ID: 914825403

View in Genome Browser
Species Human (GRCh38)
Location 1:151135544-151135566
Sequence CCTGCAAAGCAGGGAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 587}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914825403_914825419 9 Left 914825403 1:151135544-151135566 CCATCCCCTCCCTGCTTTGCAGG 0: 1
1: 0
2: 4
3: 84
4: 587
Right 914825419 1:151135576-151135598 CTCCAAAGGCCTCACCGGGCAGG 0: 1
1: 0
2: 0
3: 10
4: 132
914825403_914825415 4 Left 914825403 1:151135544-151135566 CCATCCCCTCCCTGCTTTGCAGG 0: 1
1: 0
2: 4
3: 84
4: 587
Right 914825415 1:151135571-151135593 CTGCCCTCCAAAGGCCTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 200
914825403_914825422 17 Left 914825403 1:151135544-151135566 CCATCCCCTCCCTGCTTTGCAGG 0: 1
1: 0
2: 4
3: 84
4: 587
Right 914825422 1:151135584-151135606 GCCTCACCGGGCAGGGCTGTAGG 0: 1
1: 0
2: 5
3: 25
4: 233
914825403_914825416 5 Left 914825403 1:151135544-151135566 CCATCCCCTCCCTGCTTTGCAGG 0: 1
1: 0
2: 4
3: 84
4: 587
Right 914825416 1:151135572-151135594 TGCCCTCCAAAGGCCTCACCGGG 0: 1
1: 0
2: 1
3: 18
4: 240
914825403_914825413 -5 Left 914825403 1:151135544-151135566 CCATCCCCTCCCTGCTTTGCAGG 0: 1
1: 0
2: 4
3: 84
4: 587
Right 914825413 1:151135562-151135584 GCAGGGGGCCTGCCCTCCAAAGG 0: 1
1: 0
2: 1
3: 27
4: 235
914825403_914825420 10 Left 914825403 1:151135544-151135566 CCATCCCCTCCCTGCTTTGCAGG 0: 1
1: 0
2: 4
3: 84
4: 587
Right 914825420 1:151135577-151135599 TCCAAAGGCCTCACCGGGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914825403 Original CRISPR CCTGCAAAGCAGGGAGGGGA TGG (reversed) Intronic
900189606 1:1347834-1347856 CAGGCAAAGCAGAGAGGGCAGGG - Intronic
900226034 1:1534115-1534137 CCGGCAAGGCAGGGGTGGGAGGG - Exonic
900285297 1:1896225-1896247 CCTGCAAGGGAGGCAGGGGCTGG - Intergenic
900347292 1:2215800-2215822 CCTGGAAAGCACTGCGGGGATGG + Intergenic
900555421 1:3278008-3278030 TCTGAAAAGGAGGGAGGGCAGGG + Intronic
900793509 1:4694106-4694128 CCCGTAAAGCTGGGAGGGGCGGG + Intronic
901004735 1:6166257-6166279 GCTGCAAAGCAGGTGGGGGTCGG + Intronic
901071287 1:6520021-6520043 CCTGCCAGGCAGAGAGGGGCTGG + Intronic
901102859 1:6732788-6732810 CCCACAAAGCAAGAAGGGGAAGG + Intergenic
901462180 1:9398413-9398435 GCTGGAAAGGAGGGAGGGGTGGG - Intergenic
901469697 1:9447827-9447849 CATCCACAGCAGGGACGGGATGG - Intergenic
901506505 1:9689166-9689188 CCTGCAAAGCAAGGGAGGGCTGG - Intronic
901646898 1:10721707-10721729 CCTGCAAACCAGGAAGTGGACGG + Intronic
901741353 1:11344084-11344106 CCTGGAAAGCAGGGATGTGGTGG + Intergenic
901758152 1:11453904-11453926 CCAGGACAGCAGAGAGGGGAAGG - Intergenic
901879482 1:12185506-12185528 GCAGCAAACCGGGGAGGGGAGGG + Intronic
902368283 1:15991005-15991027 CCAGGAGTGCAGGGAGGGGAAGG + Intergenic
902799064 1:18818319-18818341 CATGCAAATCAGAGAAGGGAAGG + Intergenic
902903095 1:19533788-19533810 CCAGCAAGGCAGGAAGTGGAAGG + Intergenic
903082266 1:20820251-20820273 TCCACAAAGCAGGCAGGGGACGG + Intronic
903653599 1:24935452-24935474 CCTGCAGAACAGGGTGGGGATGG - Intronic
903809679 1:26028481-26028503 CCTGCAACCCAGCCAGGGGAGGG - Intronic
903953658 1:27011016-27011038 CAGGCATGGCAGGGAGGGGAAGG - Intronic
904026171 1:27504967-27504989 TCTGCAAAACAGGGAAGGGAGGG - Intergenic
904067146 1:27762101-27762123 CATGAAAAGCAGGGAGTGTATGG - Intronic
904235852 1:29116543-29116565 CATGCAGAGCAGGGAGGTAATGG + Intronic
904415732 1:30360081-30360103 ACAGCCACGCAGGGAGGGGAGGG + Intergenic
904575708 1:31503917-31503939 CCTGCAGGGCAGGGAAGGGCAGG - Intergenic
905170351 1:36106390-36106412 CCTGCACAGGAGAGTGGGGATGG - Intronic
905238238 1:36565203-36565225 GCTGCAGACCAGGGAGGGGTTGG + Intergenic
905329954 1:37187542-37187564 CCTGCACAGCAGTGAGTGGGTGG - Intergenic
905747679 1:40433170-40433192 CCTGCCAGGCAGGGATGGGTTGG - Intergenic
907443143 1:54490580-54490602 CCTGCCAGGAGGGGAGGGGAGGG - Intergenic
907570212 1:55476435-55476457 CTTGCAGACCTGGGAGGGGAAGG + Intergenic
908075236 1:60510395-60510417 GAAGCAAAACAGGGAGGGGAAGG - Intergenic
908101954 1:60800331-60800353 CCAGCAAGGCGAGGAGGGGAAGG + Intergenic
908171882 1:61513052-61513074 CCTGCCAAGAAGGGAAGTGAGGG + Intergenic
908743291 1:67350686-67350708 CCTAAATGGCAGGGAGGGGAAGG + Intronic
909911101 1:81258920-81258942 GCTGCAGAGTAGTGAGGGGAGGG - Intergenic
911172974 1:94789669-94789691 TCTGGAAAGGATGGAGGGGAGGG + Intergenic
912239115 1:107886377-107886399 GCTGCGTAGCATGGAGGGGAAGG - Intronic
912297207 1:108481534-108481556 CCTGCTATGCAGGGAGGGAAAGG + Intergenic
912738534 1:112172354-112172376 CCATCAAAGCATAGAGGGGAGGG - Intergenic
912905703 1:113704489-113704511 TCTGCAAAGCTGGTAGGGGTAGG - Intronic
913154077 1:116077312-116077334 CCTGAAAACTAGGGAGGGGTTGG - Intergenic
913667408 1:121060880-121060902 CATGCAAATCAGGGACGTGATGG + Intergenic
913963321 1:143355200-143355222 CCTGCAAAGCGGGGAAGAGAAGG - Intergenic
914057677 1:144180786-144180808 CCTGCAAAGCGGGGAAGAGAAGG - Intergenic
914121469 1:144785580-144785602 CCTGCAAAGCGGGGAAGAGAAGG + Intergenic
914802547 1:150972057-150972079 CCTGCAAAACAGGGGGTGGGGGG + Intronic
914808169 1:151006929-151006951 CTTGCTAAGTAGGGAGGAGAAGG + Intronic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
914957726 1:152179525-152179547 CCTCTAAAGTAGGGATGGGAAGG + Intergenic
915361605 1:155289369-155289391 CCTGAAAAGGAGGGGAGGGATGG - Exonic
915728178 1:158033526-158033548 GCTGCAAAGCAAGGAAGAGAAGG - Intronic
915943219 1:160132130-160132152 TCTGCAAAGCAGTGAGGGAGAGG + Intronic
916559808 1:165924986-165925008 CCTGGAAGGCAGGGAGGGCTTGG - Intergenic
917027115 1:170656500-170656522 CCTGCAAAGGAATGAGGGGTTGG + Intergenic
919879904 1:201894639-201894661 CCTGCTAGGCTGGGAGGGAATGG + Intergenic
920098002 1:203499064-203499086 TCTGGGAAGCTGGGAGGGGAAGG + Intronic
920415424 1:205796198-205796220 GCTGAAAAGCAGGGAGGGATTGG - Intronic
921358154 1:214305804-214305826 CCTGAAATGTAGGGATGGGAAGG + Intronic
922121483 1:222673791-222673813 CCTGCAAACTAGGTAGGGCACGG + Intronic
922204063 1:223431288-223431310 CCTGAGAACCAGGGAAGGGAAGG - Intergenic
922252798 1:223864878-223864900 GCTGCAGAGCAGCGAGGGCAAGG + Intergenic
922336072 1:224618814-224618836 CTTGCAGAGCAGAGAAGGGAGGG - Intronic
922606953 1:226895402-226895424 CCTGCAGGACATGGAGGGGAGGG - Exonic
922865859 1:228861077-228861099 CCTGCAAAGCAGGGACTGTGCGG + Intergenic
923049438 1:230380517-230380539 CTTGGAGAGCCGGGAGGGGAAGG - Intronic
924865556 1:247975591-247975613 CCTGAGAAACAGGGAGGTGATGG + Intronic
1062768432 10:82204-82226 CCAGCCCAGCAGGGAGGGGAGGG + Intergenic
1062959909 10:1565027-1565049 CCTGCACGGGAGGGAGGGGAAGG - Intronic
1063015319 10:2070877-2070899 CCTGCTGAGCAGGGCTGGGAGGG + Intergenic
1063030041 10:2225458-2225480 CCGGCAAGGCAGGGAGGAGTCGG + Intergenic
1063220855 10:3966395-3966417 CCTTCCAAACAGGGAGAGGAAGG - Intergenic
1063695029 10:8326563-8326585 CCTCTAAAGCGGGGTGGGGAGGG - Intergenic
1064104356 10:12488903-12488925 GCTGCACAGCAGGAGGGGGACGG - Intronic
1065628253 10:27653244-27653266 CCTGCATGGCAGGGAGTGGGTGG - Intergenic
1065917550 10:30365826-30365848 CCTGGAGAGCAGGGAGGTCATGG - Intronic
1066289565 10:34001315-34001337 ACTGCAAACAAGAGAGGGGAAGG - Intergenic
1067068950 10:43118878-43118900 CCTGCCATGCAGGGCGGGGCTGG - Intronic
1067526570 10:47042930-47042952 GCTGCAGAGCAGGGAGAGAAGGG + Intergenic
1069754035 10:70762301-70762323 CCAGCATCCCAGGGAGGGGAGGG - Exonic
1070419070 10:76218428-76218450 CCTGCAATGCAGGGAGTGATTGG + Intronic
1071435380 10:85644102-85644124 CCTGCAAAGAGGGAAGGGGTGGG + Intronic
1072168539 10:92837975-92837997 CCTGCAAAACAAGGTGGGCAGGG - Intronic
1072252314 10:93591305-93591327 CCCGGAATGCAGGGAGGGGCTGG - Intronic
1072614092 10:97038072-97038094 AGAGCAGAGCAGGGAGGGGAAGG - Intronic
1072720047 10:97774816-97774838 CCTGCCAAGCCTGGAGGGGTGGG - Intergenic
1073491496 10:103855755-103855777 CCTGGCAGGCAGGGAAGGGAAGG + Intergenic
1073803334 10:107068141-107068163 CCTCCAAACTAGGGAGGGGAAGG - Intronic
1074079082 10:110153226-110153248 CCTGCCAGGGAGGGAGGGCAGGG - Intergenic
1074306068 10:112279690-112279712 GTTGCAAAGCAGAGAGGGGATGG + Intergenic
1075003113 10:118812306-118812328 CCTGCAGAGCAGTGGGGTGAGGG + Intergenic
1075906949 10:126089794-126089816 CCTGCAAAGCATGGAAGGAAGGG - Intronic
1075935470 10:126337365-126337387 ACTTCAAAGCAGGAAGAGGAAGG - Intronic
1076513037 10:131025685-131025707 CCCTCAAAGCAGAGAGGGCACGG + Intergenic
1076722669 10:132399496-132399518 CTTGCAAAGCAGAGGGGAGAGGG + Intronic
1076723962 10:132404846-132404868 CCTTCGAAGTAGGGAGGGTACGG - Exonic
1076855987 10:133115869-133115891 TCTGGAAGGCAGGGAGGGGTTGG - Intronic
1077008628 11:370349-370371 CCTGCTAAGCGGGCAGGGGGTGG - Intronic
1077419355 11:2443298-2443320 CCTGCTGAGGTGGGAGGGGAAGG + Intergenic
1077464408 11:2726788-2726810 TCTGCCAAGCAGTGAGGAGATGG - Intronic
1077845810 11:6023577-6023599 CCTGCAAACCAGGGAGTGAGGGG + Intergenic
1078741554 11:14071456-14071478 TCTGGAAAGCTGGGAGGGAATGG - Intronic
1079004185 11:16780861-16780883 TCAGCACAGCAGGGAGGTGAGGG + Intronic
1079303281 11:19298461-19298483 CCTAGAAGGAAGGGAGGGGAAGG - Intergenic
1080436199 11:32247265-32247287 CCAGCAAAGGAGGGAGGGGTGGG - Intergenic
1081753836 11:45530958-45530980 CCTACTATACAGGGAGGGGAGGG - Intergenic
1081813566 11:45926618-45926640 CCACCAAAGCAGAGAGGGGCAGG - Intronic
1081967334 11:47177779-47177801 CCTGGGACCCAGGGAGGGGAGGG - Exonic
1083282336 11:61634772-61634794 CCAGCTGGGCAGGGAGGGGAGGG + Intergenic
1083519633 11:63296316-63296338 ACTGCAATGCAGCGAGGGGGTGG - Intronic
1083934327 11:65862475-65862497 CCTGTGAAGGAGGGAGCGGAGGG - Exonic
1084072406 11:66744880-66744902 CCTGCGCGGCATGGAGGGGACGG + Intronic
1084694953 11:70747309-70747331 CCTGGGCAGCAGGGATGGGAGGG + Intronic
1084696844 11:70760925-70760947 GCTTCAATGCAGGGAGGTGATGG + Intronic
1084784605 11:71434896-71434918 ACTGCAGAGCAGGCAGGGGAGGG + Exonic
1084938628 11:72600705-72600727 CCTGGAAGGCAGGGTGGGGGTGG - Intronic
1085025484 11:73234134-73234156 CCTGCAGGGAAGGGAGGGGTGGG - Exonic
1085036036 11:73300643-73300665 AAGGCAGAGCAGGGAGGGGAAGG + Intergenic
1085255207 11:75168776-75168798 CCAGAAAAAGAGGGAGGGGAGGG - Intronic
1085743984 11:79099283-79099305 CCTGCAAAGGAGAGAGGGTCTGG - Intronic
1086859288 11:91906291-91906313 CCAGCTAAGAAGGGAGAGGAAGG - Intergenic
1087252135 11:95914391-95914413 CCTGCAGGGCAGGGAGTGGTGGG + Intronic
1088640703 11:111870678-111870700 CCTTAAAAGCAGGAAGTGGAAGG - Intronic
1088749303 11:112830529-112830551 CCTCCAAAGCAAGGAGGAGGAGG - Intergenic
1089256464 11:117196849-117196871 CCTGGAAAGAAGGAAGGGAAGGG - Exonic
1089272065 11:117308149-117308171 CCTGCCAAGCAGGGAAGGAGAGG + Intronic
1089332396 11:117699148-117699170 CCAGCAATGAAGGGAGGAGAAGG + Intronic
1089878220 11:121746548-121746570 CCTGCAAAGCTGTGGGGGTAGGG + Intergenic
1090242577 11:125194460-125194482 CCTGTGAAGCAGGGTGGGGGTGG - Intronic
1090444186 11:126749156-126749178 ACTCCAAAGCAGGGAGGACAAGG - Intronic
1090455470 11:126844955-126844977 TGTGCACAGCAGGGTGGGGAAGG - Intronic
1090468319 11:126955472-126955494 CTTGCCATGCAGGGAAGGGAGGG - Intronic
1090973468 11:131662479-131662501 CTTTCAAAGCAGGGTGGGGGTGG - Intronic
1090981109 11:131723256-131723278 CCTTCAAAGCAGGGTTGGAAAGG + Intronic
1091214381 11:133891649-133891671 CATGCAAAGAAGCCAGGGGATGG + Intergenic
1091381738 12:66576-66598 CCTGCAGGGCAGAGAGGAGAGGG - Intergenic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1091588968 12:1831754-1831776 GATGCAGAGCAGGGAGGGGAGGG - Intronic
1091693580 12:2612974-2612996 CTACCAAAGGAGGGAGGGGAAGG - Intronic
1091836683 12:3591071-3591093 GCTGGAAAGGAGGGAGAGGAAGG + Intronic
1091917230 12:4278450-4278472 CCTGCAAGTCAGGGTTGGGAGGG + Intronic
1092019149 12:5185935-5185957 ACTGCCAGGCAGGGAGGGGACGG - Intergenic
1092195630 12:6548188-6548210 CCAGCCAAGGAGGGATGGGATGG + Intronic
1092280204 12:7092463-7092485 CATGCACAGCAGGGAGGGGAGGG + Intronic
1093184110 12:16000097-16000119 CATGCTGAGCAGGGAAGGGAAGG + Intronic
1093888639 12:24492460-24492482 ATTGCAAAGAAGGGAGGGTAAGG + Intergenic
1094391118 12:29951185-29951207 CCTGCAAAGAAGGGAGAGGTGGG - Intergenic
1094480170 12:30875166-30875188 CCTCCCAGGCAGGGAGGGGAGGG + Intergenic
1096033447 12:48442065-48442087 CCTGAAGAACAGGGAGGTGAAGG - Intergenic
1096101188 12:48971422-48971444 CTGGGAAAGCAGGGAGGGCAGGG - Intronic
1096256262 12:50063961-50063983 CCAGCTAGGCAGGGAGTGGAGGG + Intronic
1096526209 12:52211836-52211858 CCTGCAGAGGGAGGAGGGGATGG + Intergenic
1096774024 12:53953319-53953341 CCTGCAGAGGAGAGAGGGGAGGG + Intergenic
1097905144 12:64911971-64911993 GCTGCAAAGCAGGAAAGGGCTGG + Intergenic
1099196306 12:79620505-79620527 TCTACAAAGCAGGGAAGGTAAGG + Intronic
1100598709 12:96093699-96093721 GTTGAAAAGCGGGGAGGGGAGGG + Intergenic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102455610 12:113069247-113069269 CTAGCAAAGCAGGAAGTGGAGGG - Intronic
1103056516 12:117825510-117825532 ACTGCAAAGGAGAGAAGGGATGG - Intronic
1103327695 12:120132380-120132402 CCTGTGAGGCAGGGAGGGGCGGG + Intronic
1103444383 12:120984657-120984679 TCAGCAAAGCAGGGAGATGAAGG + Intronic
1103607630 12:122098886-122098908 CCTGCTGAGCAGGGAGGCAAAGG - Intronic
1106048636 13:26169199-26169221 TCTGTGAAGCAGGGAGGGGATGG - Intronic
1106409510 13:29501434-29501456 CCTGCAGCACTGGGAGGGGAAGG + Intronic
1106488536 13:30194400-30194422 CCAGCAAAGGTGGGAGAGGAAGG - Intergenic
1106513274 13:30429940-30429962 CCTGCAGTGCAGGGTGGGGTGGG - Intergenic
1106801017 13:33255739-33255761 CCTCCAGGGCAGGGAGGGGACGG + Intronic
1107266994 13:38567492-38567514 ACTGCACAACAGGGAGGGTATGG - Intergenic
1108064253 13:46561766-46561788 CCTACAGAACAGGGAGGAGAAGG - Intronic
1109416403 13:62046569-62046591 CCTGCAGAGCAGGGGAGGGTGGG + Intergenic
1110148404 13:72221598-72221620 CCTGCCAAGGAGGGAGAGAAAGG - Intergenic
1110630224 13:77698305-77698327 GCTGCAAAGCAGGGAGGGCGCGG - Intronic
1110872064 13:80463843-80463865 CCTGCCAAGAAGGGAGTGGGAGG + Intergenic
1112922296 13:104628811-104628833 CCTACAAAGCAGAGGGGGGGGGG - Intergenic
1113264930 13:108606826-108606848 CCATGAAAGCAGGGAGTGGAAGG + Intronic
1113347944 13:109499061-109499083 CCTGCACAGGATGGATGGGACGG - Intergenic
1113457475 13:110458749-110458771 CCTGCAGAGGAGGGAGAGGAGGG - Exonic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1114204754 14:20558499-20558521 GAGGAAAAGCAGGGAGGGGAGGG - Intronic
1114265233 14:21069754-21069776 CCTGCCTAGCAGAGAGCGGAGGG - Intronic
1114459069 14:22875505-22875527 ATTGCAAGGCAGGGAGGGGACGG - Exonic
1114630443 14:24156158-24156180 CCTGGAAAGCAAGGCGGGAATGG + Intronic
1114649857 14:24277713-24277735 CCAGCAAAGCATGGTGGGCAAGG - Intergenic
1115799565 14:36977278-36977300 CCTTCATAGCAGGAAGGGGAAGG - Intronic
1116992577 14:51291896-51291918 CCAGCCAAGCAAGGAGGGAAGGG - Intergenic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1118413155 14:65503639-65503661 CCAGGAAGGCAGGGAGGGAAGGG - Intronic
1118742256 14:68748109-68748131 TATTTAAAGCAGGGAGGGGAAGG - Intergenic
1118925346 14:70186765-70186787 CCTGCAATGCATGAAGGGGCAGG + Intronic
1119554512 14:75542838-75542860 TCTGCAAGCCAGGGAGGGGGAGG + Intronic
1121406974 14:93725096-93725118 CCTGGAAGGCAGGGTGAGGAGGG + Intronic
1121948987 14:98152675-98152697 CCAGCTAGGCAGGGAAGGGAAGG - Intergenic
1122540530 14:102495538-102495560 TCTGCAAAGCAGGGCTGGGTGGG + Intronic
1122751535 14:103937463-103937485 CTGGGAAAGAAGGGAGGGGAGGG - Intronic
1122799682 14:104223367-104223389 CCTGCAGAGGCGGGAGGGCAGGG - Intergenic
1122855010 14:104555890-104555912 GCTGCACAGCAGGCAGGTGAGGG - Intronic
1122950515 14:105042060-105042082 CCTGCAACACTGGGAGGGGGCGG - Intergenic
1122996749 14:105269225-105269247 CCGGCAAAGCAGGGGTGGGCTGG + Intronic
1123056831 14:105574802-105574824 CCTGCCAAGCAGGAAGGCGGAGG - Intergenic
1123081379 14:105696983-105697005 CCTGCCAAGCAGGAAGGCGGAGG + Intergenic
1123412501 15:20072231-20072253 ACTGCAAAGGCGGGAGAGGAGGG + Intergenic
1123473507 15:20571356-20571378 CCTGGAGAGCAGGGAGGCCATGG + Intergenic
1123521843 15:21079344-21079366 ACTGCAAAGGCGGGAGAGGAGGG + Intergenic
1123644502 15:22428997-22429019 CCTGGAGAGCAGGGAGGCCATGG - Intergenic
1123665818 15:22608905-22608927 CCTGGAGAGCAGGGAGGCCATGG - Intergenic
1123733805 15:23166367-23166389 CCTGGAGAGCAGGGAGGCCATGG + Intergenic
1123751942 15:23363748-23363770 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1123989618 15:25673755-25673777 CATTTAAAGAAGGGAGGGGATGG + Intergenic
1124118121 15:26866861-26866883 CTTGTAGAGCAGGGATGGGAGGG - Exonic
1124284308 15:28387672-28387694 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1124298389 15:28523942-28523964 CCTGGAGAGCAGGGAGGCCATGG - Exonic
1124489324 15:30144183-30144205 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1124537953 15:30561113-30561135 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1124564375 15:30800610-30800632 CCTGGAGAGCAGGGAGGCCATGG + Intergenic
1124693822 15:31847001-31847023 CCTGCTAGGCAGGGCAGGGAAGG + Intronic
1124754205 15:32394144-32394166 CCTGGAGAGCAGGGAGGCCATGG - Exonic
1124777934 15:32602590-32602612 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1124787391 15:32694245-32694267 CATGCAAAGGTTGGAGGGGAGGG - Intronic
1124911133 15:33921916-33921938 CCTTAAGAGCAGGGAGCGGAGGG + Intronic
1124940529 15:34213506-34213528 CCTGCAAAGGAAGGTAGGGAAGG - Intergenic
1126400518 15:48264208-48264230 CCTGTAAAGGAGGAAAGGGATGG + Intronic
1126870117 15:52978494-52978516 CATGCAAAGAAGGGATGGGAAGG - Intergenic
1127703479 15:61524921-61524943 CTTTCAAAGGAGGGAGGGAAGGG + Intergenic
1127805237 15:62513215-62513237 CCTGCAAAGCAGTAAGGAGGGGG - Intronic
1128546090 15:68568821-68568843 CCTGCCAGCCAGGAAGGGGAAGG + Intergenic
1129185330 15:73902680-73902702 CATGCTAAGCATGGAGCGGATGG - Intergenic
1129289307 15:74551515-74551537 CCTGGAAACCTGGAAGGGGATGG - Intronic
1129296483 15:74602989-74603011 CCTGCACAGCTTGGAGGGGAAGG - Intronic
1129413497 15:75362260-75362282 CCAGCAAAGCCGGGAGGGCGGGG + Intronic
1129513651 15:76143141-76143163 CCTGAGAAGGCGGGAGGGGAAGG - Intronic
1129704500 15:77786582-77786604 CATGCAGAGGAGGGAGGGGATGG + Intronic
1129746315 15:78023912-78023934 CCTGAAAACAAGGGAGGGGAAGG + Intronic
1130542220 15:84828454-84828476 GCTGCACAGCTGGGAGGGGTGGG - Intronic
1131084728 15:89566721-89566743 CCTGCAAGGCAAGAAGGTGAAGG - Intergenic
1131298033 15:91169430-91169452 CCTACAAAACAGGGTGGGGGTGG - Intronic
1131377720 15:91939470-91939492 CCTGCAAAGCTGGGAGGTGGAGG - Intronic
1131464693 15:92645825-92645847 CCTGCCACCCAGGTAGGGGAGGG + Intronic
1131511443 15:93051474-93051496 CCCCAAAAGCAGGTAGGGGAGGG + Intronic
1132457302 16:31227-31249 ACAGCCCAGCAGGGAGGGGAGGG + Intergenic
1132841112 16:1978958-1978980 CCTGGCCAGCAGGGATGGGAGGG - Exonic
1132863391 16:2082333-2082355 CCTGCAGAGGAGAGAGGGCAGGG - Intronic
1133218854 16:4309722-4309744 CCTGCATTCCAGGGCGGGGACGG - Intergenic
1133269230 16:4602454-4602476 TCTGCTGAGCTGGGAGGGGAGGG + Intergenic
1134121115 16:11586048-11586070 CCTGCAAACCAGAGCGGGGAGGG + Intronic
1134211974 16:12285195-12285217 CCTGCTAAACAGTGAGTGGAAGG - Intronic
1134216355 16:12319814-12319836 ACTTCAAAGCAGGAAGGGGGAGG + Intronic
1134559454 16:15195607-15195629 CCTTCACAGCAGGGAAGTGATGG - Intergenic
1136145436 16:28313688-28313710 GCTGCAGGGCGGGGAGGGGAGGG + Intronic
1137251811 16:46746840-46746862 GCTGCAGGGCAGGGAGGGGAAGG + Intronic
1137546670 16:49409399-49409421 GCTGCCAAGCAGGGAGTTGAAGG - Intergenic
1138503676 16:57465086-57465108 CCTGTACAGCAAGGAGGGGAAGG + Intronic
1138505261 16:57475297-57475319 CATGCACAGCAGGGAGGGTAAGG + Intronic
1138573146 16:57888940-57888962 CCTGCAAAGGATGGAGCAGAGGG - Intronic
1138715866 16:59021505-59021527 CCTCCCCAGCAGGGAGGGGCTGG + Intergenic
1140214510 16:72996610-72996632 CCTACAAGGCGGGGAGGGGCTGG + Intronic
1140476331 16:75240996-75241018 ACTGCAAAGGCGGGAGAGGAGGG + Intronic
1140506556 16:75477291-75477313 CCTGCAAAGCAAGCAGGGCAAGG - Exonic
1140746440 16:77984619-77984641 GATGCAAAGTAGGGAGGGAATGG + Intergenic
1141711535 16:85702274-85702296 GCTGCTAAGCAGGCAGTGGAGGG + Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1142029278 16:87830519-87830541 CCAGCACAGCAGGAGGGGGAGGG + Exonic
1142122702 16:88394915-88394937 CCTGGACAGCAGGGAGGGATCGG - Intergenic
1142574712 17:898906-898928 CCTGCAAAGAAGGAAGGACAGGG + Intronic
1142967749 17:3591744-3591766 GCTGCAAGGCAGGGCAGGGAGGG - Intronic
1143066900 17:4256707-4256729 CTTGCAGAACAGAGAGGGGAAGG - Intronic
1143117496 17:4589089-4589111 CCGGCAAAGGGAGGAGGGGAAGG - Intronic
1144004563 17:11088556-11088578 CCTGCAGAGCAGGTAATGGATGG + Intergenic
1144047327 17:11465697-11465719 ACCACAAAGCAGGGAGTGGATGG - Intronic
1144521161 17:15953100-15953122 CCTGCAGAGCTGGGAGTGCAGGG + Intronic
1144708464 17:17385120-17385142 TCTCCAAAGCAGGGAGGGTGAGG - Intergenic
1144740579 17:17580072-17580094 CCTGCCCTGAAGGGAGGGGAAGG + Intronic
1144968821 17:19094321-19094343 GCTGCAAAGCAGGGTGGGCGTGG + Intronic
1144979095 17:19157745-19157767 GCTGCAAAGCAGGGTGGGCGTGG - Intronic
1144989127 17:19220487-19220509 GCTGCAAAGCAGGGTGGGCGTGG + Intronic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1145786740 17:27598556-27598578 CACTCAATGCAGGGAGGGGAGGG - Intronic
1147538457 17:41335715-41335737 TCTGCACAGCAGGGAGGGGTGGG + Intergenic
1147587083 17:41658901-41658923 CTTGCAGGGCAGGGAGGGGCTGG + Intergenic
1148246107 17:46031940-46031962 CCTTCAAAAGGGGGAGGGGATGG + Intronic
1148317299 17:46713320-46713342 CTTCCAAAACAGGGAAGGGAAGG + Intronic
1148553597 17:48564746-48564768 CCGGCAGAGAAGGGAGGGGAAGG + Intronic
1150108911 17:62480394-62480416 TCTTCCAAGCAGGGAGGGGCAGG - Intronic
1150286528 17:63957518-63957540 GCTGCCAAGCAGGGAGGGCAAGG + Exonic
1151194328 17:72420964-72420986 CCTGCAGGGCCGGGAGGAGAGGG + Intergenic
1151824133 17:76514166-76514188 CCTGCTAGCCAGGCAGGGGAAGG + Intergenic
1151926463 17:77201210-77201232 CCTGCAAGGCAGGGTATGGAAGG - Intronic
1151945429 17:77317197-77317219 CCTGCAGAGCTGTGAGAGGATGG - Intronic
1152168224 17:78724696-78724718 ACTGGAAAGGAGGGAGGGTATGG - Intronic
1152209173 17:78994045-78994067 CCTGGAGAGCAGGGAGGGGCGGG - Intronic
1152267799 17:79306472-79306494 GGAACAAAGCAGGGAGGGGAGGG - Intronic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152431121 17:80248724-80248746 CCTGAACAGCAGGGAGTGGGGGG - Intronic
1152730576 17:81967721-81967743 CCTCCAAAGCTGGGGGAGGAAGG + Intergenic
1152739603 17:82013154-82013176 CCTGCAGCGGAGGCAGGGGAGGG + Intronic
1152744530 17:82032689-82032711 ACTGCAGAGCAGTGAGGGCAGGG - Exonic
1152961314 18:82029-82051 CCAGCCCTGCAGGGAGGGGAGGG + Intergenic
1156501888 18:37565324-37565346 CCGGCAAAGTTGGGAGGGAAAGG + Intronic
1157130364 18:45001718-45001740 CCTGCAAAGCAAAAAGGAGAAGG - Intronic
1157281871 18:46351567-46351589 CCTGCTTAGCAGGAAGGGGCTGG - Intronic
1157888148 18:51388671-51388693 CAACCACAGCAGGGAGGGGAAGG + Intergenic
1158624122 18:59057018-59057040 CCTGCAAAGAAGAGAGGATACGG - Intergenic
1160583647 18:79901228-79901250 CCTGCAGCCCAGGGTGGGGAGGG - Intergenic
1160748782 19:723944-723966 CCCACAGACCAGGGAGGGGAGGG + Intronic
1160800290 19:964494-964516 CCTGCAGAAGAGGGAGGGGGTGG + Intronic
1160980165 19:1812922-1812944 CCTGCACCGCAGGGCGGGGTTGG + Intergenic
1161009636 19:1954081-1954103 CCCACAAATCAGGGAGAGGAGGG - Intronic
1161849755 19:6732225-6732247 CCTCCGGAGCAGGGCGGGGAGGG - Intronic
1161982805 19:7638704-7638726 TCTGCAGGGAAGGGAGGGGAGGG - Exonic
1162000946 19:7744816-7744838 CTTGGAAAGAAGGGAGGAGAAGG - Intronic
1162439995 19:10686943-10686965 CCAGCACAGCAGGGAGGAGGGGG + Intronic
1162595352 19:11624786-11624808 CCGGCAAAGGAGGGAGGGAGCGG - Intergenic
1162772912 19:12960761-12960783 CCTGTCAAGAAAGGAGGGGAGGG - Intergenic
1163020385 19:14478227-14478249 ACTGGGAACCAGGGAGGGGATGG + Exonic
1163638278 19:18447633-18447655 TCTGGAAATCAGGGAGGGGAGGG + Intronic
1163723716 19:18910784-18910806 CCTGCACAGCAGTGGGGGGCTGG - Intronic
1163819377 19:19487397-19487419 CCTGCAAGGCAGGGGGAGGGAGG + Intronic
1164654203 19:29909086-29909108 CCTGCACAGCAGGGGTGGTAAGG - Intergenic
1164707689 19:30332487-30332509 GCTGCAAAGGATGGAGGGAAGGG - Intronic
1164732484 19:30516863-30516885 CTTGAAAGGCAGGGAGGAGAAGG + Intronic
1165233127 19:34399879-34399901 TCTGCCAAGAAGGGAAGGGAAGG - Exonic
1165476397 19:36033119-36033141 CCTGCAAACCAGGCCGGTGAGGG + Intronic
1165784199 19:38451651-38451673 TCTGCAGAGCAGGGAGGAGGGGG + Intronic
1166159611 19:40942039-40942061 CGTCCACAGTAGGGAGGGGAGGG - Intergenic
1166400194 19:42473065-42473087 CCTGCAAAGGTTGGAGAGGAAGG + Intergenic
1166964561 19:46520863-46520885 CCTGCCCAGAATGGAGGGGAGGG + Intronic
1167134783 19:47609793-47609815 CCTGGAAAGCTGGGGAGGGATGG + Intronic
1168056077 19:53866133-53866155 CCTACGGAGCAGGGAGGGGCCGG - Intergenic
1168406200 19:56111876-56111898 TCTGCAAAGCAGGGACGGGAAGG + Intronic
1202697160 1_KI270712v1_random:133459-133481 CCTGCAAAGCGGGGAAGAGAAGG - Intergenic
925189123 2:1868770-1868792 CCTGCACCGCAGGGAGGAGGGGG - Intronic
926000942 2:9331924-9331946 CTTGCAGAGGAGGGAGGGGCGGG + Intronic
926055766 2:9773080-9773102 GCTGCAGAGCACGGTGGGGAGGG - Intergenic
926225491 2:10964284-10964306 CCAGCAGAGCGGGGAGTGGATGG - Intergenic
926297974 2:11582183-11582205 CCTGAACAGCAGGGAGATGAGGG + Intronic
926794437 2:16607298-16607320 CCTGTCAGGCAGGGAGGGGCGGG + Intronic
926982619 2:18587216-18587238 TGTTCAAATCAGGGAGGGGAGGG - Intronic
927019643 2:19003240-19003262 CCTGGAAAGTAGGCAGGGGTTGG - Intergenic
927487467 2:23498461-23498483 CCTGCTTGGCAGGGAGGGCAGGG - Intronic
927519196 2:23689020-23689042 CCTGCAGAGCTGTGAGGGGGTGG - Intronic
927615317 2:24588084-24588106 TCTCCAAAGAGGGGAGGGGAGGG - Intronic
928423307 2:31156847-31156869 GCTGGAATGCAGGGAGGGAATGG + Intergenic
928796929 2:35034215-35034237 CCTGCAACGTAGTGAGTGGAGGG + Intergenic
929035467 2:37687429-37687451 TCTGCAAAGGAGGGAGTTGAAGG + Intronic
929567622 2:42999645-42999667 TCTGTAAAGCTGGGAGGGGCAGG - Intergenic
930005475 2:46892779-46892801 CCTGCTGCCCAGGGAGGGGAGGG - Intergenic
930053995 2:47238151-47238173 CCTGCTGAGAAGGGAGGTGAGGG - Intergenic
930603729 2:53470966-53470988 ACTGTAGAGCAGGGAGGGCATGG - Intergenic
931193528 2:60028309-60028331 CCTGGAAAGCAGGGCTGGAAGGG - Intergenic
931378273 2:61727667-61727689 CCTTAGAAGCAGGGAGGGAATGG + Intergenic
933214321 2:79610693-79610715 CCTGTGAAGAAGGGATGGGATGG + Intronic
933633269 2:84680522-84680544 CCTGCCAAGCAGAGAGGGCTGGG + Intronic
933948732 2:87310090-87310112 ACTGGAAAGCAGGCAGGGAATGG - Intergenic
934278326 2:91590475-91590497 CCTGCAAAGCGGGGAAGAGAAGG - Intergenic
935089710 2:99883134-99883156 CATGCAACCCAGGGAAGGGATGG + Intronic
935152550 2:100450697-100450719 CAAGCAGAGAAGGGAGGGGAGGG - Intergenic
935301743 2:101698451-101698473 CCTGGAGAGGAAGGAGGGGAGGG - Exonic
936026115 2:109032308-109032330 CCTGCAAAACAAAGAGGGGGTGG - Intergenic
936163492 2:110101928-110101950 GCTGTAAAGCAGCAAGGGGAAGG + Intronic
936331466 2:111551506-111551528 ACTGGAAAGCAGGCAGGGAATGG + Intergenic
937089639 2:119197244-119197266 TTTGCAAACCAGGGTGGGGAGGG - Intergenic
937150939 2:119685210-119685232 CCTGCAAAGGGGGGGGGGGGCGG - Intronic
937245508 2:120489700-120489722 CCTGGACAGCTGGGAAGGGAGGG + Intergenic
937798060 2:126049086-126049108 CCTGCAAGTCAGTAAGGGGATGG + Intergenic
938066051 2:128282623-128282645 CCTGCAAGGCAGGAAGTGGCAGG + Intronic
938096209 2:128465770-128465792 CCTGCCCTGCAGGGTGGGGAAGG + Intergenic
938258331 2:129877711-129877733 AGGGCGAAGCAGGGAGGGGAGGG + Intergenic
938376330 2:130809243-130809265 CCTACATAGGAGGGAAGGGAAGG - Intergenic
938882232 2:135602798-135602820 GCTGCAAAGTAGGGAGAGGGTGG - Intronic
939650489 2:144756106-144756128 CGAGGAAAGAAGGGAGGGGAGGG - Intergenic
939878513 2:147604072-147604094 CGTGCATTGCAGGGAGGAGAGGG + Intergenic
940185368 2:150978566-150978588 CTTGCAAAGCAGGGTTGTGATGG + Intergenic
940599116 2:155835141-155835163 CCTGCAAAAGAGGAAGGGGAGGG + Intergenic
941254345 2:163209363-163209385 CTTGCAAAGCAGGTTGGAGAAGG - Intergenic
942129064 2:172859982-172860004 CATGGAAAACAGGGAGGGGTGGG + Intronic
946306735 2:218860521-218860543 TAGGCAAAGCAGGGCGGGGAAGG - Intronic
946762412 2:223007647-223007669 CCTGAAAAGCTGGTAGGGGCTGG - Intergenic
947083396 2:226423680-226423702 CCTGCAAGACAGAGTGGGGAGGG + Intergenic
947499040 2:230659032-230659054 ACTGGAAACCAGGGAGGGCATGG - Intergenic
947938477 2:234027420-234027442 CCTGACAAGAATGGAGGGGATGG - Intergenic
948427800 2:237898876-237898898 TTTCCAAAGCAGGGAGGGGCTGG - Intronic
948615355 2:239194989-239195011 CCTGAGGAGCAGGGAGGCGAGGG + Intronic
948805502 2:240452144-240452166 CCTGGGCTGCAGGGAGGGGAGGG + Intronic
948939781 2:241190028-241190050 CCAGCAAGGCCGGGTGGGGATGG - Intronic
948943419 2:241207552-241207574 CCTGCAAGGCATGGAGCGGAGGG - Exonic
1169000270 20:2163349-2163371 CCAACAAAGCAGGGACTGGAGGG - Intronic
1169346960 20:4836222-4836244 CCAGGCAAGCAGGGAGGAGATGG + Intergenic
1170792134 20:19517105-19517127 CCTGAAAGGCAGGGAGGGCTGGG - Intronic
1170850471 20:19999495-19999517 CCTGCTCAGCAGTGAAGGGAAGG - Intronic
1171953479 20:31441473-31441495 CCTGCATAACATGGAGGGGTGGG + Intronic
1172057113 20:32161873-32161895 CCTGCAGAGTAAGGAGAGGATGG + Intronic
1172216268 20:33237957-33237979 CCTGCAAAGTGGGGAGGGACAGG + Intronic
1172223915 20:33291621-33291643 CCTGCTAAGAAGGGAAGGGGGGG - Intronic
1173062533 20:39675930-39675952 TCTGGAAAGCAGGGAGGGTTGGG + Intergenic
1173181903 20:40812332-40812354 ATTGCAAAGCTGGGAGGGGTAGG + Intergenic
1175612805 20:60365439-60365461 CCTGCAGGGCAGGGAGGGGCTGG - Intergenic
1175682366 20:60999039-60999061 CCAGAAAAGCAGGGAGGAGCAGG + Intergenic
1175713111 20:61236821-61236843 CCTCCAAAGCAGGAAGAAGAGGG - Intergenic
1176024211 20:62977587-62977609 CCTGGAAAGCAGGGCCCGGAGGG + Intergenic
1176283468 20:64328257-64328279 CCTGCAGGGCAGAGAGGAGAGGG + Intergenic
1179386657 21:40949642-40949664 CCTCTAAAGAAGGGAGGTGATGG + Intergenic
1179421168 21:41238112-41238134 CCTGGAATGCAGGCAGGGGGTGG + Intronic
1179456583 21:41504916-41504938 CCTGGAAAGTAAGGAGGGGCGGG + Intronic
1179525167 21:41971308-41971330 CCTGCTACCCAGGCAGGGGAGGG + Intergenic
1179805449 21:43834401-43834423 CCTGCAGGGCGGGGAGGTGACGG - Intergenic
1179977192 21:44874837-44874859 CCTCGGAAGCGGGGAGGGGAAGG - Intergenic
1180155331 21:45974679-45974701 CCCACAAAGGAGGGAGGGGAGGG + Intergenic
1180600267 22:17010797-17010819 CCAGCTCAGCAGGGAGGGGAGGG - Intergenic
1181165279 22:20979868-20979890 TGTGCAAAGCAGGGAGGGCTGGG + Intronic
1181165955 22:20983005-20983027 CCTGGAAAGAAAGGAGTGGAGGG - Exonic
1181449917 22:23012870-23012892 GCTCCTAAGCAGGGAGGGGAGGG + Intergenic
1181477817 22:23179784-23179806 CCCGCAAGGCAGGGAGGGCCAGG - Intronic
1181711835 22:24696091-24696113 GCTGCAAAGCTGGTTGGGGAGGG - Intergenic
1182259494 22:29063009-29063031 TCTGCAAAGCAGGGACAGGAGGG + Intergenic
1182557280 22:31136046-31136068 CCAGCAAGGCAGAGAGGGGTGGG + Intronic
1182617873 22:31600696-31600718 CCTTCTAAACAGTGAGGGGAAGG - Intronic
1182662043 22:31932029-31932051 TCTGCAAAGGACAGAGGGGAGGG + Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1183460044 22:37944381-37944403 CCAGGAAAGTGGGGAGGGGAAGG - Intronic
1183518965 22:38285261-38285283 TCTGAAAAGGAAGGAGGGGAGGG - Intergenic
1183730304 22:39614772-39614794 CATGCAAAGGAGGGCAGGGAGGG - Intronic
1183829647 22:40410969-40410991 ACAGCAAAGCAGGGAGAGAAAGG + Exonic
1184122296 22:42459912-42459934 CTGGCAAGGCAGGGTGGGGAGGG - Intergenic
1184769610 22:46589582-46589604 CCTGCAAAGCAGGGGCAGCATGG - Intronic
1184851733 22:47124980-47125002 CCTGTAAAGGAGGGAGGGGCAGG + Intronic
1184998302 22:48226574-48226596 CCTGCAATGCTGGGTGGGCATGG - Intergenic
1184998320 22:48226666-48226688 CCTGCAATGCTGGGTGGGCATGG - Intergenic
1184998331 22:48226712-48226734 CCTGCAATGCTGGGTGGGCATGG - Intergenic
1184998340 22:48226758-48226780 CCTGCAATGCTGGGTGGGCATGG - Intergenic
1184998350 22:48226804-48226826 CCTGCAATGCTGGGTGGGCATGG - Intergenic
1184998358 22:48226850-48226872 CCTGCAATGCTGGGTGGGCATGG - Intergenic
1185173678 22:49307335-49307357 GCGGCAAGGCAGGGAGAGGAGGG + Intergenic
949273290 3:2246705-2246727 CATGAAAAGGAGAGAGGGGATGG + Intronic
950196894 3:11015650-11015672 CCTGCAAAGCAGAGAAGGGGAGG - Exonic
950540532 3:13609660-13609682 CCTTCAAGGCAGGGTGGGGTGGG + Intronic
950594347 3:13965637-13965659 ACTGGACAGCAGAGAGGGGATGG - Intronic
950716794 3:14853464-14853486 CCAGCCCAGCAGGGAGGGGAAGG - Intronic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
953850753 3:46464085-46464107 CCTGCAGCACCGGGAGGGGAAGG - Intronic
953877590 3:46675142-46675164 CCTGCAAGGCAGTGACAGGAAGG + Intronic
953902976 3:46853690-46853712 CTTGCGTAGCTGGGAGGGGACGG - Intergenic
954784215 3:53081281-53081303 CCAGCAAAGGAGGGAGGGCGAGG - Intronic
955086498 3:55707744-55707766 CCTGCGATGCAGGCAGGGGTGGG + Intronic
955406810 3:58630833-58630855 CAGGCAAAGAAGGGAGGGAAGGG - Intergenic
956420358 3:69080410-69080432 CTGGCAAAGCGGGGAGGGGCGGG + Intergenic
958119822 3:89270956-89270978 GCTGAAAAGGAGGAAGGGGAGGG + Intronic
960573443 3:119206879-119206901 CCAGCAAACCAGGGAGGCAAAGG + Intergenic
960695060 3:120388036-120388058 CGGGCAAACCACGGAGGGGATGG - Intergenic
960747644 3:120908094-120908116 CCGGCAAAGCTGGGAGGTGAAGG - Exonic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
960992875 3:123323195-123323217 TTTGCCCAGCAGGGAGGGGAAGG - Intronic
961325205 3:126105416-126105438 CCTGCATAGCAGGGAGGAGTTGG - Intronic
962268897 3:133963584-133963606 CCTTCTGAGCAGGGAGGGGATGG - Intronic
962732107 3:138293034-138293056 CTGGCAAAGCCTGGAGGGGAGGG - Intronic
963646474 3:147921202-147921224 ACTGCAAAACAGAGAGGGAAGGG + Intergenic
963913045 3:150831106-150831128 GCTGCAAAGGAAGGAAGGGAGGG - Intergenic
964889479 3:161518816-161518838 CCTAATATGCAGGGAGGGGAAGG - Intergenic
966732546 3:183162831-183162853 CCTACGGAGCAGGGAGGGGCGGG + Exonic
967891051 3:194364889-194364911 GCTGCAAAGCCCGCAGGGGAGGG + Intronic
967975864 3:195034592-195034614 TTTGAAAGGCAGGGAGGGGAGGG + Intergenic
968082913 3:195859338-195859360 CCAGGGAAGCTGGGAGGGGAAGG - Intergenic
968266713 3:197368544-197368566 CCTGCAAGGCAGGAAGGGGGAGG + Intergenic
969032429 4:4225866-4225888 CCTGCAAAGCCGGGAGGAGAAGG + Intronic
969268367 4:6080928-6080950 CCTAGAAACCTGGGAGGGGAAGG + Intronic
969498478 4:7539697-7539719 CCTCCACAGCAGGAAGGGGCGGG - Intronic
969498536 4:7539869-7539891 CCCCCACAGCAGGGAGGGGATGG - Intronic
969498552 4:7539919-7539941 CCTTCACAGCAGGAAGGGGGTGG - Intronic
969855534 4:9996364-9996386 AGAGCAGAGCAGGGAGGGGAGGG - Intronic
970195196 4:13544872-13544894 CCTGCCCAGCAGGGAAGGGGAGG - Exonic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
970640544 4:18060704-18060726 CTTCCAAAGTAGGGAGGGGAGGG - Intergenic
971255157 4:25007831-25007853 CCTGCAAAGGAGGAAGTGCATGG + Intronic
972357808 4:38297330-38297352 CCTGAAAATCAGGGTGGGGTGGG + Intergenic
972418471 4:38865513-38865535 ACGGCACAGCAGGGAAGGGAAGG + Intergenic
972596138 4:40531421-40531443 CCTGCCAAGCAGAGAGGGTTGGG + Intronic
972983200 4:44730481-44730503 CCAGGAAATCAGGTAGGGGAGGG - Intergenic
976088174 4:81427709-81427731 CCTGCAGATCATGGAGGGGCTGG - Exonic
976131085 4:81884626-81884648 GGTGCAGAGCAGGGAGAGGATGG + Intronic
976231186 4:82844995-82845017 ACTGCAAAAGAAGGAGGGGAAGG + Intronic
976496430 4:85735058-85735080 CCTGAAAAGGTGGGAGTGGAAGG - Intronic
978336920 4:107679082-107679104 GCTGTTATGCAGGGAGGGGAAGG + Intronic
978917780 4:114147495-114147517 CCAGCCCAGCAGGGAGGGGAGGG + Intergenic
980969348 4:139555393-139555415 CCAGCCAAGCAGGAAGGGGGAGG + Intronic
981079299 4:140622754-140622776 CCTGCAAAGGAGGGCGGGAGCGG - Exonic
981404448 4:144352142-144352164 CTTGGAAAGCAAGGTGGGGAGGG + Intergenic
981602636 4:146507821-146507843 CTTTCAAATTAGGGAGGGGAAGG + Intronic
982138437 4:152295015-152295037 ACAGCAAAGCAGATAGGGGAGGG - Intergenic
982563292 4:156957684-156957706 CCTGCATAGCTGGGATGGGCGGG + Intronic
984814162 4:183821716-183821738 CCTGCCTAGAGGGGAGGGGAGGG + Intergenic
985494247 5:195741-195763 GCTCCACAGCAGGGAGGGGGAGG + Intergenic
985838437 5:2288096-2288118 CCTGAAAAGCAAGGAGAGCAGGG - Intergenic
986311987 5:6557682-6557704 CATCCGAAGAAGGGAGGGGAAGG - Intergenic
986460358 5:7964024-7964046 CCTGCAACTCAGGTATGGGAGGG + Intergenic
986851251 5:11816584-11816606 AGTGCAGAGCAGGTAGGGGAGGG + Intronic
987303690 5:16618225-16618247 CCTGCACAGGATGGAAGGGAGGG + Intergenic
988539202 5:32094080-32094102 CCTGAGAAGGAGGGAGGGGTTGG + Intronic
990284985 5:54292219-54292241 ACAGCAAGGGAGGGAGGGGAGGG - Intronic
990545210 5:56815522-56815544 CCTGCGAGGGAGGGAGGGGGCGG - Intergenic
991604207 5:68383976-68383998 CCTGAAAAGCAGTGAGGGAATGG - Intergenic
992142535 5:73813439-73813461 CCTGCACACCAGGGAGGGAAAGG - Intronic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994031890 5:95152646-95152668 CCTTCAGGGCAGGGAGGTGAAGG + Intronic
994323629 5:98423172-98423194 GCTGCACAGCATGGGGGGGAGGG - Intergenic
994395510 5:99223216-99223238 CCTAATAAGCAGGGAGGGGAAGG - Intergenic
995336080 5:111001382-111001404 ACTGAAAAGCAGGAAGGGCAAGG + Intergenic
995600598 5:113791187-113791209 CCTGCAAAGCTGCTAGGAGAAGG + Intergenic
997201470 5:132012188-132012210 TCTGCAAACCAGTGAGGGGAGGG + Intronic
997411678 5:133695768-133695790 CCTGGTTTGCAGGGAGGGGAGGG - Intergenic
997443584 5:133925783-133925805 CCTGAAAGGGATGGAGGGGAGGG + Intergenic
997684514 5:135779315-135779337 CCTAATATGCAGGGAGGGGAAGG + Intergenic
998178112 5:139914456-139914478 CCTGGAAAGCAGCGAGAGGAAGG - Intronic
998522724 5:142815606-142815628 ACTGCAAAGGAAGCAGGGGAAGG - Intronic
999144525 5:149383550-149383572 CCTACCAGGGAGGGAGGGGAGGG - Intronic
999203781 5:149833910-149833932 GCTGAAAGCCAGGGAGGGGAAGG - Intronic
999370379 5:151051692-151051714 CTTGCAAAGGAAGGAAGGGAAGG + Intronic
999389987 5:151182856-151182878 CCCGCAAATCAGAGTGGGGAAGG - Exonic
999610697 5:153366155-153366177 ACTTCAAAGAAGGGAGGGGCCGG + Intergenic
1000244986 5:159441769-159441791 CCAGCAGGACAGGGAGGGGAGGG + Intergenic
1000980961 5:167816189-167816211 CCGGAACAGAAGGGAGGGGAAGG + Intronic
1001639751 5:173236075-173236097 GCTGCCAGGCAGGGAGGGCACGG - Intergenic
1002334450 5:178468337-178468359 GGTGCAAGACAGGGAGGGGATGG + Intronic
1002334858 5:178470592-178470614 GGTGCAAGACAGGGAGGGGATGG + Intronic
1002537028 5:179881418-179881440 CCTGCAGAGAAGGCAGGGGATGG - Intronic
1002598353 5:180338946-180338968 TCTGCAAATCAGGGAGTGCATGG - Intronic
1002788304 6:420443-420465 CCTGGAAAGCAGGGAGGGTCAGG - Intergenic
1003157448 6:3608456-3608478 GCTGGAAAGCAGGGAGGGTTTGG - Intergenic
1004864814 6:19842627-19842649 CTTGCAAAGCAGAAACGGGAAGG - Intergenic
1005320350 6:24646712-24646734 CCTGCAAGGCCTGGAGGTGATGG - Intergenic
1006312192 6:33268649-33268671 CCTGGTTAGCAGGGAGGGGTGGG + Exonic
1007096305 6:39215311-39215333 CCTTCAGAGCAGCGAGTGGAAGG - Intronic
1007410000 6:41656018-41656040 CCTGCGGAGCAGGGAGGGCCAGG - Intergenic
1008960579 6:57261753-57261775 GCTCCAAAGCAGGGAGGGAATGG - Intergenic
1010030836 6:71269226-71269248 CCTGACAAGCTGGGAGGGGTTGG - Intergenic
1010696944 6:78987584-78987606 CCTGTAAAGAAGGAAGGTGATGG + Intronic
1012258045 6:97056478-97056500 CCTGGAAAGGAGTGACGGGAAGG - Intronic
1013540790 6:111106747-111106769 GCTGCAATGCAGGGAGGAAAGGG - Intronic
1013556887 6:111265147-111265169 ACAGCAAAGCAGGGAAGGGAGGG - Intronic
1013644499 6:112123139-112123161 CTTTCAAAGCAGGGAGGGAGTGG + Intronic
1013845462 6:114445267-114445289 CCTGTAAAGTAGAGAGGGAAGGG + Intergenic
1014633342 6:123814138-123814160 CCTACAAGGCAGGGGGTGGAGGG + Intronic
1015213329 6:130721875-130721897 TATGCAAACCAGGGTGGGGAAGG - Intergenic
1015999570 6:139029218-139029240 TCTGCAGAGCTGGGTGGGGAAGG + Intronic
1016486299 6:144543295-144543317 CCTGGGAAGCAGGTGGGGGATGG + Intronic
1016688055 6:146903638-146903660 CCTGCAAAGGCGGGAGGGACTGG - Intergenic
1017097030 6:150813491-150813513 CCGGCAGAGCTGGTAGGGGAAGG + Intronic
1017822111 6:158057056-158057078 CCCGCAGAGCGGGGCGGGGAAGG - Intronic
1018332542 6:162746675-162746697 TGTGCAAAGCACCGAGGGGAGGG - Intronic
1018991451 6:168676916-168676938 CTTGCCCTGCAGGGAGGGGATGG - Intergenic
1019275058 7:171784-171806 CCTGGAAAGCAGTGAGAGAAGGG - Intergenic
1019337675 7:493028-493050 CCAGCAATACAGGGAGGGGCTGG - Intergenic
1019516812 7:1443807-1443829 CCTGCAGAGCTGTGAGGGGGTGG + Intronic
1019607818 7:1918875-1918897 CCTGTAGAGAGGGGAGGGGAGGG - Intronic
1019649788 7:2150579-2150601 CGTGCAAAACAGGCATGGGATGG - Intronic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1020084654 7:5303802-5303824 CCTGGAACGTAGGGAGGGGCTGG + Exonic
1020257712 7:6511095-6511117 CCTCCAAAACAGGGAGGGGAGGG + Intronic
1020407988 7:7858380-7858402 CCTGCAAAGAGGGCAGAGGAGGG + Intronic
1021715824 7:23461234-23461256 CCAGCAAAGGAGGGTGAGGAAGG - Intronic
1022177406 7:27885011-27885033 TCTGCACAGGAAGGAGGGGAGGG + Intronic
1022340088 7:29459744-29459766 CCTGCCATGCAGGGAGGAGAGGG - Intronic
1022355333 7:29609334-29609356 TCCGCAACGCAGGGAGGAGACGG + Intergenic
1022466287 7:30655080-30655102 CCTGGAAAGGAGGGAAAGGAGGG + Exonic
1023417744 7:39949140-39949162 CCCGCAAAACAGGGTGGAGATGG - Intergenic
1023792369 7:43763171-43763193 CCTTCAAACCAGAGAGGGGATGG - Intronic
1024343127 7:48287064-48287086 TCTGCGCAGCAGGGAGGGGAGGG + Intronic
1024690959 7:51802906-51802928 TCTGGAAAGCAGCCAGGGGAGGG - Intergenic
1025333606 7:58355982-58356004 CCTACAAAACAGGGTGGGGGTGG + Intergenic
1027156490 7:75772003-75772025 CCTAAAAATCAGGGAGAGGAAGG + Exonic
1027873633 7:83742565-83742587 CCTGCAAAGGATGGTGGAGAAGG - Intergenic
1027874536 7:83751569-83751591 CCTGCTAAGCAGGAAAGAGAAGG - Intergenic
1029279898 7:99428876-99428898 ACTGCAAAGCAGGGTGGGAGGGG + Intronic
1029448558 7:100627974-100627996 CCTGGAAAAAGGGGAGGGGAGGG + Exonic
1029881983 7:103823453-103823475 CTTCCAAAATAGGGAGGGGAAGG - Intronic
1030074393 7:105723890-105723912 GCTGCAAAGTAGGGAGGAAAAGG + Intronic
1030080680 7:105775189-105775211 CCTGCAAAGGAGCAAGGGAAAGG + Intronic
1030120843 7:106109508-106109530 CCTGCAAAGGAGAGAAGGAATGG - Intronic
1030215523 7:107041342-107041364 CCTAGAAGGAAGGGAGGGGAGGG + Intergenic
1031841596 7:126747829-126747851 TCTGGAAAGCAAGGAGGCGATGG - Intronic
1031946792 7:127850578-127850600 CCTTCAAAGCAGGGCAGGAAGGG - Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032037927 7:128532916-128532938 TCTTCCAAGCAGGGAGGGGCAGG - Intergenic
1032840071 7:135706300-135706322 CCTGGAAGGCAGGGAGGGTTGGG + Exonic
1033321412 7:140343107-140343129 CCTGGAAAGAAAGAAGGGGATGG + Intronic
1033756662 7:144402217-144402239 CCTGCTTTGCAGGGAGGGGGAGG - Intronic
1034046661 7:147936600-147936622 CCTCAAAATGAGGGAGGGGAGGG - Intronic
1034172299 7:149071802-149071824 CCAGCACAGCCGGGAGGGGCCGG - Exonic
1034190630 7:149210723-149210745 CGTCCACACCAGGGAGGGGAGGG + Intronic
1034733344 7:153406977-153406999 TCTGCAAAGGAGGAAGGGGTTGG - Intergenic
1034788076 7:153943496-153943518 CCTCCCAAGTAGGGAGGGCAGGG + Intronic
1035076458 7:156180805-156180827 CCTGTGATACAGGGAGGGGAAGG - Intergenic
1035127178 7:156616867-156616889 GCTGCGCTGCAGGGAGGGGACGG - Intergenic
1035432204 7:158830226-158830248 CCTGACAAGCAGGGTGGGAAGGG - Intronic
1035493580 7:159301353-159301375 CATTCAAAGCAGTGTGGGGAGGG + Intergenic
1035680623 8:1484892-1484914 ACGGCAGAGCAGGAAGGGGAGGG - Intergenic
1036153336 8:6319179-6319201 CTTGCAAAAAAGGGAGGGGGAGG + Intergenic
1037667084 8:20979054-20979076 CCTTAAAAGAAGGGAAGGGATGG + Intergenic
1037789287 8:21922014-21922036 TCTGCAATGCATTGAGGGGAGGG + Intronic
1037904240 8:22706067-22706089 CATTCCAAGCTGGGAGGGGACGG - Intergenic
1038829101 8:31036990-31037012 CATCCACAGGAGGGAGGGGATGG + Intronic
1039560754 8:38510638-38510660 TGTGCAGAGCAGGGAGGGGAAGG + Intergenic
1040481711 8:47832969-47832991 CCTGCAAAGCAGGGAGTCCAGGG + Intronic
1041045346 8:53881884-53881906 ACTGGAAAGCAGGGGGCGGAGGG + Intronic
1041142947 8:54842553-54842575 GATGCAAAGGAAGGAGGGGAAGG - Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1043728708 8:83647335-83647357 TCTGGAAAGCAGGGACTGGAGGG - Intergenic
1043745468 8:83869153-83869175 CCTGCCAACCAGGAAGGGGCGGG - Intergenic
1044167872 8:89010333-89010355 CCTGCTAAACAGAGAGGGTATGG + Intergenic
1044628230 8:94255412-94255434 CGTGCTGAGCAGGGAGGAGATGG - Intronic
1045367645 8:101492168-101492190 TCTCCAAAGCAGGGATGGGAAGG - Intergenic
1045936133 8:107681579-107681601 ACTGCAAAAGAGGGAAGGGAAGG - Intergenic
1046958727 8:120087468-120087490 CCTACACAGAAGGCAGGGGAAGG - Intronic
1048048777 8:130797675-130797697 CTTGCAAGGTGGGGAGGGGAAGG - Intronic
1049012212 8:139894547-139894569 CCTGCAGCGGAGGGAGGGGGGGG + Intronic
1049306041 8:141904828-141904850 CCTGCCAGGCAGGGAGGGGCAGG + Intergenic
1049312458 8:141940459-141940481 CTTGGAGAGGAGGGAGGGGAGGG - Intergenic
1049622345 8:143604331-143604353 CCTGGGAACCAGGCAGGGGAGGG + Exonic
1049729078 8:144166730-144166752 ACTGCAAAGCAGTGAGGAGGTGG + Intronic
1049742634 8:144248441-144248463 CCTGCAGAGGAAGGAGGGGTAGG + Intronic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1051139418 9:13962379-13962401 GCTGCAAAGCTGAGGGGGGAAGG + Intergenic
1051823723 9:21195707-21195729 ACAGAAAAGCAGGGAGGAGAGGG + Intergenic
1052769223 9:32672080-32672102 CCTGAAAGGCAGGGAGGTGTCGG - Intergenic
1053328782 9:37183984-37184006 CCTGCACAGTAGAGAGGGGTTGG + Intronic
1053652360 9:40181969-40181991 CCTGCAAAGGAAGCAGGAGAAGG + Intergenic
1053902756 9:42811281-42811303 CCTGCAAAGGAAGCAGGAGAAGG + Intergenic
1054532222 9:66194246-66194268 CCTGCAAAGGAAGCAGGAGAAGG - Intergenic
1056523930 9:87425278-87425300 TTTGCAAAGGAAGGAGGGGAGGG + Intergenic
1057314642 9:93960527-93960549 ACTGCAAGGCCGGGCGGGGATGG + Intergenic
1057547164 9:96027280-96027302 CCGGCAAAGCAGGTGGGAGACGG + Intergenic
1057828511 9:98389593-98389615 CTGGCACAGCAGGGAGAGGAAGG - Intronic
1058361641 9:104154145-104154167 CCTGGAAAGCAAGGAGGACAGGG + Intergenic
1060187494 9:121572678-121572700 CCTGAAAAACAGGCAGGGCAGGG - Intronic
1060188553 9:121578171-121578193 CCCTGACAGCAGGGAGGGGATGG + Intronic
1060228276 9:121809339-121809361 CCAGCACAGCAGAGCGGGGAAGG - Intergenic
1060478494 9:124002037-124002059 GCTGCCAAGCAGGCTGGGGATGG + Intronic
1061009299 9:127945753-127945775 CCTGGAAGGCAGGAAGGGGCAGG + Exonic
1061396541 9:130346815-130346837 GCTGAAAAGCAGGGAGGGCAGGG + Intronic
1061547099 9:131310788-131310810 CCTCTAAAGCTTGGAGGGGACGG + Intergenic
1061673528 9:132202507-132202529 CCTGGAAGGCAGGCAGGGGGTGG + Intronic
1061675691 9:132214344-132214366 CCTGCGCTGCAGGGAGGGGCAGG - Intronic
1061770797 9:132919691-132919713 CCTGCACAGGAGAGAGGCGAAGG + Intronic
1061920423 9:133779564-133779586 GCAGCAAGGCAGGAAGGGGATGG + Intronic
1062021143 9:134319958-134319980 GCTGAGACGCAGGGAGGGGAGGG - Intronic
1062109784 9:134775818-134775840 CCTTCAGACCAGGGAGGTGAGGG - Intronic
1062290383 9:135791735-135791757 CCTGCAGAGCTGGGAGGGGCAGG + Intronic
1062400294 9:136369860-136369882 CCTGCAGTGCATGGAGGAGAAGG - Exonic
1062476871 9:136732668-136732690 CAGCCAAAGCAGGGAGGGGAAGG - Intergenic
1062497936 9:136840417-136840439 CCCGCGCAGCAGGGAGAGGACGG + Exonic
1062662128 9:137642885-137642907 CCTGTCAAGAGGGGAGGGGAGGG - Intronic
1062722433 9:138051376-138051398 CATGCAGAGCAGGGACGGCAAGG - Intronic
1062736844 9:138142107-138142129 CCAGCCCAGCAGGGAGGGGAGGG - Intergenic
1185435970 X:95352-95374 CCTGCAAGGGTGGGAGGGGCTGG - Intergenic
1185444288 X:249670-249692 CCTGCAAGGGTGGGAGGGGCTGG + Intergenic
1185786424 X:2895099-2895121 TCTGCAAAGCACGGAGAGCAAGG + Intergenic
1185787591 X:2903890-2903912 CCTTCAAAGCTGGGGGGTGAAGG + Intergenic
1186473031 X:9836074-9836096 CCTGGAGAGCGGGGAGGGGAGGG + Intronic
1187397450 X:18930929-18930951 CCGGGGAGGCAGGGAGGGGAAGG - Intronic
1187473269 X:19588216-19588238 CCTGCAGAGCAGTGAGGGTCAGG + Intronic
1188966394 X:36558456-36558478 GGTGCTAAGCAGGGAGTGGAGGG - Intergenic
1189826711 X:44926071-44926093 GCTGCAAAACAAGGAAGGGAGGG - Intronic
1192485943 X:71526041-71526063 TGTGCAAAGTAGGGAGGGCAGGG + Intronic
1192738945 X:73874941-73874963 CCTGCAGGCCAGGGAGGGAATGG + Intergenic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1196989379 X:121311439-121311461 CCTGGAGAGCAGTGAGGGAAGGG - Intergenic
1197366172 X:125567177-125567199 CATCCCCAGCAGGGAGGGGAAGG + Intergenic
1197782437 X:130171659-130171681 CCGGGAATGCAGGCAGGGGAGGG + Exonic
1197862388 X:130984663-130984685 CCAGCAAAGCCTGCAGGGGAAGG + Intergenic
1198054929 X:132984604-132984626 CATGCAGAACAGGAAGGGGAAGG + Intergenic
1198076128 X:133194822-133194844 CCTGCAAGGCAGGGAGCCAACGG + Intergenic
1198321420 X:135521649-135521671 GATGGAAAGGAGGGAGGGGAGGG + Intronic
1199699757 X:150366245-150366267 CCTCCAGAGATGGGAGGGGAGGG - Intronic
1200005681 X:153082841-153082863 GCTGCAGGGCAGGGTGGGGAGGG - Intergenic
1200399056 X:156008158-156008180 ACAGCCCAGCAGGGAGGGGAGGG - Intronic