ID: 914824955

View in Genome Browser
Species Human (GRCh38)
Location 1:151133402-151133424
Sequence GACCAGGAGGCCAGAGACTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 1, 2: 8, 3: 45, 4: 474}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914824949_914824955 12 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824955 1:151133402-151133424 GACCAGGAGGCCAGAGACTGAGG 0: 1
1: 1
2: 8
3: 45
4: 474
914824947_914824955 17 Left 914824947 1:151133362-151133384 CCTTGCCCCGACGTCGGTGGGCG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 914824955 1:151133402-151133424 GACCAGGAGGCCAGAGACTGAGG 0: 1
1: 1
2: 8
3: 45
4: 474
914824951_914824955 10 Left 914824951 1:151133369-151133391 CCGACGTCGGTGGGCGCGGCGAC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 914824955 1:151133402-151133424 GACCAGGAGGCCAGAGACTGAGG 0: 1
1: 1
2: 8
3: 45
4: 474
914824950_914824955 11 Left 914824950 1:151133368-151133390 CCCGACGTCGGTGGGCGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 31
Right 914824955 1:151133402-151133424 GACCAGGAGGCCAGAGACTGAGG 0: 1
1: 1
2: 8
3: 45
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914824955 Original CRISPR GACCAGGAGGCCAGAGACTG AGG Exonic