ID: 914824954

View in Genome Browser
Species Human (GRCh38)
Location 1:151133389-151133411
Sequence GACAAGCACAGGAGACCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 423}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914824950_914824954 -2 Left 914824950 1:151133368-151133390 CCCGACGTCGGTGGGCGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 31
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423
914824951_914824954 -3 Left 914824951 1:151133369-151133391 CCGACGTCGGTGGGCGCGGCGAC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423
914824942_914824954 20 Left 914824942 1:151133346-151133368 CCCGGAGTCTCGATGTCCTTGCC 0: 1
1: 0
2: 2
3: 7
4: 106
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423
914824949_914824954 -1 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423
914824941_914824954 21 Left 914824941 1:151133345-151133367 CCCCGGAGTCTCGATGTCCTTGC 0: 1
1: 0
2: 0
3: 1
4: 57
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423
914824947_914824954 4 Left 914824947 1:151133362-151133384 CCTTGCCCCGACGTCGGTGGGCG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423
914824943_914824954 19 Left 914824943 1:151133347-151133369 CCGGAGTCTCGATGTCCTTGCCC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 914824954 1:151133389-151133411 GACAAGCACAGGAGACCAGGAGG 0: 1
1: 0
2: 1
3: 28
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914824954 Original CRISPR GACAAGCACAGGAGACCAGG AGG Exonic