ID: 914824949

View in Genome Browser
Species Human (GRCh38)
Location 1:151133367-151133389
Sequence CGCCGCGCCCACCGACGTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914824949_914824957 20 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824957 1:151133410-151133432 GGCCAGAGACTGAGGCGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 259
914824949_914824955 12 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824955 1:151133402-151133424 GACCAGGAGGCCAGAGACTGAGG 0: 1
1: 1
2: 8
3: 45
4: 474
914824949_914824953 -4 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824953 1:151133386-151133408 GGCGACAAGCACAGGAGACCAGG 0: 1
1: 0
2: 0
3: 4
4: 138
914824949_914824954 -1 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423
914824949_914824958 21 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824958 1:151133411-151133433 GCCAGAGACTGAGGCGCCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914824949 Original CRISPR CGCCGCGCCCACCGACGTCG GGG (reversed) Exonic
900349669 1:2228499-2228521 CGCCGCGCCCGCCGCCGCCCGGG - Intergenic
908555651 1:65254507-65254529 CGCCGCGCCCTCCCCCGCCGCGG - Intronic
910647035 1:89525060-89525082 AGCCGCGCCGACCGAGGTGGTGG + Intronic
914824949 1:151133367-151133389 CGCCGCGCCCACCGACGTCGGGG - Exonic
922250469 1:223845453-223845475 CTCTGCGCCCACAGCCGTCGTGG - Intronic
1064645374 10:17454334-17454356 CGCCGCCGCCACCGCCGCCGTGG + Intergenic
1077059444 11:611406-611428 CCCCCCGCCCACCGACACCGTGG + Intronic
1077253814 11:1571964-1571986 CGCCGGGCCCATGGACGGCGCGG - Intergenic
1077404699 11:2377776-2377798 CACCGCGCCCCCCGACATTGGGG + Intronic
1097155111 12:57006569-57006591 CGCAGCGCCCCCCGCCGTCCCGG + Intergenic
1101692158 12:107092955-107092977 CGCCGCGCCCCCCGGCATGGGGG - Exonic
1103954256 12:124567597-124567619 CGCCGCCGCCACCGCCGCCGCGG - Intergenic
1106112078 13:26786081-26786103 CTCCACCCCCACCGACGTCGGGG - Intergenic
1111396065 13:87671792-87671814 CGCCGAGCCCGCCGCCGCCGCGG - Intergenic
1112290645 13:98142517-98142539 CCCCGCGCCCGCCCACGTCCTGG - Intergenic
1112290907 13:98143401-98143423 CGCCGCGCCCTCGGCCGCCGGGG + Intronic
1124952546 15:34337388-34337410 CGCCACCCCCACCGACCTCTCGG - Exonic
1130295950 15:82647324-82647346 TGCCGCGACCGCCGCCGTCGTGG + Intronic
1131108680 15:89751012-89751034 CGCCGCGCCTACCTACGGAGGGG + Exonic
1131268435 15:90932417-90932439 CGACGCGCCCACCGATGGGGTGG + Exonic
1132815961 16:1826700-1826722 CGCCGCACCCACCGAGGCCTCGG + Exonic
1135040644 16:19114572-19114594 GGCCGAGCCCGCCGACGGCGTGG + Exonic
1141959056 16:87392478-87392500 CGCCGCACCCGCCGCCCTCGCGG - Intronic
1144547994 17:16215440-16215462 CGCCGCGCCGAACGAGGTCCCGG - Exonic
1145183662 17:20775465-20775487 CGCCGCGGCCACCGCTGCCGAGG + Intergenic
1146057867 17:29589920-29589942 CGCTGGGCCCACGGACGGCGAGG + Intronic
1152686213 17:81695043-81695065 CGCAGCCCCCACCAACGTGGTGG + Exonic
1153565705 18:6415037-6415059 CGCTGGGCCCGCCGAGGTCGGGG + Intronic
1160679528 19:406457-406479 CTCCGCGCCCACCCTCGTCAGGG + Exonic
1162470872 19:10871484-10871506 CGCCGCCGCCACCGTCGCCGCGG - Intergenic
929758776 2:44789118-44789140 AGCTGCACCCACCCACGTCGTGG + Intergenic
932699856 2:73985079-73985101 CGCCGCCGCCACCACCGTCGCGG - Intergenic
942278737 2:174340970-174340992 CCCCGCCCCCACCGACCTCCAGG - Intergenic
946921430 2:224585161-224585183 CGCCGCCCCCGCCGCCGCCGCGG - Exonic
947641343 2:231709317-231709339 CGCCGGGACGGCCGACGTCGCGG - Intronic
1170578779 20:17682546-17682568 CGCCCCGCCCACCGAGGGGGGGG + Intergenic
1172028919 20:31968180-31968202 CGCCGCTCCATCCGACTTCGCGG - Exonic
1172118522 20:32584896-32584918 CGCCGCGCCCGGCGCCCTCGGGG + Intronic
1173221823 20:41137683-41137705 CGGCGCGCCCTCGGACGCCGAGG + Exonic
1176173795 20:63708258-63708280 CGCCGCGCCCGCCGCCTTCCAGG - Intronic
1178437615 21:32573672-32573694 AGCCGTGCCCACCGACTTAGAGG - Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181147490 22:20859020-20859042 CGCCCCGCCCGCCGACCCCGCGG - Exonic
1185055267 22:48575868-48575890 CGCCGCCGCCACCGCCGCCGCGG - Intronic
964748323 3:160032290-160032312 CGCCGCGCCCAGCCAGGTCTTGG + Intergenic
968616346 4:1579311-1579333 CGCTGCGCCCACGGCCCTCGTGG + Intergenic
969344723 4:6563614-6563636 CGCCGCGCCCGCCGCCGACCAGG - Intergenic
970333324 4:15004763-15004785 CGCCGCGCCTCCCCGCGTCGGGG - Intronic
978072539 4:104491322-104491344 CGCCGCCGCCACCGCCGGCGGGG + Exonic
985652098 5:1112037-1112059 CGCCGCTCCCGCCGACGCCACGG + Intergenic
998152635 5:139765825-139765847 CGCCGCCACCGCCGCCGTCGTGG + Intergenic
1002527067 5:179820796-179820818 CGCCCCCGCCACCGTCGTCGCGG - Exonic
1018613075 6:165662247-165662269 CGCCGCTGCCACCGCCGCCGCGG + Intronic
1018668124 6:166158389-166158411 GGCCGCGGCCACAGACATCGTGG - Exonic
1018795419 6:167181604-167181626 AGCCGCGCCCACTGACTTAGAGG + Intronic
1018820904 6:167373459-167373481 AGCCGCGCCCACTGACTTAGAGG - Intronic
1029640255 7:101815897-101815919 CGCCGCCGCCACCGAGGACGCGG - Intronic
1043428494 8:80171667-80171689 CGCCGCCCGCGCCGACGTGGCGG - Intronic
1055757475 9:79571747-79571769 CGCCCCGCCCACCCCCGTTGCGG - Intergenic
1056475396 9:86947234-86947256 CGCCGCCGCCACCGCCGCCGCGG + Intergenic
1060634587 9:125189870-125189892 CGCCGGGCGTACCGACGTAGCGG - Exonic
1201895871 Y:18992712-18992734 CGCGCCGCGCACCGACGTAGGGG - Intergenic