2:197605503-197605525 CCAACAAATTCGGCCAGGCGCGG - Intronic
944795120 2:203176432-203176454 ACAGTAAAGTAGGCCAGGTGTGG + Intronic
1168865163 20:1080041-1080063 CAAGCAGAGGTGGCCAGGTGGGG + Intergenic
1176013820 20:62917319-62917341 CCGACATTATCGGCCAGGTGAGG - Intronic
1180744677 22:18079240-18079262 CCAGCCTCGTCTGGCAGGTGAGG + Intronic
1181107295 22:20582772-20582794 CCAGCCTCGAGGGCCAGGTGGGG - Intronic
1181744288 22:24945096-24945118 CCAGCCTAGGCGGCCAGGCGCGG - Intronic
1182749763 22:32632190-32632212 CCAGCATACACTGCCAGGAGGGG + Intronic
1182998110 22:34832939-34832961 ACACCATAGCTGGCCAGGTGCGG - Intergenic
1183889324 22:40913280-40913302 CCAACATAGTTAGCCAGGTGTGG + Intronic
1184181512 22:42831007-42831029 ACAGAAGGGTCGGCCAGGTGTGG + Intronic
1184517899 22:44974121-44974143 CGTGCATATGCGGCCAGGTGCGG + Intronic
949291593 3:2472941-2472963 CTAGCATAGTCGGCAGGGCGTGG + Intronic
950489583 3:13295557-13295579 ACAGCAGGGTGGGCCAGGTGCGG - Intergenic
951220421 3:20063332-20063354 AAAGCACAGGCGGCCAGGTGTGG - Intronic
953277151 3:41513345-41513367 TCAGCAGAGTTGGCCAGGTGTGG + Intronic
953679586 3:45029382-45029404 CCAGCATAGGGTGCCATGTGAGG - Intronic
957024660 3:75167775-75167797 CCTACATATTGGGCCAGGTGTGG + Intergenic
958029263 3:88087363-88087385 CCAGGATTTTCAGCCAGGTGTGG - Intronic
960041585 3:113155460-113155482 CAAACATTTTCGGCCAGGTGCGG + Intergenic
960377182 3:116917701-116917723 AAAGAAAAGTCGGCCAGGTGTGG + Intronic
961850901 3:129817291-129817313 CCATAAGAGTCGGCCGGGTGTGG + Intronic
961891399 3:130133274-130133296 CTTGCAGAGTCGGCCAGGTGTGG + Intergenic
961985712 3:131131090-131131112 CCAACATTGTAGGCCAGGCGTGG - Intronic
963474995 3:145793652-145793674 CCATCAGATTGGGCCAGGTGTGG + Intergenic
965443247 3:168742850-168742872 CCAGTAGAGGCGGCAAGGTGGGG + Intergenic
966144956 3:176800654-176800676 ACAGCAGAATAGGCCAGGTGTGG + Intergenic
966444049 3:179980749-179980771 ACAGCAGAGTTGGCCAGGAGCGG + Intronic
966841495 3:184092658-184092680 TCAACGTAGTTGGCCAGGTGCGG + Intergenic
966851377 3:184167003-184167025 CCAGCAGACAGGGCCAGGTGGGG + Intronic
967184670 3:186934244-186934266 CCAGCAGGCTGGGCCAGGTGTGG + Intronic
968425137 4:518301-518323 CCAACAAAATTGGCCAGGTGTGG + Intronic
969002789 4:3995705-3995727 CTTGCAGAGTCAGCCAGGTGTGG + Intergenic
969384078 4:6831342-6831364 ACAACAAAATCGGCCAGGTGTGG - Intronic
969558314 4:7928907-7928929 CCAGCATGCCCAGCCAGGTGTGG + Intronic
969811143 4:9649107-9649129 CTTGCAGAGTCAGCCAGGTGTGG - Intergenic
971766352 4:30836940-30836962 CCAGCACAGTAGGACAGTTGAGG + Intronic
974860684 4:67517545-67517567 ACTGCATTGTCGGCCGGGTGCGG + Intronic
975119867 4:70716551-70716573 ACAGCATTGAAGGCCAGGTGCGG + Intronic
992113944 5:73521976-73521998 CCAGCATTGCTGGCCAGGTACGG + Intergenic
994666435 5:102711097-102711119 TCAGCATAGTCTGCTATGTGTGG - Intergenic
995530354 5:113086028-113086050 CCAGCACAGTCAGGCAAGTGGGG - Intronic
1000601637 5:163282632-163282654 AAAGCAAATTCGGCCAGGTGTGG + Intergenic
1000887012 5:166758950-166758972 TCAGCAAATGCGGCCAGGTGCGG + Intergenic
1001254951 5:170176357-170176379 CCAGCACAGTGGTTCAGGTGTGG + Intergenic
1002384446 5:178855801-178855823 CCACCATACCCGGCCAGGAGTGG + Intergenic
1002396645 5:178961523-178961545 ACAGCATTTTTGGCCAGGTGTGG + Intronic
1003091837 6:3110496-3110518 AGAGTATAGTGGGCCAGGTGCGG - Intronic
1006859904 6:37164674-37164696 CCAGCATTTTCGGCCGGGCGCGG + Intergenic
1007612636 6:43160406-43160428 GCAGTATTTTCGGCCAGGTGTGG - Intronic
1010436640 6:75838948-75838970 CCAACATGGTCAGCCAGGCGCGG - Intronic
1011107210 6:83795845-83795867 CCAGCAGAGTCTGCATGGTGAGG + Intergenic
1013238876 6:108224568-108224590 GCAGCTAAGTGGGCCAGGTGTGG - Intronic
1013529919 6:111009608-111009630 CTAGCATAGTTTGCTAGGTGTGG - Intronic
1013603739 6:111729181-111729203 TGGGCATACTCGGCCAGGTGTGG + Intronic
1015116585 6:129656351-129656373 GTAGCACAGTAGGCCAGGTGCGG + Intronic
1015970135 6:138735297-138735319 TCAGCATACTCGGCCGGGCGCGG + Intergenic
1016829974 6:148424510-148424532 CCACCATATCCGGCCAGATGGGG + Intronic
1018767279 6:166944486-166944508 CCAGCATGGTGGGGCAGGAGAGG - Intronic
1019858992 7:3639268-3639290 CCAGCGTGGCTGGCCAGGTGAGG + Intronic
1020009103 7:4798864-4798886 CCAGCATCCTCTGCCAGGTCTGG + Intronic
1026552688 7:71381486-71381508 CCTGCAGAGCAGGCCAGGTGCGG + Intronic
1029820793 7:103144715-103144737 CCTGCATCTTAGGCCAGGTGTGG + Intronic
1031890433 7:127287548-127287570 CCACCAGAGTCAGACAGGTGGGG + Intergenic
1032539578 7:132692125-132692147 CTAGCCTGGTAGGCCAGGTGCGG + Intronic
1036374439 8:8188225-8188247 CTTGCAGAGTCGGCCAGGTGTGG - Intergenic
1036603200 8:10282480-10282502 CCAGCATAGTCGACATTGTGGGG + Intronic
1036876464 8:12477410-12477432 CTTGCAGAGTCGGCCAGGTGTGG + Intergenic
1038883266 8:31638078-31638100 GCAGCATAGTTGGGCAGGTCTGG - Intergenic
1039372309 8:36997867-36997889 CAAGCATATGAGGCCAGGTGCGG + Intergenic
1039432719 8:37537989-37538011 CAATCATGGTCTGCCAGGTGCGG + Intergenic
1040569307 8:48593632-48593654 CCAGCACAGTGGGCTGGGTGTGG + Intergenic
1041183860 8:55277601-55277623 CCACCATATTAGGTCAGGTGTGG + Intronic
1041288503 8:56284905-56284927 CACCCATAGTCGGCCAGGTGTGG + Intergenic
1041766263 8:61421298-61421320 GCAGCAAAGTGGGCCTGGTGAGG + Intronic
1047593247 8:126349646-126349668 AAAGAATAGTCGGCCAGGCGCGG + Intergenic
1049082491 8:140454346-140454368 GCAGCATAATCAGCCGGGTGTGG + Intronic
1049211017 8:141386414-141386436 CCAGCAGAGCCGGCCTGGAGCGG - Intergenic
1050304468 9:4294216-4294238 ACAGAATAATGGGCCAGGTGCGG + Intronic
1052307663 9:27029455-27029477 ACAATATAGTCGGCCGGGTGTGG + Intronic
1055432416 9:76257609-76257631 CCAGCACAGTGGGCCAGCCGGGG + Intronic
1056681646 9:88724637-88724659 CCAGCAGAGACGGCCAGGGGAGG + Intergenic
1057741899 9:97719349-97719371 CCTGCACAATCTGCCAGGTGTGG - Intergenic
1058846488 9:108965149-108965171 ACAGTGTAGTAGGCCAGGTGTGG - Intronic
1061396642 9:130347215-130347237 CCTGCATGGCCAGCCAGGTGTGG + Intronic
1187399652 X:18948181-18948203 CAAGCATAATGGGCCAGGAGTGG + Intronic
1187428701 X:19202576-19202598 CCAGCATTGTGGGGCAGGGGTGG - Intergenic
1187679491 X:21752805-21752827 ACAGCATAGTAGGCCGGGCGCGG - Intronic
1187892171 X:23946572-23946594 ACAGCATGGTTGGCCAGGCGCGG + Intergenic
1189052078 X:37656394-37656416 CCAGCATAGTCTCCCACATGCGG + Intronic
1192243960 X:69358127-69358149 CCAACATAGTGAGCCAGGAGTGG - Intergenic
1192846587 X:74912204-74912226 CCAGCATGCTTAGCCAGGTGGGG - Intronic
1195931696 X:110084211-110084233 CAAGAATAGTTGGCCAGGTGTGG + Intronic
1196321480 X:114345465-114345487 TCAGAATAGTCTCCCAGGTGTGG - Intergenic
1196989547 X:121313001-121313023 CTTGCATATTAGGCCAGGTGCGG + Intergenic
1197050882 X:122058072-122058094 CCAGGCTAGCCTGCCAGGTGGGG + Intergenic
1198461875 X:136871154-136871176 CAACCATAGGCGGCCAGGTGCGG + Intronic
1199682717 X:150238778-150238800 CCAGCACAGCCAGCCAGTTGGGG + Intergenic
1199733941 X:150666807-150666829 CCAGCCTAGTCGCCCTGGTCAGG + Intronic
1199978629 X:152908801-152908823 TCAGCAGAGTCAGCCAGGAGTGG - Intergenic