ID: 914824949

View in Genome Browser
Species Human (GRCh38)
Location 1:151133367-151133389
Sequence CGCCGCGCCCACCGACGTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914824949_914824957 20 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824957 1:151133410-151133432 GGCCAGAGACTGAGGCGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 259
914824949_914824954 -1 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423
914824949_914824955 12 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824955 1:151133402-151133424 GACCAGGAGGCCAGAGACTGAGG 0: 1
1: 1
2: 8
3: 45
4: 474
914824949_914824953 -4 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824953 1:151133386-151133408 GGCGACAAGCACAGGAGACCAGG 0: 1
1: 0
2: 0
3: 4
4: 138
914824949_914824958 21 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824958 1:151133411-151133433 GCCAGAGACTGAGGCGCCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914824949 Original CRISPR CGCCGCGCCCACCGACGTCG GGG (reversed) Exonic