ID: 914824957

View in Genome Browser
Species Human (GRCh38)
Location 1:151133410-151133432
Sequence GGCCAGAGACTGAGGCGCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914824951_914824957 18 Left 914824951 1:151133369-151133391 CCGACGTCGGTGGGCGCGGCGAC 0: 1
1: 0
2: 1
3: 3
4: 27
Right 914824957 1:151133410-151133432 GGCCAGAGACTGAGGCGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 259
914824950_914824957 19 Left 914824950 1:151133368-151133390 CCCGACGTCGGTGGGCGCGGCGA 0: 1
1: 0
2: 1
3: 2
4: 31
Right 914824957 1:151133410-151133432 GGCCAGAGACTGAGGCGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 259
914824949_914824957 20 Left 914824949 1:151133367-151133389 CCCCGACGTCGGTGGGCGCGGCG 0: 1
1: 0
2: 0
3: 1
4: 60
Right 914824957 1:151133410-151133432 GGCCAGAGACTGAGGCGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 259
914824947_914824957 25 Left 914824947 1:151133362-151133384 CCTTGCCCCGACGTCGGTGGGCG 0: 1
1: 0
2: 1
3: 1
4: 31
Right 914824957 1:151133410-151133432 GGCCAGAGACTGAGGCGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914824957 Original CRISPR GGCCAGAGACTGAGGCGCCC AGG Exonic