ID: 914824950

View in Genome Browser
Species Human (GRCh38)
Location 1:151133368-151133390
Sequence TCGCCGCGCCCACCGACGTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 31}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914824950_914824955 11 Left 914824950 1:151133368-151133390 CCCGACGTCGGTGGGCGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 31
Right 914824955 1:151133402-151133424 GACCAGGAGGCCAGAGACTGAGG 0: 1
1: 1
2: 8
3: 45
4: 474
914824950_914824954 -2 Left 914824950 1:151133368-151133390 CCCGACGTCGGTGGGCGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 31
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423
914824950_914824958 20 Left 914824950 1:151133368-151133390 CCCGACGTCGGTGGGCGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 31
Right 914824958 1:151133411-151133433 GCCAGAGACTGAGGCGCCCAGGG 0: 1
1: 0
2: 2
3: 18
4: 232
914824950_914824957 19 Left 914824950 1:151133368-151133390 CCCGACGTCGGTGGGCGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 31
Right 914824957 1:151133410-151133432 GGCCAGAGACTGAGGCGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 259
914824950_914824953 -5 Left 914824950 1:151133368-151133390 CCCGACGTCGGTGGGCGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 31
Right 914824953 1:151133386-151133408 GGCGACAAGCACAGGAGACCAGG 0: 1
1: 0
2: 0
3: 4
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914824950 Original CRISPR TCGCCGCGCCCACCGACGTC GGG (reversed) Exonic